Plaintext
Computer Science I
Dr. Chris Bourke
cbourke@cse.unl.edu
Department of Computer Science & Engineering
University of Nebraska–Lincoln
Lincoln, NE 68588, USA
2020/11/12 14:28:08
Version 1.3.9
Copyleft (Copyright)
The entirety of this book is free and is released under a Creative Commons Attribution-
ShareAlike 4.0 International License (see http://creativecommons.org/licenses/
by-sa/4.0/ for details).
i
Draft Notice
This book is a draft that has been released for evaluation and comment. Some of the later
chapters are included as placeholders and indicators for the intended scope of the final
draft, but are intentionally left blank. The author encourages people to send feedback
including suggestions, corrections, and reviews to inform and influence the final draft.
Thank you in advance to anyone helping out or sending constructive criticisms.
iii
Preface
“If you really want to understand something, the best way is to try and
explain it to someone else. That forces you to sort it out in your own mind...
that’s really the essence of programming. By the time you’ve sorted out a
complicated idea into little steps that even a stupid machine can deal with,
you’ve certainly learned something about it yourself.” —Douglas Adams,
Dirk Gently’s Holistic Detective Agency [8]
“The world of A.D. 2014 will have few routine jobs that cannot be done better
by some machine than by any human being. Mankind will therefore have
become largely a race of machine tenders. Schools will have to be oriented in
this direction. All the high-school students will be taught the fundamentals
of computer technology, will become proficient in binary arithmetic and will
be trained to perfection in the use of the computer languages that will have
developed out of those like the contemporary Fortran” —Isaac Asimov 1964
I’ve been teaching Computer Science since 2008 and was a Teaching Assistant long
before that. Before that I was a student. During that entire time I’ve been continually
disappointed in the value (note, not quality) of textbooks, particularly Computer Science
textbooks and especially introductory textbooks. Of primary concern are the costs,
which have far outstripped inflation over the last decade [31] while not providing any
real additional value. New editions with trivial changes are released on a regular basis in
an attempt to nullify the used book market. Publishers engage in questionable business
practices and unfortunately many institutions are complicit in this process.
In established fields such as mathematics and physics, new textbooks are especially
questionable as the material and topics don’t undergo many changes. However, in
Computer Science, new languages and technologies are created and change at breakneck
speeds. Faculty and students are regularly trying to give away stacks of textbooks
(“Learn Java 4!,” “Introduction to Cold Fusion,” etc.) that are only a few years old and
yet are completely obsolete and worthless. The problem is that such books have built-in
obsolescence by focusing too much on technological specifics and not enough on concepts.
There are dozens of introductory textbooks for Computer Science; add in the fact that
there are multiple languages and many gimmicks (“Learn Multimedia Java,” “Gaming
with JavaScript,” “Build a Robot with C!”), it is a publisher’s paradise: hundreds of
variations, a growing market, and customers with few alternatives.
v
Preface
That’s why I like organizations like OpenStax (http://openstaxcollege.org/) that
attempt to provide free and “open” learning materials. Though they have textbooks for
a variety of disciplines, Computer Science is not one of them (currently, that is). This
might be due to the fact that there are already a huge amount of resources available
online such as tutorials, videos, online open courses, and even interactive code learning
tools. With such a huge amount of resources, why write this textbook then? Firstly,
layoff. Secondly, I don’t really expect this book to have much impact beyond my own
courses or department. I wanted a resource that presented an introduction to Computer
Science how I teach it in my courses and it wasn’t available. However, if it does find its
way into another instructor’s classes or into the hands of an aspiring student that wants
to learn, then great!
Several years ago our department revamped our introductory courses in a “Renaissance
in Computing” initiative in which we redeveloped several different “flavors” of Computer
Science I (one intended for Computer Science majors, one for Computer Engineering
majors, one for non-CE engineering majors, one for humanities majors, etc.). The courses
are intended to be equivalent in content but have a broader appeal to those in different
disciplines. The intent was to provide multiple entry points into Computer Science. Once
a student had a solid foundation, they could continue into Computer Science II and pick
up a second programming language with little difficulty.
This basic idea informed how I structured this book. There is a separation of concepts
and programming language syntax. The first part of this book uses pseudocode with
a minimum of language-specific elements. Subsequent parts of the book recapitulate
these concepts but in the context of a specific programming language. This allows for a
“plug-in” style approach to Computer Science: the same book could theoretically be used
for multiple courses or the book could be extended by adding another part for a new
language with minimal effort.
Another inspiration for the structure of this book is the Computer Science I Honors
course that I developed. Previously, Computer Science majors took CS1 using Java as the
primary language while CE students took CS1 using C. Since the honors course consists of
both majors (as well as some of the top students), I developed the Honors version to cover
both languages at the same time in parallel. This has led to many interesting teaching
moments: by covering two languages, it provides opportunities to highlight fundamental
differences and concepts in programming languages. It also keeps concepts as the focus of
the course emphasizing that syntax and idiosyncrasies of individual languages are only of
secondary concern. Finally, actively using multiple languages in the first class provides a
better opportunity to extend knowledge to other programming languages–once a student
has a solid foundation in one language learning a new one should be relatively easy.
The exercises in this book are a variety of exercises I’ve used in my courses over the
years. They have been made as generic as possible so that they could be assigned using
any language. While some have emphasized the use of “real-world” exercises (whatever
that means), my exercises have focused more on solving problems of a mathematical
vi
nature (most of my students have been Engineering students). Some of them are more
easily understood if students have had Calculus but it is not absolutely necessary.
It may be cliché, but the two quotes above exemplify what I believe a Computer Science
I course is about. The second is from Isaac Asimov who was asked at the 1964 World’s
Fair what he though the world of 2014 would look like. His prediction didn’t become
entirely true, but I do believe we are on the verge of a fundamental social change that
will be caused by more and more automation. Like the industrial revolution, but on
a much smaller time scale and to a far greater extent, automation will fundamentally
change how we live and not work (I say “not work” because automation will very easily
destroy the vast majority of today’s jobs–this represents a huge economic and political
challenge that will need to be addressed). The time is quickly approaching where being
able to program and develop software will be considered a fundamental skill as essential
as arithmetic. I hope this book plays some small role in helping students adjust to that
coming world.
The first quote describes programming, or more fundamentally Computer Science and
“problem solving.” Computers do not solve problems, humans do. Computers only make
it possible to automate solutions on a large scale. At the end of the day, the human race
is still responsible for tending the machines and will be for some time despite what Star
Trek and the most optimistic of AI advocates think.
I hope that people find this book useful. If value is a ratio of quality vs cost then this
book has already succeeded in having infinite value.1 If you have suggestions on how to
improve it, please feel free to contact me. If you end up using it and finding it useful,
please let me know that too!
1
or it might be undefined, or NaN, or this book is Exceptional depending on which language sections
you read
vii
Acknowledgements
I’d like to thank the Department of Computer Science & Engineering at the University
of Nebraska–Lincoln for their support during my writing and maintaining this book.
This book is dedicated to my family.
ix
Contents
Copyleft (Copyright) i
Draft Notice iii
Preface v
Acknowledgements ix
1. Introduction 1
1.1. Problem Solving . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
1.2. Computing Basics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
1.3. Basic Program Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
1.4. Syntax Rules & Pseudocode . . . . . . . . . . . . . . . . . . . . . . . . . 13
1.5. Documentation, Comments, and Coding Style . . . . . . . . . . . . . . . 14
2. Basics 17
2.1. Control Flow . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
2.1.1. Flowcharts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
2.2. Variables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
2.2.1. Naming Rules & Conventions . . . . . . . . . . . . . . . . . . . . 19
2.2.2. Types . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
2.2.3. Declaring Variables: Dynamic vs. Static Typing . . . . . . . . . . 31
2.2.4. Scoping . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32
2.3. Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33
2.3.1. Assignment Operators . . . . . . . . . . . . . . . . . . . . . . . . 33
2.3.2. Numerical Operators . . . . . . . . . . . . . . . . . . . . . . . . . 35
2.3.3. String Concatenation . . . . . . . . . . . . . . . . . . . . . . . . . 37
2.3.4. Order of Precedence . . . . . . . . . . . . . . . . . . . . . . . . . 38
2.3.5. Common Numerical Errors . . . . . . . . . . . . . . . . . . . . . . 38
2.3.6. Other Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
2.4. Basic Input/Output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
2.4.1. Standard Input & Output . . . . . . . . . . . . . . . . . . . . . . 42
2.4.2. Graphical User Interfaces . . . . . . . . . . . . . . . . . . . . . . . 42
2.4.3. Output Using printf() -style Formatting . . . . . . . . . . . . . 43
2.4.4. Command Line Input . . . . . . . . . . . . . . . . . . . . . . . . . 44
xi
Contents
2.5. Debugging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46
2.5.1. Types of Errors . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46
2.5.2. Strategies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
2.6. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50
2.6.1. Temperature Conversion . . . . . . . . . . . . . . . . . . . . . . . 50
2.6.2. Quadratic Roots . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
2.7. Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
3. Conditionals 65
3.1. Logical Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
3.1.1. Comparison Operators . . . . . . . . . . . . . . . . . . . . . . . . 66
3.1.2. Negation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68
3.1.3. Logical And . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69
3.1.4. Logical Or . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
3.1.5. Compound Statements . . . . . . . . . . . . . . . . . . . . . . . . 71
3.1.6. Short Circuiting . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74
3.2. The If Statement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
3.3. The If-Else Statement . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
3.4. The If-Else-If Statement . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
3.5. Ternary If-Else Operator . . . . . . . . . . . . . . . . . . . . . . . . . . . 82
3.6. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82
