#################### Definition downloads #################### The sequence definition database defines alleles, i.e. links an allele identifier to a sequence. It also defines scheme, e.g. MLST, profiles. .. _download_alleles: *************************** Allele sequence definitions *************************** Click the 'Allele sequences' link in the 'Downloads' section. Depending on the database, you may see either a hierarchical scheme tree or a table of loci. You can choose to display links either by scheme using the scheme tree, as an alphabetical list or a page of all schemes, by selecting the approrpiate link at the top of the page. Scheme tree =========== .. image:: /images/data_downloads/alleles.png You can drill down through the tree by clicking branch nodes. Clicking the labels of internal nodes will display tables of all schemes belonging to that scheme group. Clicking the labels of terminal nodes will display that single scheme table. .. image:: /images/data_downloads/alleles2.png Click the download link for the required locus .. image:: /images/data_downloads/alleles3.png Alleles will be downloaded in FASTA format, e.g. :: >fumC_1 GAAGCCTTGGGCGGACGCGATGCCGCCGTTGCCGCTTCGGGCGCATTGAAAACGCTGGCG GCAAGCCTGAATAAAATCGCCAACGACATCCGCTGGCTGGCAAGCGGCCCGCGCTGCGGT TTGGGCGAAATCAAAATCCCCGAAAACGAGCCGGGTTCGTCCATCATGCCGGGCAAAGTC AACCCGACCCAATGCGAAGCGATGACCATGGTGTGCTGCCAAGTGTTCGGCAACGACGTT ACCATCGGTATGGCGGGCGCGTCGGGCAATTTCGAGCTGAACGTCTATATGCCCGTCATC GCCTACAACCTCTTGCAATCCATCCGCCTGTTGGGCGACGCGTGCAACAGCTTCAACGAA CACTGCGCCGTCGGCATTGAACCCGTACCGGAAAAAATCGACTATTTCCTGCACCATTCC CTGATGCTCGTTACCGCGTTAAACCGCAAAATCGGTTACGAAAAC >fumC_2 GAAGCCTTGGGCGGACGCGATGCCGCCGTTGCCGCTTCGGGCGCATTGAAAACGCTGGCG GCAAGCCTGAATAAAATCGCCAACGACATCCGCTGGCTGGCAAGCGGCCCGCGCTGCGGT TTGGGCGAAATCAAAATCCCCGAAAACGAGCCGGGTTCGTCCATCATGCCGGGCAAAGTC AACCCGACCCAATGCGAAGCGATGACCATGGTGTGCTGCCAAGTGTTCGGCAACGACGTT ACCATCGGCATGGCGGGCGCGTCGGGCAATTTCGAGCTGAACGTCTATATGCCCGTTATC GCCTACAACCTCTTGCAATCCATCCGCCTCTTGGGCGACGCGTGCAACAGCTTCAACGAA CACTGCGCCATCGGCATCGAACCCGTACCGGAAAAAATCGACTATTTCCTGCACCATTCC CTGATGCTCGTTACCGCGTTAAACCGCAAAATCGGTTACGAAAAC >fumC_3 GAAGCCTTGGGCGGACGCGATGCCGCCGTTGCCGCTTCGGGCGCATTGAAAACGCTGGCG GCAAGCCTGAATAAAATCGCCAACGACATCCGCTGGCTGGCAAGCGGCCCGCGCTGCGGT TTGGGCGAAATCAAAATCCCCGAAAACGAGCCGGGTTCGTCCATCATGCCGGGCAAAGTC AACCCGACCCAATGCGAAGCGATGACCATGGTGTGCTGCCAAGTGTTCGGCAACGACGTT ACCATCGGCATGGCGGGCGCGTCGGGCAATTTCGAGCTGAACGTCTATATGCCCGTTATC GCCTACAACCTCTTGCAATCCATCCGCCTGTTGGGCGACGCGTGCAACAGCTTCAACGAA CACTGCGCCGTCGGCATCGAACCCGTACCGGAAAAAATCGACTATTTCCTGCACCATTCC CTGATGCTGGTTACTGCGTTAAACCGTAAAATCGGCTACGAAAAC Alphabetical list ================= Loci can be displayed in an alphabetical list. Loci will be grouped in to tables by initial letter. If common names are set for loci, they will be listed by both primary and common names. .. image:: /images/data_downloads/alleles4.png Click the download links for the required locus. All loci by scheme ================== Loci can also be displayed by scheme with all schemes displayed. .. image:: /images/data_downloads/alleles5.png Click the green download links for the required locus. Download locus table ==================== The locus table can be downloaded in tab-delimited text or Excel formats by clicking the links following table display. .. image:: /images/data_downloads/alleles6.png ************************** Scheme profile definitions ************************** Scheme profiles, e.g. those for MLST, can be downloaded by clicking the appropriate link on the contents page. .. image:: /images/data_downloads/profiles.png If multiple schemes are available, you will need to select the scheme in the dropdown box and click 'Download profiles' .. image:: /images/data_downloads/profiles2.png Profiles will be downloaded in tab-delimited format, e.g. :: ST abcZ adk aroE fumC gdh pdhC pgm clonal_complex 1 1 3 1 1 1 1 3 ST-1 complex/subgroup I/II 2 1 3 4 7 1 1 3 ST-1 complex/subgroup I/II 3 1 3 1 1 1 23 13 ST-1 complex/subgroup I/II 4 1 3 3 1 4 2 3 ST-4 complex/subgroup IV 5 1 1 2 1 3 2 3 ST-5 complex/subgroup III 6 1 1 2 1 3 2 11 ST-5 complex/subgroup III 7 1 1 2 1 3 2 19 ST-5 complex/subgroup III 8 2 3 7 2 8 5 2 ST-8 complex/Cluster A4 9 2 3 8 10 8 5 2 ST-8 complex/Cluster A4 10 2 3 4 2 8 15 2 ST-8 complex/Cluster A4 11 2 3 4 3 8 4 6 ST-11 complex/ET-37 complex 12 4 3 2 16 8 11 20 13 4 10 15 7 8 11 1 ST-269 complex 14 4 1 15 7 8 11 1 ST-269 complex