junctionAlignment - Calculate junction region alignment properties
Description¶
junctionAlignment determines the number of deleted germline nucleotides in the 
junction region and the number of V gene and J gene nucleotides in the CDR3.
Usage¶
junctionAlignment(
data,
germline_db,
v_call = "v_call",
d_call = "d_call",
j_call = "j_call",
v_germline_start = "v_germline_start",
v_germline_end = "v_germline_end",
d_germline_start = "d_germline_start",
d_germline_end = "d_germline_end",
j_germline_start = "j_germline_start",
j_germline_end = "j_germline_end",
np1_length = "np1_length",
np2_length = "np2_length",
junction = "junction",
junction_length = "junction_length",
sequence_alignment = "sequence_alignment"
)
Arguments¶
- data
 data.framecontaining sequence data.- germline_db
 - reference germline database for the V, D and J genes.
in 
data - v_call
 - V gene assignment column.
 - d_call
 - D gene assignment column.
 - j_call
 - J gene assignment column.
 - v_germline_start
 - column containing the start position of the alignment in the V reference germline.
 - v_germline_end
 - column containing the end position of the alignment in the V reference germline.
 - d_germline_start
 - column containing the start position of the alignment in the D reference germline.
 - d_germline_end
 - column containing the start position of the alignment in the D reference germline.
 - j_germline_start
 - column containing the start position of the alignment in the J reference germline.
 - j_germline_end
 - column containing the start position of the alignment in the J reference germline.
 - np1_length
 - combined length of the N and P regions between the V and D regions (heavy chain) or V and J regions (light chain).
 - np2_length
 - combined length of the N and P regions between the D and J regions (heavy chain).
 - junction
 - column containing the junction sequence.
 - junction_length
 - column containing the length of the junction region in nucleotides.
 - sequence_alignment
 - column containing the aligned sequence.
 
Value¶
A modified input data.frame with the following additional columns storing 
junction alignment information:
e3v_length: number of 3’ V germline nucleotides deleted.e5d_length: number of 5’ D germline nucleotides deleted.e3d_length: number of 3’ D germline nucleotides deleted.e5j_length: number of 5’ J germline nucleotides deleted.v_cdr3_length: number of sequence_alignment V nucleotides in the CDR3.j_cdr3_length: number of sequence_alignment J nucleotides in the CDR3.
Examples¶
germline_db <- list(
"IGHV3-11*05"="CAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCAAGCCTGGAGGGTCCCTGAGACT
CTCCTGTGCAGCCTCTGGATTCACCTTC............AGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAG
GGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......AGTAGTTACACAAACTACGCAGACTCTGTGAAG
...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGA
CACGGCCGTGTATTACTGTGCGAGAGA",
"IGHD3-10*01"="GTATTACTATGGTTCGGGGAGTTATTATAAC",
"IGHJ5*02"="ACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG"
)
db <- junctionAlignment(SingleDb, germline_db)