3.6.1. Meal Discount . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82
3.6.2. Look Before You Leap . . . . . . . . . . . . . . . . . . . . . . . . 83
3.6.3. Comparing Elements . . . . . . . . . . . . . . . . . . . . . . . . . 84
3.6.4. Life & Taxes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85
3.7. Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
4. Loops 95
4.1. While Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
4.1.1. Example . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 98
4.2. For Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99
4.2.1. Example . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100
4.3. Do-While Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100
4.4. Foreach Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 102
4.5. Other Issues . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103
4.5.1. Nested Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103
4.5.2. Infinite Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103
4.5.3. Common Errors . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105
4.5.4. Equivalency of Loops . . . . . . . . . . . . . . . . . . . . . . . . . 106
4.6. Problem Solving With Loops . . . . . . . . . . . . . . . . . . . . . . . . . 106
4.7. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107
4.7.1. For vs While Loop . . . . . . . . . . . . . . . . . . . . . . . . . . 107
4.7.2. Primality Testing . . . . . . . . . . . . . . . . . . . . . . . . . . . 108
4.7.3. Paying the Piper . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
xii
Contents
4.8. Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111
5. Functions 133
5.1. Defining & Using Functions . . . . . . . . . . . . . . . . . . . . . . . . . 134
5.1.1. Function Signatures . . . . . . . . . . . . . . . . . . . . . . . . . . 134
5.1.2. Calling Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . 136
5.1.3. Organizing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137
5.2. How Functions Work . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137
5.2.1. Call By Value . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 140
5.2.2. Call By Reference . . . . . . . . . . . . . . . . . . . . . . . . . . . 140
5.3. Other Issues . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 142
5.3.1. Functions as Entities . . . . . . . . . . . . . . . . . . . . . . . . . 142
5.3.2. Function Overloading . . . . . . . . . . . . . . . . . . . . . . . . . 144
5.3.3. Variable Argument Functions . . . . . . . . . . . . . . . . . . . . 145
5.3.4. Optional Parameters & Default Values . . . . . . . . . . . . . . . 145
5.4. Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 146
6. Error Handling 151
6.1. Error Handling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 153
6.2. Error Handling Strategies . . . . . . . . . . . . . . . . . . . . . . . . . . 153
6.2.1. Defensive Programming . . . . . . . . . . . . . . . . . . . . . . . 153
6.2.2. Exceptions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 155
6.3. Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157
7. Arrays, Collections & Dynamic Memory 159
7.1. Basic Usage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160
7.2. Static & Dynamic Memory . . . . . . . . . . . . . . . . . . . . . . . . . . 162
7.2.1. Dynamic Memory . . . . . . . . . . . . . . . . . . . . . . . . . . . 164
7.2.2. Shallow vs. Deep Copies . . . . . . . . . . . . . . . . . . . . . . . 166
7.3. Multidimensional Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . 166
7.4. Other Collections . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 167
7.5. Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 168
8. Strings 177
8.1. Basic Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 177
8.2. Comparisons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 178
8.3. Tokenizing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179
8.4. Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179
9. File Input/Output 183
9.1. Processing Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 183
9.1.1. Paths . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184
9.1.2. Error Handling . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185
9.1.3. Buffered and Unbuffered . . . . . . . . . . . . . . . . . . . . . . . 187
xiii
Contents
9.1.4. Binary vs Text Files . . . . . . . . . . . . . . . . . . . . . . . . . 187
9.2. Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188
10.Encapsulation & Objects 197
10.1. Objects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198
10.1.1. Defining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198
10.1.2. Creating . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
10.1.3. Using Objects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 200
10.2. Design Principles & Best Practices . . . . . . . . . . . . . . . . . . . . . 200
10.3. Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 201
11.Recursion 203
11.1. Writing Recursive Functions . . . . . . . . . . . . . . . . . . . . . . . . . 205
11.1.1. Tail Recursion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 205
11.2. Avoiding Recursion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206
11.2.1. Memoization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 208
11.3. Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 209
12.Searching & Sorting 211
12.1. Searching . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 211
12.1.1. Linear Search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 212
12.1.2. Binary Search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213
12.1.3. Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 215
12.2. Sorting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 220
12.2.1. Selection Sort . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 221
12.2.2. Insertion Sort . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 224
12.2.3. Quick Sort . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227
12.2.4. Merge Sort . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 232
12.2.5. Other Sorts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237
12.2.6. Comparison & Summary . . . . . . . . . . . . . . . . . . . . . . . 237
12.3. Searching & Sorting In Practice . . . . . . . . . . . . . . . . . . . . . . . 238
12.3.1. Using Libraries and Comparators . . . . . . . . . . . . . . . . . . 238
12.3.2. Preventing Arithmetic Errors . . . . . . . . . . . . . . . . . . . . 239
12.3.3. Avoiding the Difference Trick . . . . . . . . . . . . . . . . . . . . 241
12.3.4. Importance of a Total Order . . . . . . . . . . . . . . . . . . . . . 242
12.3.5. Artificial Ordering . . . . . . . . . . . . . . . . . . . . . . . . . . 242
12.3.6. Sorting Stability . . . . . . . . . . . . . . . . . . . . . . . . . . . 243
12.4. Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 244
13.Graphical User Interfaces & Event Driven Programming 247
14.Introduction to Databases & Database Connectivity 249
xiv
Contents
I. The C Programming Language 251
15.Basics 253
15.1. Getting Started: Hello World . . . . . . . . . . . . . . . . . . . . . . . . 253
15.2. Basic Elements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 254
15.2.1. Basic Syntax Rules . . . . . . . . . . . . . . . . . . . . . . . . . . 255
15.2.2. Preprocessor Directives . . . . . . . . . . . . . . . . . . . . . . . . 255
15.2.3. Comments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 258
15.2.4. The main() Function . . . . . . . . . . . . . . . . . . . . . . . . 259
15.3. Variables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 260
15.3.1. Declaration & Assignment . . . . . . . . . . . . . . . . . . . . . . 260
15.4. Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 262
15.5. Basic I/O . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 263
15.6. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 265
15.6.1. Converting Units . . . . . . . . . . . . . . . . . . . . . . . . . . . 265
15.6.2. Computing Quadratic Roots . . . . . . . . . . . . . . . . . . . . . 267
16.Conditionals 271
16.1. Logical Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 271
16.1.1. Order of Precedence . . . . . . . . . . . . . . . . . . . . . . . . . 273
16.1.2. Comparing Strings and Characters . . . . . . . . . . . . . . . . . 273
16.2. If, If-Else, If-Else-If Statements . . . . . . . . . . . . . . . . . . . . . . . 274
16.3. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 276
16.3.1. Computing a Logarithm . . . . . . . . . . . . . . . . . . . . . . . 276
16.3.2. Life & Taxes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 277
16.3.3. Quadratic Roots Revisited . . . . . . . . . . . . . . . . . . . . . . 279
17.Loops 283
17.1. While Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 283
17.2. For Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 285
17.3. Do-While Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 285
17.4. Other Issues . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 286
17.5. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 287
17.5.1. Normalizing a Number . . . . . . . . . . . . . . . . . . . . . . . . 287
17.5.2. Summation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 287
17.5.3. Nested Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 288
17.5.4. Paying the Piper . . . . . . . . . . . . . . . . . . . . . . . . . . . 288
18.Functions 291
18.1. Defining & Using Functions . . . . . . . . . . . . . . . . . . . . . . . . . 291
18.1.1. Declaration: Prototypes . . . . . . . . . . . . . . . . . . . . . . . 291
18.1.2. Void Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . 293
18.1.3. Organizing Functions . . . . . . . . . . . . . . . . . . . . . . . . . 294
18.1.4. Calling Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . 294
xv
Contents
18.2. Pointers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 295
18.2.1. Passing By Reference . . . . . . . . . . . . . . . . . . . . . . . . . 297
18.2.2. Function Pointers . . . . . . . . . . . . . . . . . . . . . . . . . . . 300
18.3. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 301
18.3.1. Generalized Rounding . . . . . . . . . . . . . . . . . . . . . . . . 301
18.3.2. Quadratic Roots . . . . . . . . . . . . . . . . . . . . . . . . . . . 303
19.Error Handling 305
19.1. Language Supported Error Codes . . . . . . . . . . . . . . . . . . . . . . 305
19.1.1. POSIX Error Codes . . . . . . . . . . . . . . . . . . . . . . . . . 306
19.2. Error Handling By Design . . . . . . . . . . . . . . . . . . . . . . . . . . 308
19.3. Enumerated Types . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 309
19.4. Using Enumerated Types for Error Codes . . . . . . . . . . . . . . . . . 310
20.Arrays 313
20.1. Basic Usage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 313
20.2. Dynamic Memory . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 316
20.3. Using Arrays with Functions . . . . . . . . . . . . . . . . . . . . . . . . . 318
20.4. Multidimensional Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . 319
20.4.1. Contiguous 2-D Arrays . . . . . . . . . . . . . . . . . . . . . . . . 322
20.5. Dynamic Data Structures . . . . . . . . . . . . . . . . . . . . . . . . . . 324
21.Strings 325
21.1. Character Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 325
21.2. String Library . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 327
21.3. Arrays of Strings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 330
21.4. Comparisons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 331
21.5. Conversions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 332
21.6. Tokenizing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 333
22.File I/O 335
22.1. Opening Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 335
22.2. Reading & Writing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 336
22.2.1. Plaintext Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 336
22.2.2. Binary Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338
22.3. Closing Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 339
23.Structures 341
23.1. Defining Structures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 341
23.1.1. Alternative Declarations . . . . . . . . . . . . . . . . . . . . . . . 342
23.1.2. Nested Structures . . . . . . . . . . . . . . . . . . . . . . . . . . . 343
23.2. Usage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 344
