Definition downloads

The sequence definition database defines alleles, i.e. links an allele identifier to a sequence. It also defines scheme, e.g. MLST, profiles.

Allele sequence definitions

Click the ‘Allele sequences’ link in the ‘Downloads’ section.

../_images/download_alleles.png

Depending on the database, you may see either a hierarchical scheme tree or a table of loci. You can choose to display links either by scheme using the scheme tree, as an alphabetical list or a page of all schemes, by selecting the approrpiate link at the top of the page.

Scheme tree

../_images/alleles.png

You can drill down through the tree by clicking branch nodes. Clicking the labels of internal nodes will display tables of all schemes belonging to that scheme group. Clicking the labels of terminal nodes will display that single scheme table.

../_images/alleles2.png

Click the download link for the required locus

../_images/alleles3.png

Alleles will be downloaded in FASTA format, e.g.

>fumC_1
GAAGCCTTGGGCGGACGCGATGCCGCCGTTGCCGCTTCGGGCGCATTGAAAACGCTGGCG
GCAAGCCTGAATAAAATCGCCAACGACATCCGCTGGCTGGCAAGCGGCCCGCGCTGCGGT
TTGGGCGAAATCAAAATCCCCGAAAACGAGCCGGGTTCGTCCATCATGCCGGGCAAAGTC
AACCCGACCCAATGCGAAGCGATGACCATGGTGTGCTGCCAAGTGTTCGGCAACGACGTT
ACCATCGGTATGGCGGGCGCGTCGGGCAATTTCGAGCTGAACGTCTATATGCCCGTCATC
GCCTACAACCTCTTGCAATCCATCCGCCTGTTGGGCGACGCGTGCAACAGCTTCAACGAA
CACTGCGCCGTCGGCATTGAACCCGTACCGGAAAAAATCGACTATTTCCTGCACCATTCC
CTGATGCTCGTTACCGCGTTAAACCGCAAAATCGGTTACGAAAAC
>fumC_2
GAAGCCTTGGGCGGACGCGATGCCGCCGTTGCCGCTTCGGGCGCATTGAAAACGCTGGCG
GCAAGCCTGAATAAAATCGCCAACGACATCCGCTGGCTGGCAAGCGGCCCGCGCTGCGGT
TTGGGCGAAATCAAAATCCCCGAAAACGAGCCGGGTTCGTCCATCATGCCGGGCAAAGTC
AACCCGACCCAATGCGAAGCGATGACCATGGTGTGCTGCCAAGTGTTCGGCAACGACGTT
ACCATCGGCATGGCGGGCGCGTCGGGCAATTTCGAGCTGAACGTCTATATGCCCGTTATC
GCCTACAACCTCTTGCAATCCATCCGCCTCTTGGGCGACGCGTGCAACAGCTTCAACGAA
CACTGCGCCATCGGCATCGAACCCGTACCGGAAAAAATCGACTATTTCCTGCACCATTCC
CTGATGCTCGTTACCGCGTTAAACCGCAAAATCGGTTACGAAAAC
>fumC_3
GAAGCCTTGGGCGGACGCGATGCCGCCGTTGCCGCTTCGGGCGCATTGAAAACGCTGGCG
GCAAGCCTGAATAAAATCGCCAACGACATCCGCTGGCTGGCAAGCGGCCCGCGCTGCGGT
TTGGGCGAAATCAAAATCCCCGAAAACGAGCCGGGTTCGTCCATCATGCCGGGCAAAGTC
AACCCGACCCAATGCGAAGCGATGACCATGGTGTGCTGCCAAGTGTTCGGCAACGACGTT
ACCATCGGCATGGCGGGCGCGTCGGGCAATTTCGAGCTGAACGTCTATATGCCCGTTATC
GCCTACAACCTCTTGCAATCCATCCGCCTGTTGGGCGACGCGTGCAACAGCTTCAACGAA
CACTGCGCCGTCGGCATCGAACCCGTACCGGAAAAAATCGACTATTTCCTGCACCATTCC
CTGATGCTGGTTACTGCGTTAAACCGTAAAATCGGCTACGAAAAC

Alphabetical list

Loci can be displayed in an alphabetical list. Loci will be grouped in to tables by initial letter. If common names are set for loci, they will be listed by both primary and common names.

../_images/alleles4.png

Click the download links for the required locus.

All loci by scheme

Loci can also be displayed by scheme with all schemes displayed.

../_images/alleles5.png

Click the green download links for the required locus.

Download locus table

The locus table can be downloaded in tab-delimited text or Excel formats by clicking the links following table display.

../_images/alleles6.png

Scheme profile definitions

Scheme profiles, e.g. those for MLST, can be downloaded by clicking the appropriate link on the contents page.

../_images/profiles.png

If there is only one scheme available, the link will directly download the profiles. If multiple schemes are available, the link will take you to an intermediate page from where you can select the scheme to download.

../_images/profiles2.png

Profiles will be downloaded in tab-delimited format, e.g.

ST    abcZ    adk     aroE    fumC    gdh     pdhC    pgm     clonal_complex
1     1       3       1       1       1       1       3       ST-1 complex/subgroup I/II
2     1       3       4       7       1       1       3       ST-1 complex/subgroup I/II
3     1       3       1       1       1       23      13      ST-1 complex/subgroup I/II
4     1       3       3       1       4       2       3       ST-4 complex/subgroup IV
5     1       1       2       1       3       2       3       ST-5 complex/subgroup III
6     1       1       2       1       3       2       11      ST-5 complex/subgroup III
7     1       1       2       1       3       2       19      ST-5 complex/subgroup III
8     2       3       7       2       8       5       2       ST-8 complex/Cluster A4
9     2       3       8       10      8       5       2       ST-8 complex/Cluster A4
10    2       3       4       2       8       15      2       ST-8 complex/Cluster A4
11    2       3       4       3       8       4       6       ST-11 complex/ET-37 complex
12    4       3       2       16      8       11      20
13    4       10      15      7       8       11      1       ST-269 complex
14    4       1       15      7       8       11      1       ST-269 complex