6.3.3.10. sam2bed

The sam2bed script converts 1-based, closed [start, end] Sequence Alignment/Map (SAM) to sorted, 0-based, half-open [start-1, end) UCSC BED data.

For convenience, we also offer sam2starch, which performs the extra step of creating a Starch-formatted archive.

The sam2bed script is “non-lossy” (with the use of specific options, described below). Other toolkits tend to throw out information from the original SAM input upon conversion; sam2bed retains everything, facilitating reuse of converted data and conversion to other formats.

Tip

Doing the extra step of creating a Starch-formatted archive can save a lot of space relative to the original SAM format, up to 33% of the original SAM dataset, while offering per-chromosome random access.

6.3.3.10.1. Dependencies

The sam2bed wrapper script is dependent upon the installation of SAMtools and convert2bed. The sam2starch wrapper script is further dependent on the installation of the starch binary, part of a typical BEDOPS installation.

6.3.3.10.2. Source

The sam2bed and sam2starch conversion scripts are part of the binary and source downloads of BEDOPS. See the Installation documentation for more details.

6.3.3.10.3. Usage

The sam2bed script parses SAM data from standard input and prints sorted BED to standard output. The sam2starch script uses an extra step to parse SAM to a compressed BEDOPS Starch-formatted archive, which is also directed to standard output.

The header data of a SAM file is usually discarded, unless you add the --keep-header option. In this case, BED elements are created from these data, using the chromosome name _header to denote content. Line numbers are specified in the start and stop coordinates, and unmodified header data are placed in the fourth column (ID field).

Tip

If you work with RNA-seq data, you can use the --split option to process reads with N-CIGAR operations, splitting them into separate BED elements.

Tip

By default, all conversion scripts now output sorted BED data ready for use with BEDOPS utilities. If you do not want to sort converted output, use the --do-not-sort option. Run the script with the --help option for more details.

Tip

If sorting converted data larger than system memory, use the --max-mem option to limit sort memory usage to a reasonable fraction of available memory, e.g., --max-mem 2G or similar. See --help for more details.

6.3.3.10.4. Example

To demonstrate these scripts, we use a sample binary input called foo.sam (see the Downloads section to grab this file).

@HD     VN:1.0 SO:coordinate
@SQ     SN:seq1 LN:5000
@SQ     SN:seq2 LN:5000
@CO     Example of SAM/BAM file format.
B7_591:4:96:693:509     73      seq1    1       99      36M     *       0       0       CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG    <<<<<<<<<<<<<<<;<<<<<<<<<5<<<<<;:<;7    MF:i:18 Aq:i:73 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
EAS54_65:7:152:368:113  73      seq1    3       99      35M     *       0       0       CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT     <<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6):     MF:i:18 Aq:i:66 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
EAS51_64:8:5:734:57     137     seq1    5       99      35M     *       0       0       AGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCC     <<<<<<<<<<<7;71<<;<;;<7;<<3;);3*8/5     MF:i:18 Aq:i:66 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
...

We can convert it to sorted BED data in the following manner (omitting standard error messages):

$ sam2bed < foo.sam
seq1    0       36      B7_591:4:96:693:509     99      +       73      36M     *       0       0       CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG    <<<<<<<<<<<<<<<;<<<<<<<<<5<<<<<;:<;7    MF:i:18 Aq:i:73 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
seq1    2       37      EAS54_65:7:152:368:113  99      +       73      35M     *       0       0       CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT     <<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6):     MF:i:18 Aq:i:66 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
seq1    4       39      EAS51_64:8:5:734:57     99      +       137      35M     *       0       0       AGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCC     <<<<<<<<<<<7;71<<;<;;<7;<<3;);3*8/5     MF:i:18 Aq:i:66 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
seq1    5       41      B7_591:1:289:587:906    63      +       137      36M     *       0       0       GTGGCTCATTGTAATTTTTTGTTTTAACTCTTCTCT    (-&----,----)-)-),'--)---',+-,),''*,    MF:i:130        Aq:i:63 NM:i:5  UQ:i:38 H0:i:0  H1:i:0
...

Note also that we strip the header section from the output. If we want to keep this, the use of the --keep-header option will preserve the BAM file’s header, turning it into BED elements that use _header as a chromosome name.

Here’s an example:

$ sam2bed --keep-header < foo.sam
_header 0       1       @HD     VN:1.0 SO:coordinate
_header 1       2       @SQ     SN:seq1 LN:5000
_header 2       3       @SQ     SN:seq2 LN:5000
_header 3       4       @CO     Example of SAM/BAM file format.
seq1    0       36      B7_591:4:96:693:509     99      +       73      36M     *       0       0       CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG    <<<<<<<<<<<<<<<;<<<<<<<<<5<<<<<;:<;7    MF:i:18 Aq:i:73 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
seq1    2       37      EAS54_65:7:152:368:113  99      +       73      35M     *       0       0       CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT     <<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6):     MF:i:18 Aq:i:66 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
seq1    4       39      EAS51_64:8:5:734:57     99      +       137      35M     *       0       0       AGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCC     <<<<<<<<<<<7;71<<;<;;<7;<<3;);3*8/5     MF:i:18 Aq:i:66 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
seq1    5       41      B7_591:1:289:587:906    63      +       137      36M     *       0       0       GTGGCTCATTGTAATTTTTTGTTTTAACTCTTCTCT    (-&----,----)-)-),'--)---',+-,),''*,    MF:i:130        Aq:i:63 NM:i:5  UQ:i:38 H0:i:0  H1:i:0
...

With this option, the sam2bed and sam2starch scripts are completely “non-lossy” (with the exception of unmapped reads; see note below). Use of awk or other scripting tools can munge these data back into a SAM-formatted file.

Note

The provided scripts strip out unmapped reads from the SAM file. We believe this makes sense under most circumstances. Add the --all-reads option if you need unmapped and mapped reads.

Note

Note the conversion from 1- to 0-based coordinates. While BEDOPS fully supports 0- and 1-based coordinates, the coordinate change in BED is believed to be convenient to most end users.

6.3.3.10.5. Column mapping

In this section, we describe how SAM columns are mapped to BED columns. We start with the first six UCSC BED columns as follows:

SAM field

BED column index

BED field

RNAME

1

chromosome

POS - 1

2

start

POS + length(SEQ) - 1

3

stop

QNAME

4

id

MAPQ

5

score

16 & FLAG

6

strand

The remaining SAM columns are mapped as-is, in same order, to adjacent BED columns:

SAM field

BED column index

BED field

FLAG

7

CIGAR

8

RNEXT

9

PNEXT

10

TLEN

11

SEQ

12

QUAL

13

Because we have mapped all columns, we can translate converted BED data back to headered or headerless SAM reads with a simple awk statement (or other script) that reverts back to 1-based coordinates and permutes columns to SAM-based ordering.

6.3.3.10.6. Downloads