23.2.1. Declaration & Initialization . . . . . . . . . . . . . . . . . . . . . 344
23.2.2. Selection Operators . . . . . . . . . . . . . . . . . . . . . . . . . . 346
xvi
Contents
23.3. Arrays of Structures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 348
23.4. Using Structures With Functions . . . . . . . . . . . . . . . . . . . . . . 352
23.4.1. Factory Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . 353
23.4.2. To String Functions . . . . . . . . . . . . . . . . . . . . . . . . . . 354
23.4.3. Passing Arrays of Structures . . . . . . . . . . . . . . . . . . . . . 355
24.Recursion 357
25.Searching & Sorting 361
25.1. Comparator Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . 361
25.2. Function Pointers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 365
25.3. Searching & Sorting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 372
25.3.1. Searching . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 372
25.3.2. Sorting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 374
25.3.3. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 374
25.4. Other Considerations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 377
25.4.1. Sorting Pointers to Elements . . . . . . . . . . . . . . . . . . . . . 377
25.4.2. Dealing With NULL Elements . . . . . . . . . . . . . . . . . . . . 378
II. The Java Programming Language 381
26.Basics 383
26.1. Getting Started: Hello World . . . . . . . . . . . . . . . . . . . . . . . . 384
26.2. Basic Elements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 385
26.2.1. Basic Syntax Rules . . . . . . . . . . . . . . . . . . . . . . . . . . 385
26.2.2. Program Structure . . . . . . . . . . . . . . . . . . . . . . . . . . 386
26.2.3. The main() Method . . . . . . . . . . . . . . . . . . . . . . . . . 389
26.2.4. Comments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 389
26.3. Variables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 390
26.3.1. Declaration & Assignment . . . . . . . . . . . . . . . . . . . . . . 391
26.4. Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 393
26.5. Basic I/O . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 395
26.6. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 396
26.6.1. Converting Units . . . . . . . . . . . . . . . . . . . . . . . . . . . 396
26.6.2. Computing Quadratic Roots . . . . . . . . . . . . . . . . . . . . . 400
27.Conditionals 403
27.1. Logical Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 403
27.1.1. Order of Precedence . . . . . . . . . . . . . . . . . . . . . . . . . 405
27.1.2. Comparing Strings and Characters . . . . . . . . . . . . . . . . . 406
27.2. If, If-Else, If-Else-If Statements . . . . . . . . . . . . . . . . . . . . . . . 407
27.3. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 408
27.3.1. Computing a Logarithm . . . . . . . . . . . . . . . . . . . . . . . 408
xvii
Contents
27.3.2. Life & Taxes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 410
27.3.3. Quadratic Roots Revisited . . . . . . . . . . . . . . . . . . . . . . 411
28.Loops 415
28.1. While Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 415
28.2. For Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 417
28.3. Do-While Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 417
28.4. Enhanced For Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 418
28.5. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 419
28.5.1. Normalizing a Number . . . . . . . . . . . . . . . . . . . . . . . . 419
28.5.2. Summation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 419
28.5.3. Nested Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 420
28.5.4. Paying the Piper . . . . . . . . . . . . . . . . . . . . . . . . . . . 421
29.Methods 423
29.1. Defining Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 424
29.1.1. Void Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 426
29.1.2. Using Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . 426
29.1.3. Passing By Reference . . . . . . . . . . . . . . . . . . . . . . . . . 427
29.2. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 428
29.2.1. Generalized Rounding . . . . . . . . . . . . . . . . . . . . . . . . 428
30.Error Handling & Exceptions 431
30.1. Exceptions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 431
30.1.1. Catching Exceptions . . . . . . . . . . . . . . . . . . . . . . . . . 431
30.1.2. Throwing Exceptions . . . . . . . . . . . . . . . . . . . . . . . . . 433
30.1.3. Creating Custom Exceptions . . . . . . . . . . . . . . . . . . . . . 433
30.1.4. Checked Exceptions . . . . . . . . . . . . . . . . . . . . . . . . . . 434
30.2. Enumerated Types . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 436
30.2.1. More Tricks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 437
31.Arrays 439
31.1. Basic Usage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 439
31.2. Dynamic Memory . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 442
31.3. Using Arrays with Methods . . . . . . . . . . . . . . . . . . . . . . . . . 442
31.4. Multidimensional Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . 443
31.5. Dynamic Data Structures . . . . . . . . . . . . . . . . . . . . . . . . . . 444
32.Strings 449
32.1. Basics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 449
32.2. String Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 450
32.3. Arrays of Strings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 452
32.4. Comparisons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 453
32.5. Tokenizing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 455
xviii
Contents
33.File I/O 457
33.1. File Input . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 457
33.2. File Output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 459
34.Objects 461
34.1. Data Visibility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 462
34.2. Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 463
34.2.1. Accessor & Mutator Methods . . . . . . . . . . . . . . . . . . . . 464
34.3. Constructors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 467
34.4. Usage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 469
34.5. Common Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 469
34.6. Composition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 472
34.7. Example . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 474
35.Recursion 479
36.Searching & Sorting 483
36.1. Comparators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 483
36.2. Searching & Sorting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 487
36.2.1. Searching . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 487
36.2.2. Sorting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 488
36.3. Other Considerations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 488
36.3.1. Sorted Collections . . . . . . . . . . . . . . . . . . . . . . . . . . . 488
36.3.2. Handling null values . . . . . . . . . . . . . . . . . . . . . . . . 490
36.3.3. Importance of equals() and hashCode() Methods . . . . . . . 491
36.3.4. Java 8: Lambda Expressions . . . . . . . . . . . . . . . . . . . . . 493
III. The PHP Programming Language 495
37.Basics 497
37.1. Getting Started: Hello World . . . . . . . . . . . . . . . . . . . . . . . . 498
37.2. Basic Elements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 499
37.2.1. Basic Syntax Rules . . . . . . . . . . . . . . . . . . . . . . . . . . 499
37.2.2. PHP Tags . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 500
37.2.3. Libraries . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 500
37.2.4. Comments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 500
37.2.5. Entry Point & Command Line Arguments . . . . . . . . . . . . . 502
37.3. Variables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 502
37.3.1. Using Variables . . . . . . . . . . . . . . . . . . . . . . . . . . . . 502
37.4. Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 503
37.4.1. Type Juggling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 504
37.4.2. String Concatenation . . . . . . . . . . . . . . . . . . . . . . . . . 507
37.5. Basic I/O . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 507
xix
Contents
37.6. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 509
37.6.1. Converting Units . . . . . . . . . . . . . . . . . . . . . . . . . . . 509
37.6.2. Computing Quadratic Roots . . . . . . . . . . . . . . . . . . . . . 510
38.Conditionals 515
38.1. Logical Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 515
38.1.1. Order of Precedence . . . . . . . . . . . . . . . . . . . . . . . . . 517
38.2. If, If-Else, If-Else-If Statements . . . . . . . . . . . . . . . . . . . . . . . 517
38.3. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 519
38.3.1. Computing a Logarithm . . . . . . . . . . . . . . . . . . . . . . . 519
38.3.2. Life & Taxes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 520
38.3.3. Quadratic Roots Revisited . . . . . . . . . . . . . . . . . . . . . . 522
39.Loops 527
39.1. While Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 527
39.2. For Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 528
39.3. Do-While Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 529
39.4. Foreach Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 529
39.5. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 530
39.5.1. Normalizing a Number . . . . . . . . . . . . . . . . . . . . . . . . 530
39.5.2. Summation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 530
39.5.3. Nested Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 531
39.5.4. Paying the Piper . . . . . . . . . . . . . . . . . . . . . . . . . . . 531
40.Functions 535
40.1. Defining & Using Functions . . . . . . . . . . . . . . . . . . . . . . . . . 535
40.1.1. Declaring Functions . . . . . . . . . . . . . . . . . . . . . . . . . . 535
40.1.2. Organizing Functions . . . . . . . . . . . . . . . . . . . . . . . . . 537
40.1.3. Calling Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . 537
40.1.4. Passing By Reference . . . . . . . . . . . . . . . . . . . . . . . . . 538
40.1.5. Optional & Default Parameters . . . . . . . . . . . . . . . . . . . 539
40.1.6. Function Pointers . . . . . . . . . . . . . . . . . . . . . . . . . . . 540
40.2. Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 540
40.2.1. Generalized Rounding . . . . . . . . . . . . . . . . . . . . . . . . 540
40.2.2. Quadratic Roots . . . . . . . . . . . . . . . . . . . . . . . . . . . 541
41.Error Handling & Exceptions 543
41.1. Throwing Exceptions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 543
41.2. Catching Exceptions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 543
41.3. Creating Custom Exceptions . . . . . . . . . . . . . . . . . . . . . . . . . 544
42.Arrays 547
42.1. Creating Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 547
xx
Contents
42.2. Indexing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 547
42.2.1. Strings as Indices . . . . . . . . . . . . . . . . . . . . . . . . . . . 549
42.2.2. Non-Contiguous Indices . . . . . . . . . . . . . . . . . . . . . . . 549
42.2.3. Key-Value Initialization . . . . . . . . . . . . . . . . . . . . . . . 549
42.3. Useful Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 550
42.4. Iteration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 551
42.5. Adding Elements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 552
42.6. Removing Elements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 553
42.7. Using Arrays in Functions . . . . . . . . . . . . . . . . . . . . . . . . . . 554
42.8. Multidimensional Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . 555
43.Strings 557
43.1. Basics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 557
43.2. String Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 558
43.3. Arrays of Strings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 560
43.4. Comparisons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 560
43.5. Tokenizing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 561
44.File I/O 563
44.1. Opening Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 563
44.2. Reading & Writing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 564
44.2.1. Using URLs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 565
44.2.2. Closing Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 565
45.Objects 567
45.1. Data Visibility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 568
45.2. Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 568
45.2.1. Accessor & Mutator Methods . . . . . . . . . . . . . . . . . . . . 570
45.3. Constructors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 571
45.4. Usage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 572
45.5. Common Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 573
45.6. Composition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 573
45.7. Example . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 574
46.Recursion 577
47.Searching & Sorting 581
47.1. Comparator Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . 581
47.1.1. Searching . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 584
47.1.2. Sorting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 584
Glossary 587
Acronyms 599
xxi
Contents
Index 610
References 613
xxii
List of Algorithms
1.1. An example of pseudocode: finding a minimum value . . . . . . . . . . . . 14
2.1. Assignment Operator Demonstration . . . . . . . . . . . . . . . . . . . . . 34
2.2. Addition and Subtraction Demonstration . . . . . . . . . . . . . . . . . . 35
2.3. Multiplication and Division Demonstration . . . . . . . . . . . . . . . . . 36
2.4. Temperature Conversion Program . . . . . . . . . . . . . . . . . . . . . . 50
2.5. Quadratic Roots Program . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
3.1. An if-statement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
3.2. An if-else Statement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
3.3. Example If-Else-If Statement . . . . . . . . . . . . . . . . . . . . . . . . . 79
3.4. General If-Else-If Statement . . . . . . . . . . . . . . . . . . . . . . . . . . 81
3.5. If-Else-If Statement With a Bug . . . . . . . . . . . . . . . . . . . . . . . 81
3.6. A simple receipt program . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
3.7. Preventing Division By Zero Using an If Statement . . . . . . . . . . . . . 83
3.8. Comparing Students by Name . . . . . . . . . . . . . . . . . . . . . . . . . 84
3.9. Computing Tax Liability with If-Else-If . . . . . . . . . . . . . . . . . . . 86
3.10. Computing Tax Credit with If-Else-If . . . . . . . . . . . . . . . . . . . . . 86
4.1. Counter-Controlled While Loop . . . . . . . . . . . . . . . . . . . . . . . . 97
4.2. Normalizing a Number With a While Loop . . . . . . . . . . . . . . . . . 99
4.3. A General For Loop . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99
xxiii
LIST OF ALGORITHMS
4.4. Counter-Controlled For Loop . . . . . . . . . . . . . . . . . . . . . . . . . 100
4.5. Summation of Numbers in a For Loop . . . . . . . . . . . . . . . . . . . . 100
4.6. Counter-Controlled Do-While Loop . . . . . . . . . . . . . . . . . . . . . . 101
4.7. Flag-Controlled Do-While Loop . . . . . . . . . . . . . . . . . . . . . . . . 102
4.8. Example Foreach Loop . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 102
4.9. Foreach Loop Computing Grades . . . . . . . . . . . . . . . . . . . . . . . 103
4.10. Nested For Loops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103
4.11. Infinite Loop . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 104
4.12. Computing the Geometric Series Using a For Loop . . . . . . . . . . . . . 107
4.13. Computing the Geometric Series Using a While Loop . . . . . . . . . . . . 108
4.14. Determining if a Number is Prime or Composite . . . . . . . . . . . . . . 109
4.15. Counting the number of primes. . . . . . . . . . . . . . . . . . . . . . . . . 109
4.16. Computing a loan amortization schedule . . . . . . . . . . . . . . . . . . . 111
4.17. Scaling a Value . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 123
5.1. A function in pseudocode . . . . . . . . . . . . . . . . . . . . . . . . . . . 135
5.2. Using a function . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137
11.1. Recursive CountDown(n) Function . . . . . . . . . . . . . . . . . . . . . 203
11.2. Recursive Fibonacci(n) Function . . . . . . . . . . . . . . . . . . . . . . 204
11.3. Recursive Fibonacci(n) Function With Memoization . . . . . . . . . . . 208
12.1. Linear Search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 212
12.2. Recursive Binary Search Algorithm, BinarySearch(A, l, r, ek ) . . . . . . 214
12.3. Iterative Binary Search Algorithm, BinarySearch(A, ek ) . . . . . . . . . 215
12.4. Selection Sort . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 222
12.5. Insertion Sort . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225
12.6. QuickSort . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 229
xxiv
LIST OF ALGORITHMS
12.7. In-Place Partition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 229
12.8. MergeSort . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 233
12.9. Merge . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 234
xxv
List of Code Samples
1.1. A simple program in C . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
1.2. A simple program in C, compiled to assembly . . . . . . . . . . . . . . . 11
1.3. A simple program in C, resulting machine code formatted in hexadecimal
(partial) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
2.1. Example of variable scoping in C . . . . . . . . . . . . . . . . . . . . . . 32
2.2. Compound Assignment Operators in C . . . . . . . . . . . . . . . . . . . 41
2.3. printf() examples in C . . . . . . . . . . . . . . . . . . . . . . . . . . 45
2.4. Output Result . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
4.1. Zune Bug . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105
15.1. Hello World Program in C . . . . . . . . . . . . . . . . . . . . . . . . . . 254
15.2. Fahrenheit-to-Celsius Conversion Program in C . . . . . . . . . . . . . . 268
15.3. Quadratic Roots Program in C . . . . . . . . . . . . . . . . . . . . . . . 269
16.1. Examples of Conditional Statements in C . . . . . . . . . . . . . . . . . . 275
16.2. Logarithm Calculator Program in C . . . . . . . . . . . . . . . . . . . . . 280
16.3. Tax Program in C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 281
16.4. Quadratic Roots Program in C With Error Checking . . . . . . . . . . . 282
17.1. While Loop in C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 283
17.2. Flag-controlled While Loop in C . . . . . . . . . . . . . . . . . . . . . . . 284
17.3. For Loop in C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 285
17.4. Do-While Loop in C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 286
17.5. Normalizing a Number with a While Loop in C . . . . . . . . . . . . . . 287
17.6. Summation of Numbers using a For Loop in C . . . . . . . . . . . . . . . 287
17.7. Nested For Loops in C . . . . . . . . . . . . . . . . . . . . . . . . . . . . 288
17.8. Loan Amortization Program in C . . . . . . . . . . . . . . . . . . . . . . 290
19.1. Using the errno.h library . . . . . . . . . . . . . . . . . . . . . . . . . 307
23.1. A Student structure declaration . . . . . . . . . . . . . . . . . . . . . . 344
25.1. C Function Pointer Syntax Examples . . . . . . . . . . . . . . . . . . . . 371
25.2. C Search Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 375
25.3. C Sort Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 376
25.4. C Comparator Function for Strings . . . . . . . . . . . . . . . . . . . . . 377
xxvii
List of Code Samples
25.5. Sorting Structures via Pointers . . . . . . . . . . . . . . . . . . . . . . . 378
25.6. Handling Null Values . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 380
26.1. Hello World Program in Java . . . . . . . . . . . . . . . . . . . . . . . . 384
26.2. Basic Input/Output in Java . . . . . . . . . . . . . . . . . . . . . . . . . 396
26.3. Fahrenheit-to-Celsius Conversion Program in Java . . . . . . . . . . . . . 399
26.4. Quadratic Roots Program in Java . . . . . . . . . . . . . . . . . . . . . . 402
27.1. Examples of Conditional Statements in Java . . . . . . . . . . . . . . . . 407
27.2. Logarithm Calculator Program in Java . . . . . . . . . . . . . . . . . . . 412
27.3. Tax Program in Java . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 413
27.4. Quadratic Roots Program in Java With Error Checking . . . . . . . . . . 414
28.1. While Loop in Java . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 415
28.2. Flag-controlled While Loop in Java . . . . . . . . . . . . . . . . . . . . . 416
28.3. For Loop in Java . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 417
28.4. Do-While Loop in Java . . . . . . . . . . . . . . . . . . . . . . . . . . . . 418
28.5. Enhanced For Loops in Java Example 1 . . . . . . . . . . . . . . . . . . . 418
28.6. Enhanced For Loops in Java Example 2 . . . . . . . . . . . . . . . . . . . 419
28.7. Normalizing a Number with a While Loop in Java . . . . . . . . . . . . . 419
28.8. Summation of Numbers using a For Loop in Java . . . . . . . . . . . . . 420
28.9. Nested For Loops in Java . . . . . . . . . . . . . . . . . . . . . . . . . . . 420
28.10.Loan Amortization Program in Java . . . . . . . . . . . . . . . . . . . . . 422
34.1. The completed Java Student class. . . . . . . . . . . . . . . . . . . . . 477
36.1. Java Search Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . 489
36.2. Using Java Collection’s Sort Method . . . . . . . . . . . . . . . . . . . . 490
36.3. Handling Null Values in Java Comparators . . . . . . . . . . . . . . . . . 491
37.1. Hello World Program in PHP . . . . . . . . . . . . . . . . . . . . . . . . 498
37.2. Hello World Program in PHP with HTML . . . . . . . . . . . . . . . . . 498
37.3. Type Juggling in PHP . . . . . . . . . . . . . . . . . . . . . . . . . . . . 505
37.4. Fahrenheit-to-Celsius Conversion Program in PHP . . . . . . . . . . . . . 511
37.5. Quadratic Roots Program in PHP . . . . . . . . . . . . . . . . . . . . . . 512
38.1. Examples of Conditional Statements in PHP . . . . . . . . . . . . . . . . 518
38.2. Logarithm Calculator Program in C . . . . . . . . . . . . . . . . . . . . . 523
38.3. Tax Program in PHP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 524
38.4. Quadratic Roots Program in PHP With Error Checking . . . . . . . . . 525
39.1. While Loop in PHP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 527
39.2. Flag-controlled While Loop in PHP . . . . . . . . . . . . . . . . . . . . . 528
39.3. For Loop in PHP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 529
39.4. Do-While Loop in PHP . . . . . . . . . . . . . . . . . . . . . . . . . . . . 529
39.5. Normalizing a Number with a While Loop in PHP . . . . . . . . . . . . . 530
xxviii
List of Code Samples
39.6. Summation of Numbers using a For Loop in PHP . . . . . . . . . . . . . 531
39.7. Nested For Loops in PHP . . . . . . . . . . . . . . . . . . . . . . . . . . 531
39.8. Loan Amortization Program in PHP . . . . . . . . . . . . . . . . . . . . 533
44.1. Processing a file line-by-line in PHP . . . . . . . . . . . . . . . . . . . . . 564
45.1. The completed PHP Student class. . . . . . . . . . . . . . . . . . . . . 576
47.1. Using PHP’s usort() Function . . . . . . . . . . . . . . . . . . . . . . . 585
xxix
List of Figures
1.1. Depiction of Computer Memory . . . . . . . . . . . . . . . . . . . . . . . 7
1.2. A Compiling Process . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
2.1. Types of Flowchart Nodes . . . . . . . . . . . . . . . . . . . . . . . . . . 18
2.2. Example of a flowchart for a simple ATM process . . . . . . . . . . . . . 19
2.3. Elements of a printf() statement in C . . . . . . . . . . . . . . . . . . 44
2.4. Intersection of two circles. . . . . . . . . . . . . . . . . . . . . . . . . . . 63
3.1. Control flow diagrams for sequential control flow and an if-statement. . . 77
3.2. An if-else Flow Chart . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
3.3. Control Flow for an If-Else-If Statement . . . . . . . . . . . . . . . . . . 80
3.4. Quadrants of the Cartesian Plane . . . . . . . . . . . . . . . . . . . . . . 87
3.5. Three types of triangles . . . . . . . . . . . . . . . . . . . . . . . . . . . 90
3.6. Intersection of Two Rectangles . . . . . . . . . . . . . . . . . . . . . . . . 91
3.7. Examples of Floor Tiling . . . . . . . . . . . . . . . . . . . . . . . . . . . 93
4.1. A Typical Loop Flow Chart . . . . . . . . . . . . . . . . . . . . . . . . . 96
4.2. A Do-While Loop Flow Chart. The continuation condition is checked after
the loop body. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101
4.3. Plot of f (x) = sinx x . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116
4.4. A rectangle for the interval [−5, 5]. . . . . . . . . . . . . . . . . . . . . . 117
4.5. Follow the bouncing ball . . . . . . . . . . . . . . . . . . . . . . . . . . . 118
4.6. Sampling points in a circle . . . . . . . . . . . . . . . . . . . . . . . . . . 119
4.7. Regular polygons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 120
4.8. A polygon and its centroid. Whoo! . . . . . . . . . . . . . . . . . . . . . 130
5.1. A function declaration (prototype) in the C programming language with
the return type, identifier, and parameter list labeled. . . . . . . . . . . . 135
5.2. Program Stack . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 139
5.3. Demonstration of Pass By Value . . . . . . . . . . . . . . . . . . . . . . . 141
5.4. Demonstration of Pass By Reference . . . . . . . . . . . . . . . . . . . . 143
7.1. Example of an Array . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160
7.2. Example returning a static array . . . . . . . . . . . . . . . . . . . . . . 163
7.3. Pitfalls of Returning Static Arrays . . . . . . . . . . . . . . . . . . . . . . 174
7.4. Depiction of Application Memory. . . . . . . . . . . . . . . . . . . . . . . 175
7.5. Shallow vs. Deep Copies . . . . . . . . . . . . . . . . . . . . . . . . . . . 176
xxxi
List of Figures
9.1. Linux Tree Directory Structure . . . . . . . . . . . . . . . . . . . . . . . 186
9.2. An example polygon for n = 5 . . . . . . . . . . . . . . . . . . . . . . . . 188
9.3. A Word Search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 189
9.4. A solved Sudoku puzzle . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
9.5. A DNA Sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 194
9.6. Codon Table for RNA to Protein Translation . . . . . . . . . . . . . . . . 195
11.1. Recursive Fibonacci Computation Tree . . . . . . . . . . . . . . . . . . . 207
12.1. Array of Integers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 212
12.2. A Sorted Array . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213
12.3. Binary Search Example . . . . . . . . . . . . . . . . . . . . . . . . . . . . 216
12.4. Example of the benefit of ordered (indexed) elements in Windows 7 . . . 220
12.5. Selection Sort Example . . . . . . . . . . . . . . . . . . . . . . . . . . . . 223
12.6. Insertion Sort Example . . . . . . . . . . . . . . . . . . . . . . . . . . . . 226
12.7. Partitioning Example 1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . 230
12.8. Partitioning Example 2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . 230
12.9. Partitioning Example 3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . 231
12.10.Merge Sort Example . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235
12.11.Merge Example . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 236
12.12.Generalized Sorting with a Comparator . . . . . . . . . . . . . . . . . . . 240
18.1. Pointer Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 298
20.1. Dynamically Allocating Multidimensional Arrays . . . . . . . . . . . . . 321
20.2. Contiguous Two Dimensional Array . . . . . . . . . . . . . . . . . . . . . 324
21.1. Example of a character array (string) in C. . . . . . . . . . . . . . . . . . 325
23.1. Visualization of an initialized Student structure. Visualization generated
by http://pythontutor.com . . . . . . . . . . . . . . . . . . . . . . . . 346
23.2. Contiguous Structure Array . . . . . . . . . . . . . . . . . . . . . . . . . 350
23.3. Array of Structure Pointers . . . . . . . . . . . . . . . . . . . . . . . . . 351
23.4. Hybrid Array of Structures . . . . . . . . . . . . . . . . . . . . . . . . . . 352
25.1. Sorting an Array of Strings . . . . . . . . . . . . . . . . . . . . . . . . . . 379
xxxii
1. Introduction
Your problem is, you’re trying to understand it. You need to just do it.
You’re sitting there with all those tabs open in your browser, trying to
work out every aspect of Linux microkernel messaging, binary compatibility
between distributions, and look at that, you’re trying to read up about
compilers at the same time? Mate, you are trying to get a four-year computer
science degree, on your own, in one evening. You will not succeed at this.
Its not because you’re not a smart and quick young man, I can see that you
are. It’s because this is impossible.
What you’re trying to do now, you’re trying to learn something about as
complicated as a language. You’ve learned one language so far, the one
we’re speaking in. But you didn’t wait until you’d memorized all the rules of
grammar and a twenty-thousand-word vocabulary before you opened your
gob, did you? No, you learned to talk by saying ‘goo-goo’ and ‘da-da’ and
‘I done a pee-poo.’ You made mistakes, you backtracked went down blind
alleys. You mispronounced words and got the grammar wrong. But people
around you understood and when they didn’t understand what you meant,
you got better at that part of speech. You let the world tell you where you
needed to focus your attention, and in little and big pieces you became an
expert talker, fluent in English as she is spoke the world around.
So that’s what I mean when I say you need to stop trying to understand it
and just do it.
– Cory Doctorow, Pirate Cinema [?]
Computers are awesome. The human race has seen more advancements in the last 50 years
than in the entire 10,000 years of human history. Technology has transformed the way we
live our daily lives, how we interact with each other, and has changed the course of our
history. Today, everyone carries smart phones which have more computational power than
supercomputers from even 20 years ago. Computing has become ubiquitous, the “internet
of things” will soon become a reality in which every device will become interconnected
and data will be collected and available even about the smallest of minutiae.
However, computers are also dumb. Despite the most fantastical of depictions in science
1
1. Introduction
fiction and and hopes of Artificial Intelligence, computers can only do what they are told
to do. The fundamental art of Computer Science is problem solving. Computers are
not good at problem solving; you are the problem solver. It is still up to you, the user,
to approach a complex problem, study it, understand it, and develop a solution to it.
Computers are only good at automating solutions once you have solved the problem.
Computational sciences have become a fundamental tool of almost every discipline.
Scholars have used textual analysis and data mining techniques to analyze classical
literature and historic texts, providing new insights and opening new areas of study.
Astrophysicists have used computational analysis to detect dozens of new exoplanets.
Complex visualizations and models can predict astronomical collisions on a galactic scale.
Physicists have used big data analytics to push the boundaries of our understanding of
matter in the search for the Higgs boson and study of elementary particles. Chemists
simulate the interaction of millions of combinations of compounds without the need for
expensive and time consuming physical experiments. Biologists use massively distributed
computing models to simulate protein folding and other complex processes. Meteorologists
can predict weather and climactic changes with ever greater accuracy.
Technology and data analytics have changed how political campaigns are run, how
products are marketed and even delivered. Social networks can be data mined to track
and predict the spread of flu epidemics. Computing and automation will only continue
to grow. The time is soon coming where basic computational thinking and the ability
to develop software will be considered a basic skill necessary to every discipline, a
requirement for many jobs and an essential skill akin to arithmetic.
Computer Science is not programming. Programming is a necessary skill, but it is only
the beginning. This book is intended to get you started on your journey.
1.1. Problem Solving
At its heart, Computer Science is about problem solving. That is not to say that only
Computer Science is about problem solving. It would be hubris to think that Computer
Science holds a monopoly on “problem solving.” Indeed, it would be hard to find any
discipline in which solving problems was not a substantial aspect or motivation if not
integral. Instead, Computer Science is the study of computers and computation. It
involves studying and understanding computational processes and the development of
algorithms and techniques and how they apply to problems.
Problem solving skills are not something that can be distilled down into a single step-
by-step process. Each area and each problem comes with its own unique challenges and
considerations. General problem solving techniques can be identified, studied and taught,
but problem solving skills are something that come with experience, hard work, and most
importantly, failure. Problem solving is part and parcel of the human experience.
2
1.1. Problem Solving
That doesn’t mean we can’t identify techniques and strategies for approaching problems,
in particular problems that lend themselves to computational solutions. A prerequisite
to solving a problem is understanding it. What is the problem? Who or what entities
are involved in the problem? How do those entities interact with each other? What are
the problems or deficiencies that need to be addressed? Answering these questions, we
get an idea of where we are.
Ultimately, what is desired in a solution? What are the objectives that need to be
achieved? What would an ideal solution look like or what would it do? Who would use
the solution and how would they use it? By answering these questions, we get an idea of
where we want to be. Once we know where we are and where we want to be, the problem
solving process can begin: how do we get from point A to point B?
One of the first things a good engineer asks is: does a solution already exist? If a solution
already exists, then the problem is already solved! Ideally the solution is an “off-the-shelf”
solution: something that already exists and which may have been designed for a different
purpose but that can be repurposed for our problem. However, there may be exceptions
to this. The existing solution may be infeasible: it may be too resource intensive or
expensive. It may be too difficult or too expensive to adapt to our problem. It may solve
most of our problem, but may not work in some corner cases. It may need to be heavily
modified in order to work. Still, this basic question may save a lot of time and effort in
many cases.
In a very broad sense, the problem solving process is one that involves
1. Design
2. Implementation
3. Testing
4. Refinement
After one has a good understanding of a problem, they can start designing a solution. A
design is simply a plan on the construction of a solution. A design “on paper” allows
you to see what the potential solution would look like before investing the resources in
building it. It also allows you to identify possible impediments or problems that were
not readily apparent. A design allows you to an opportunity to think through possible
alternative solutions and weigh the advantages and disadvantages of each. Designing a
solution also allows you to understand the problem better. Design can involve gathering
requirements and developing use cases. How would an individual use the proposed
solution? What features would they need or want?
Implementations can involve building prototype solutions to test the feasibility of the
design. It can involve building individual components and integrating them together.
Testing involves finding, designing, and developing test cases: actual instances of the
3
1. Introduction
problem that can be used to test your solution. Ideally, the a test case instance involves
not only the “input” of the problem, but also the “output” of the problem: a feasible or
optimal solution that is known to be correct via other means. Test cases allow us to test
our solution to see if it gives correct and perhaps optimal solutions.
Refinement is a process by which we can redesign, reimplement and retest our solution.
We may want to make the solution more efficient, cheaper, simpler or more elegant. We
may find there are components that are redundant or unnecessary and try to eliminate
them. We may find errors or bugs in our solution that fail to solve the problem for some
or many instances. We may have misinterpreted requirements or there may have been
miscommunication, misunderstanding or differing expectations in the solution between
the designers and stakeholders. Situations may change or requirements may have been
modified or new requirements created and the solution needs to be adapted. Each of
these steps may need to be repeated many times until an ideal solution, or at least
acceptable, solution is achieved.
Yet another phase of problem solving is maintenance. The solution we create may need
to be maintained in order to remain functional and stay relevant. Design flaws or bugs
may become apparent that were missed in previous phases. The solution may need to be
updated to adapt to new technology or requirements.
In software design there are two general techniques for problem solving; top-down and
bottom-up design. A top-down design strategy approaches a problem by breaking it
down into smaller and smaller problems until either a solution is obvious or trivial or a
preexisting solution (the aforementioned “off-the-shelf” solution) exists. The solutions to
the subproblems are combined and interact to solve the overall problem.
A bottom-up strategy attempts to first completely define the smallest components or
entities that make up a system first. Once these have been defined and implemented,
they are combined and interactions between them are defined to produce a more complex
system.
1.2. Computing Basics
Everyone has some level of familiarity with computers and computing devices just as
everyone has familiarity with automotive basics. However, just because you drive a car
everyday doesn’t mean you can tell the difference between a crankshaft and a piston. To
get started, let’s familiarize ourselves with some basic concepts.
A computer is a device, usually electronic, that stores, receives, processes, and outputs
information. Modern computing devices include everything from simple sensors to mobile
devices, tablets, desktops, mainframes/servers, supercomputers and huge grid clusters
consisting of multiple computers networked together.
4
1.2. Computing Basics
Unit 2n Number of bytes
Kilobyte (KB) 210 1,024
Megabyte (MB) 220 1,048,576
Gigabyte (GB) 230 1,073,741,824
Terabyte (TB) 240 1,099,511,627,776
Petabyte (PB) 250 1,125,899,906,842,624
Exabyte (EB) 260 1,152,921,504,606,846,976
Zettabyte (ZB) 270 1,180,591,620,717,411,303,424
Yottabyte (YB) 280 1,208,925,819,614,629,174,706,176
Table 1.1.: Various units of digital information with respect to bytes. Memory is usually
measured using powers of two.
Computer hardware usually refers to the physical components in a computing system
which includes input devices such as a mouse/touchpad, keyboard, or touchscreen, output
devices such as monitors, storage devices such as hard disks and solid state drives, as
well as the electronic components such as graphics cards, main memory, motherboards
and chips that make up the Central Processing Unit (CPU).
Computer processors are complex electronic circuits (referred to as Very Large Scale Inte-
gration (VLSI)) which contain thousands of microscopic electronic transistors–electronic
“gates” that can perform logical operations and complex instructions. In addition to
the CPU a processor may contain an Arithmetic and Logic Unit (ALU) that performs
arithmetic operations such as addition, multiplication, division, etc.
Computer Software usually refers to the actual machine instructions that are run on a
processor. Software is usually written in a high-level programming language such as C or
Java and then converted to machine code that the processor can execute.
Computers “speak” in binary code. Binary is nothing more than a structured collection
of 0s and 1s. A single 0 or 1 is referred to as a bit. Bits can be collected to form larger
chunks of information: 8 bits form a byte, 1024 bytes is referred to as a kilobyte, etc.
Table 1.1 contains a several more binary units. Each unit is in terms of a power of 2
instead of a power of 10. As humans, we are more familiar with decimal–base-10 numbers
and so units are usually expressed as powers of 10, kilo- refers to 103 , mega- is 106 , etc.
However, since binary is base-2 (0 or 1), units are associated with the closest power
of 2. Computers are binary machines because it is the most practical to implement in
electronic devices. 0s and 1s can be easily represented by low/high voltage; low/high
frequency; on-off; etc. It is much easier to design and implement systems that switch
between only two states.
Computer memory can refer to secondary memory which are typically longterm storage
devices such as hard disks, flash drives, SD cards, optical disks (CDs, DVDs), etc. These
generally have a large capacity but are slower (the time it takes to access a chunk of data
is longer). Or, it can refer to main memory (or primary memory): data stored on chips
5
1. Introduction
that is much faster but also more expensive and thus generally smaller.
The first hard disk (IBM 350) was developed in 1956 by IBM and had a capacity of
3.75MB and cost $3,200 ($27,500 in 2015 dollars) per month to lease. For perspective,
the first commercially available TB hard drive was released in 2007. As of 2015, terabyte
hard disks can be commonly purchased for $50–$100.
Main memory, sometimes referred to as Random Access Memory (RAM) consists of
a collection of addresses along with contents. An address usually refers to a single
byte of memory (called byte-addressing). The content, that is the byte of data that is
stored at an address, can be anything. It can represent a number, a letter, etc. To the
computer it is all just a bunch of 0s and 1s. For convenience, memory addresses are
represented using hexadecimal, which is a base-16 counting system using the symbols
0, 1, . . . , 9, a, b, c, d, e, f . Numbers are prefixed with a 0x to indicate they represent
hexadecimal numbers. Figure 1.1 depicts memory and its address/contents.
Separate computing devices can be connected to each other through a network. Networks
can be wired with electrical signals or light as in fiber optics which provide large bandwidth
(the amount of data that can be sent at any one time), but can be expensive to build and
maintain. They can also be wireless, but provide shorter range and lower bandwidth.
1.3. Basic Program Structure
Programs start out as source code, a collection of instructions usually written in a high-
level programming language. A source file containing source code is nothing more than
a plain text file that can be edited by any text editor. However, many developers and
programmers utilize modern Integrated Development Environment (IDE) that provide a
text editor with code highlighting: various elements are displayed in different colors to
make the code more readable and elements can be easily identified. Mistakes such as
unclosed comments or curly brackets can be readily apparent with such editors. IDEs can
also provide automated compile/build features and other tools that make the development
process easier and faster.
Some languages are compiled languages meaning that a source file must be translated
into machine code that a processor can understand and execute. This is actually a
multistep process. A compiler may first preprocess the source file(s) and perform some
pre-compiler operations. It may then transform the source code into another language
such as an assembly language, a lower-level more machine-like language. Ultimately, the
compiler transforms the source code into object code, a binary format that the machine
can understand.
To produce an executable file that can actually be run, a linker may then take the object
code and link in any other necessary objects or precompiled library code necessary to
6
1.3. Basic Program Structure
Address Contents
.. ..
. .
0x7fff58310b8f
0x7fff58310b8b 0x32
0x7fff58310b8a 0x3e
0x7fff58310b89 0xcf
0x7fff58310b88 0x23
0x7fff58310b87 0x01
0x7fff58310b86 0x32
0x7fff58310b85 0x7c
0x7fff58310b84 0xff
0x7fff58310b83
0x7fff58310b82
0x7fff58310b81
0x7fff58310b80
0x7fff58310b7f
0x7fff58310b7e
0x7fff58310b7d
0x7fff58310b7c 3.14159265359
0x7fff58310b7b
0x7fff58310b7a
0x7fff58310b79
0x7fff58310b78 32,321,231
0x7fff58310b77
0x7fff58310b76
0x7fff58310b75
0x7fff58310b74 1,458,321
0x7fff58310b73 \0
0x7fff58310b72 o
0x7fff58310b71 l
0x7fff58310b70 l
0x7fff58310b6f e
0x7fff58310b6e H
0x7fff58310b88 0xfa
0x7fff58310b87 0xa8
0x7fff58310b86 0xba
.. ..
. .
Figure 1.1.: Depiction of Computer Memory. Each address refers to a byte, but different
types of data (integers, floating-point numbers, characters) may require
different amounts of memory. Memory addresses and some data is represented
in hexadecimal.
7
1. Introduction
produce a final program. Finally, an executable file (still just a bunch of binary code) is
produced.
Once an executable file has been produced we can run the program. When a program is
executed, a request is sent to the operating system to load and run the program. The
operating system loads the executable file into memory and may setup additional memory
for its variables as well as its call stack (memory to enable the program to make function
calls). Once loaded and setup, the operating system begins executing the instructions at
the program’s entry point.
In many languages, a program’s entry point is defined by a main function or method.
A program may contain many functions and pieces of code, but this special function is
defined as the one that gets invoked when a program starts. Without a main function,
the code may still be useful: libraries contain many useful functions and procedures so
that you don’t have to write a program from scratch. However, these functions are not
intended to be run by themselves. Instead, they are written so that other programs can
use them. A program becomes executable only when a main entry point is provided.
This compile-link-execute process is roughly depicted in Code Sample 1.2. An example of
a simple C program can be found in Code Sample 1.1 along with the resulting assembly
code produced by a compiler in Figure 1.2 and the final machine code represented in
hexadecimal in Code Sample 1.3.
In contrast, some languages are interpreted, not compiled. The source code is contained
in a file usually referred to as a script. Rather than being run directly by an operating
system, the operating system loads and execute another program called an interpreter.
The interpreter then loads the script, parses, and execute its instructions. Interpreted
languages may still have a predefined main function, but in general, a script starts
executing starting with the first instruction in the script file. Adhering to the syntax
rules is still important, but since interpreted languages are not compiled, syntax errors
become runtime errors. A program may run fine until its first syntax error at which
point it fails.
There are other ways of compiling and running programs. Java for example represents a
compromise between compiled and interpreted languages. Java source code is compiled
into Java bytecode which is not actually machine code that the operating system and
hardware can run directly. Instead, it is compiled code for a Java Virtual Machine (JVM).
This allows a developer to write highly portable code, compile it once and it is runnable
on any JVM on any system (write-once, compile-once, run-anywhere).
In general, interpreted languages are slower than compiled languages because they are
being run through another program (the interpreter) instead of being executed directly
by the processor. Modern tools have been introduced to solve this problem. Just In Time
(JIT) compilers have been developed that take scripts that are not usually compiled,
and compile them to a native machine code format which has the potential to run much
8
1.3. Basic Program Structure
Text Editor
Source File
or IDE
Syntax Other Object
Compiler Files &
Error(s)
Libraries
success
Object File Linker
Input
Executable Results &
File Output
run
Figure 1.2.: A Compiling Process
9
1. Introduction
1 #include <stdlib.h>
2 #include <stdio.h>
3 #include <math.h>
4
5 int main(int argc, char **argv) {
6
7 if(argc != 2) {
8 fprintf(stderr, "Usage: %s x\n", argv[0]);
9 exit(1);
10 }
11
12 double x = atof(argv[1]);
13 double result = sqrt(x);
14
15 if(x < 0) {
16 fprintf(stderr, "Cannot handle complex roots\n");
17 exit(2);
18 }
19
20 printf("square root of %f = %f\n", x, result);
21
22 return 0;
23 }
Code Sample 1.1.: A simple program in C
10
1.3. Basic Program Structure
.section __TEXT,__text,regular,pure_instructions
.globl _main
.align 4, 0x90
_main: ## @main
.cfi_startproc
## BB#0:
pushq %rbp
Ltmp2:
.cfi_def_cfa_offset 16
Ltmp3:
.cfi_offset %rbp, -16
movq %rsp, %rbp
Ltmp4:
.cfi_def_cfa_register %rbp
subq $48, %rsp
movl $0, -4(%rbp)
movl %edi, -8(%rbp)
movq %rsi, -16(%rbp)
cmpl $2, -8(%rbp)
je LBB0_2
## BB#1:
leaq L_.str(%rip), %rsi
movq ___stderrp@GOTPCREL(%rip), %rax
movq (%rax), %rdi
movq -16(%rbp), %rax
movq (%rax), %rdx
movb $0, %al
callq _fprintf
movl $1, %edi
movl %eax, -36(%rbp) ## 4-byte Spill
callq _exit
LBB0_2:
movq -16(%rbp), %rax
movq 8(%rax), %rdi
callq _atof
xorps %xmm1, %xmm1
movsd %xmm0, -24(%rbp)
movsd -24(%rbp), %xmm0
sqrtsd %xmm0, %xmm0
movsd %xmm0, -32(%rbp)
ucomisd -24(%rbp), %xmm1
jbe LBB0_4
## BB#3:
leaq L_.str1(%rip), %rsi
movq ___stderrp@GOTPCREL(%rip), %rax
movq (%rax), %rdi
movb $0, %al
callq _fprintf
movl $2, %edi
movl %eax, -40(%rbp) ## 4-byte Spill
callq _exit
LBB0_4:
leaq L_.str2(%rip), %rdi
movsd -24(%rbp), %xmm0
movsd -32(%rbp), %xmm1
movb $2, %al
callq _printf
movl $0, %ecx
movl %eax, -44(%rbp) ## 4-byte Spill
movl %ecx, %eax
addq $48, %rsp
popq %rbp
retq
.cfi_endproc
.section __TEXT,__cstring,cstring_literals
L_.str: ## @.str
.asciz "Usage: %s x\n"
L_.str1: ## @.str1
.asciz "Cannot handle complex roots\n"
L_.str2: ## @.str2
.asciz "square root of %f = %f\n"
.subsections_via_symbols
Code Sample 1.2.: A simple program in C, compiled to assembly
11
1. Introduction
00000e40 55 48 89 e5 48 83 ec 30 c7 45 fc 00 00 00 00 89 |UH..H..0.E......|
00000e50 7d f8 48 89 75 f0 81 7d f8 02 00 00 00 0f 84 2c |}.H.u..}.......,|
00000e60 00 00 00 48 8d 35 f2 00 00 00 48 8b 05 9f 01 00 |...H.5....H.....|
00000e70 00 48 8b 38 48 8b 45 f0 48 8b 10 b0 00 e8 94 00 |.H.8H.E.H.......|
00000e80 00 00 bf 01 00 00 00 89 45 dc e8 81 00 00 00 48 |........E......H|
00000e90 8b 45 f0 48 8b 78 08 e8 6e 00 00 00 0f 57 c9 f2 |.E.H.x..n....W..|
00000ea0 0f 11 45 e8 f2 0f 10 45 e8 f2 0f 51 c0 f2 0f 11 |..E....E...Q....|
00000eb0 45 e0 66 0f 2e 4d e8 0f 86 25 00 00 00 48 8d 35 |E.f..M...%...H.5|
00000ec0 a5 00 00 00 48 8b 05 45 01 00 00 48 8b 38 b0 00 |....H..E...H.8..|
00000ed0 e8 41 00 00 00 bf 02 00 00 00 89 45 d8 e8 2e 00 |.A.........E....|
00000ee0 00 00 48 8d 3d 9d 00 00 00 f2 0f 10 45 e8 f2 0f |..H.=.......E...|
00000ef0 10 4d e0 b0 02 e8 22 00 00 00 b9 00 00 00 00 89 |.M....".........|
00000f00 45 d4 89 c8 48 83 c4 30 5d c3 ff 25 08 01 00 00 |E...H..0]..%....|
00000f10 ff 25 0a 01 00 00 ff 25 0c 01 00 00 ff 25 0e 01 |.%.....%.....%..|
00000f20 00 00 00 00 4c 8d 1d dd 00 00 00 41 53 ff 25 cd |....L......AS.%.|
00000f30 00 00 00 90 68 00 00 00 00 e9 e6 ff ff ff 68 0c |....h.........h.|
00000f40 00 00 00 e9 dc ff ff ff 68 18 00 00 00 e9 d2 ff |........h.......|
00000f50 ff ff 68 27 00 00 00 e9 c8 ff ff ff 55 73 61 67 |..h'........Usag|
00000f60 65 3a 20 25 73 20 78 0a 00 43 61 6e 6e 6f 74 20 |e: %s x..Cannot |
00000f70 68 61 6e 64 6c 65 20 63 6f 6d 70 6c 65 78 20 72 |handle complex r|
00000f80 6f 6f 74 73 0a 00 73 71 75 61 72 65 20 72 6f 6f |oots..square roo|
00000f90 74 20 6f 66 20 25 66 20 3d 20 25 66 0a 00 00 00 |t of %f = %f....|
00000fa0 01 00 00 00 1c 00 00 00 00 00 00 00 1c 00 00 00 |................|
00000fb0 00 00 00 00 1c 00 00 00 02 00 00 00 40 0e 00 00 |............@...|
00000fc0 34 00 00 00 34 00 00 00 0b 0f 00 00 00 00 00 00 |4...4...........|
00000fd0 34 00 00 00 03 00 00 00 0c 00 01 00 10 00 01 00 |4...............|
00000fe0 00 00 00 00 00 00 00 01 14 00 00 00 00 00 00 00 |................|
00000ff0 01 7a 52 00 01 78 10 01 10 0c 07 08 90 01 00 00 |.zR..x..........|
00001000 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 |................|
00001010 00 00 00 00 00 00 00 00 34 0f 00 00 01 00 00 00 |........4.......|
00001020 3e 0f 00 00 01 00 00 00 48 0f 00 00 01 00 00 00 |>.......H.......|
00001030 52 0f 00 00 01 00 00 00 00 00 00 00 00 00 00 00 |R...............|
00001040 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 |................|
...(cut for room)...
00002000 11 22 18 54 00 00 00 00 11 40 5f 5f 5f 73 74 64 |.".T.....@___std|
00002010 65 72 72 70 00 51 72 10 90 40 64 79 6c 64 5f 73 |errp.Qr..@dyld_s|
00002020 74 75 62 5f 62 69 6e 64 65 72 00 80 e8 ff ff ff |tub_binder......|
00002030 ff ff ff ff ff 01 90 00 72 18 11 40 5f 61 74 6f |........r..@_ato|
00002040 66 00 90 00 72 20 11 40 5f 65 78 69 74 00 90 00 |f...r .@_exit...|
00002050 72 28 11 40 5f 66 70 72 69 6e 74 66 00 90 00 72 |r(.@_fprintf...r|
00002060 30 11 40 5f 70 72 69 6e 74 66 00 90 00 00 00 00 |0.@_printf......|
00002070 00 01 5f 00 05 00 02 5f 6d 68 5f 65 78 65 63 75 |.._...._mh_execu|
00002080 74 65 5f 68 65 61 64 65 72 00 21 6d 61 69 6e 00 |te_header.!main.|
00002090 25 02 00 00 00 03 00 c0 1c 00 00 00 00 00 00 00 |%...............|
000020a0 c0 1c 00 00 00 00 00 00 fa de 0c 05 00 00 00 14 |................|
000020b0 00 00 00 01 00 00 00 00 00 00 00 00 00 00 00 00 |................|
000020c0 02 00 00 00 0f 01 10 00 00 00 00 00 01 00 00 00 |................|
000020d0 16 00 00 00 0f 01 00 00 40 0e 00 00 01 00 00 00 |........@.......|
000020e0 1c 00 00 00 01 00 00 01 00 00 00 00 00 00 00 00 |................|
000020f0 27 00 00 00 01 00 00 01 00 00 00 00 00 00 00 00 |'...............|
00002100 2d 00 00 00 01 00 00 01 00 00 00 00 00 00 00 00 |-...............|
00002110 33 00 00 00 01 00 00 01 00 00 00 00 00 00 00 00 |3...............|
00002120 3c 00 00 00 01 00 00 01 00 00 00 00 00 00 00 00 |<...............|
00002130 44 00 00 00 01 00 00 01 00 00 00 00 00 00 00 00 |D...............|
00002140 03 00 00 00 04 00 00 00 05 00 00 00 06 00 00 00 |................|
00002150 07 00 00 00 00 00 00 40 02 00 00 00 03 00 00 00 |.......@........|
00002160 04 00 00 00 05 00 00 00 06 00 00 00 20 00 5f 5f |............ .__|
00002170 6d 68 5f 65 78 65 63 75 74 65 5f 68 65 61 64 65 |mh_execute_heade|
00002180 72 00 5f 6d 61 69 6e 00 5f 5f 5f 73 74 64 65 72 |r._main.___stder|
00002190 72 70 00 5f 61 74 6f 66 00 5f 65 78 69 74 00 5f |rp._atof._exit._|
000021a0 66 70 72 69 6e 74 66 00 5f 70 72 69 6e 74 66 00 |fprintf._printf.|
000021b0 64 79 6c 64 5f 73 74 75 62 5f 62 69 6e 64 65 72 |dyld_stub_binder|
000021c0 00 00 00 00 |....|
000021c4
Code Sample 1.3.: A simple program in C, resulting machine code formatted in hexadec-
imal (partial)
12
1.4. Syntax Rules & Pseudocode
faster than when interpreted. Modern web browsers typically do this for JavaScript code
(Google Chrome’s V8 JavaScript engine for example).
Another related technology are transpilers. Transpilers are source-to-source compilers.
They don’t produce assembly or machine code, instead they translate code in one
high-level programming language to another high-level programming language. This
is sometimes done to ensure that scripting languages like JavaScript are backwards
compatible with previous versions of the language. Transpilers can also be used to
translate one language into the same language but with different aspects (such as parallel
or synchronized code) automatically added. They can also be used to translate older
languages such as Pascal to more modern languages as a first step in updating a legacy
system.
1.4. Syntax Rules & Pseudocode
Programming languages are a lot like human languages in that they have syntax rules.
These rules dictate the appropriate arrangements of words, punctuation, and other
symbols that form valid statements in the language. For example, in many programming
languages, commands or statements are terminated by semicolons (just as most sentences
are ended with a period). This is an example of “punctuation” in a programming language.
In English paragraphs are separated by lines, in programming languages blocks of code
are separated by curly brackets. Variables are comparable to nouns and operations and
functions are comparable to verbs. Complex documents often have footnotes that provide
additional explanations; code has comments that provide documentation and explanation
for important elements. English is read top-to-bottom, left-to-right. Programming
languages are similar: individual executable commands are written one per line. When a
program executes, each command executes one after the other, top-to-bottom. This is
known as sequential control flow.
A block of code is a section of code that has been logically grouped together. Many
languages allow you to define a block by enclosing the grouped code around opening and
closing curly brackets. Blocks can be nested within each other to form sub-blocks.
Most languages also have reserved words and symbols that have special meaning. For
example, many languages assign special meaning to keywords such as for , if , while ,
etc. that are used to define various control structures such as conditionals and loops.
Special symbols include operators such as + and * for performing basic arithmetic.
Failure to adhere to the syntax rules of a particular language will lead to bugs and
programs that fail to compile and/or run. Natural languages such as English are very
forgiving: we can generally discern what someone is trying to say even if they speak
in broken English (to a point). However, a compiler or interpreter isn’t as smart as a
human. Even a small syntax error (an error in the source code that does not conform
13
1. Introduction
to the language’s rules) will cause a compiler to completely fail to understand the code
you have written. Learning a programming language is a lot like learning a new spoken
language (but, fortunately a lot easier).
In subsequent parts of this book we focus on particular languages. However, in order
to focus on concepts, we’ll avoid specific syntax rules by using pseudocode, informal,
high-level descriptions of algorithms and processes. Good pseudocode makes use of plain
English and mathematical notation, making it more readable and abstract. A small
example can be found in Algorithm 1.1.
Input : A collection of numbers, A = {a1 , a2 , . . . , an }
Output : The minimal element in A
1 Let min be equal to a1
2 foreach element ai in A do
3 if ai < min then
4 ai is less than the smallest element we’ve found so far
5 Update min to be equal to ai
6 end
7 end
8 output min
Algorithm 1.1: An example of pseudocode: finding a minimum value
1.5. Documentation, Comments, and Coding Style
Good code is not just functional, it is also beautiful. Good code is organized, easy to
read, and well documented. Organization can be achieved by separating code into useful
functions and collecting functions into modules or libraries. Good organization means
that at any one time, we only need to focus on a small part of a program.
It would be difficult to read an essay that contained random line breaks, paragraphs
were not indented, it contained different spacing or different fonts, etc. Likewise, code
should be legible. Well written code is consistent and makes good use of whitespace
and indentation. Code within the same code block should be indented at the same level.
Nested blocks should be further indented just like the outline of an essay or table of
contents.
Code should also be well documented. Each line or segment of code should be clear
enough that it tells the user what the code does and how it does it. This is referred to as
“self-documenting” code. A person familiar with the particular language should be able
to read your code and immediately understand what it does. In addition, well-written
14
1.5. Documentation, Comments, and Coding Style
code should contain sufficient and clear comments. A comment in a program is intended
for a human user to read. A comment is ultimately ignored by the compiler/interpreter
and has no effect on the actual program. Good comments tell the user why the code was
written or why it was written the way it was. Comments provide a high-level description
of what a block of code, function, or program does. If the particular method or algorithm
is of interest, it should also be documented.
There are typically two ways to write comments. Single line comments usually begin
with two forward slashes, // .1 Everything after the slashes until the next line is ignored.
Multiline comments begin with a /* and end with a */ ; everything between them is
ignored even if it spans multiple lines. This syntax is shared among many languages
including C, Java, PHP and others. Some examples:
1 double x = sqrt(y); //this is a single line comment
2
3 /*
4 This is a multiline comment
5 each line is ignored, but allows
6 for better formatting
7 */
8
9 /**
10 * This is a doc-style comment, usually placed in
11 * front of major portions of code such as a function
12 * to provide documentation
13 * It begins with a forward-slash-star-star
14 */
The last example above is a doc-style comment. It originated with Java, but has since
been adopted by many other programming languages. Syntactically it is a normal
multiline comment, but begins with a /** . Asterisks are aligned together on each
line. Certain commenting systems allow you to place other marked up data inside these
comments such as labeling parameters ( @param x ) or use HTML code to provide links
and style. These doc-style comments are used to provide documentation for major parts
of the code especially functions and data structures. Though not part of the language,
other documentation tools can be used to gather the information in doc-style comments
to produce formatted documentation such as web pages or Portable Document Format
(PDF) documents.
1
You can remember the difference between a forward slash / and a backslash \ by thinking of a
person facing right and either leaning backwards (backslash) or forwards (forward slash).
15
1. Introduction
Comments should not be trivial: they should not explain something that should be
readily apparent to an experienced user or programmer. For example, if a piece of code
adds two numbers together and stores the result, there should not be a comment that
explains the process. It is a simple and common enough operation that is self-evident.
However, if a function uses a particular process or algorithm such as a Fourier Transform
to perform an operation, it would be appropriate to document it in a series of comments.
Comments can also detail how a function or piece of code should be used. This is
typically done when developing an Application Programmer Interface (API) for use
by other programmers. The API’s available functions should be well documented so
that users will know how and when to use a particular function. It can document the
function’s expectations and behavior such as how it handles bad input or error situations.
16
2. Basics
2.1. Control Flow
The flow of control (or simply control flow) is how a program processes its instructions.
Typically, programs operate in a linear or sequential flow of control. Executable statements
or instructions in a program are performed one after another. In source code, the order
that instructions are written defines their order. Just like English, a program is “read”
top to bottom. Each statement may modify the state of a program. The state of a
program is the value of all its variables and other information/data stored in memory
at a given moment during its execution. Further, an executable statement may instead
invoke (or call or execute) another procedure (also called subroutine, function, method,
etc.) which is another unit of code that has been encapsulated into one unit so that it
can be reused.
This type of control flow is usually associated with a procedural programming paradigm
(which is closely related to imperative or structured programming paradigms). Though
this text will mostly focus on languages that are procedural (or that have strong procedural
aspects), it is important to understand that there are other programming language
paradigms. Functional programming languages such as Scheme and Haskell achieve
computation through the evaluation of mathematical functions with as little or no (“pure”
functional) state at all. Declarative languages such as those used in database languages
like SQL or in spreadsheets like Excel specify computation by expressing the logic of
computation rather than explicitly specifying control flow. For a more formal introduction
to programming language paradigms, a good resource is Seven Languages in Seven Weeks:
A Pragmatic Guide to Learning Programming Languages by Tate [37].
2.1.1. Flowcharts
Sometimes processes are described using diagrams called flowcharts. A flowchart is a
visual representation of an algorithm or process consisting of boxes or “nodes” connected
by directed edges. Boxes can represent an individual step or a decision to be made. The
edges establish an order of operations in the diagram.
Some boxes represent decisions to be made which may have one or more alternate routes
(more than one directed edge going out of the box) depending on the the result of the
17
2. Basics
Decision Control to Action to
Node Perform Perform
(a) Decision Node (b) Control Node (c) Action Node
Figure 2.1.: Types of Flowchart Nodes. Control and action nodes are distinguished
by color. Control nodes are automated steps while action nodes are steps
performed as part of the algorithm being depicted.
decision. Decision boxes are usually depicted with a diamond shaped box.
Other boxes represent a process, operation, or action to be performed. Boxes representing
a process are usually rectangles. We will further distinguish two types of processes using
two different colorings: we’ll use green to represent boxes that are steps directly related
to the algorithm being depicted. We’ll use blue for actions that are necessary to the
control flow of the algorithm such as assigning a value to a variable or incrementing a
value as part of a loop. Figure 2.1 depicts the three types of boxes we’ll use. Figure 2.2
depicts a simple ATM (Automated Teller Machine) process as an example.
2.2. Variables
In mathematics, variables are used as placeholders for values that aren’t necessarily
known. For example, in the equation,
x = 3y + 5
the variables x and y represent numbers that can take on a number of different values.
Similarly, in a computer program, we also use variables to store values. A variable is
essentially a memory location in which a value can be stored. Typically, a variable is
referred to by a name or identifier (like x, y, z in mathematics). In mathematics variables
are usually used to hold numerical values. However, in programming, variables can
usually hold different types of values such as numbers, strings (a collection of characters),
Booleans (true or false values), or more complex types such as arrays or objects.
18
2.2. Variables
User Input
amount
yes Get yes
Is PIN Sufficient Dispense
Input PIN amount of
correct? Funds? amount
withdraw
no
no
Eject Card
Figure 2.2.: Example of a flowchart for a simple ATM process
2.2.1. Naming Rules & Conventions
Most programming languages have very specific rules as to what you can use as variable
identifiers (names). For example, most programming languages do not allow you to use
whitespace characters (space, tab, etc.) in a variable’s identifier. Allowing spaces would
make variable names ambiguous: where does the variable’s name end and the rest of the
program continue? How could you tell the difference between “average score” and two
separate variables named “average” and “score”? Many programming languages also
have reserved words–words or terms that are used by the programming language itself
and have special meaning. Variable names cannot be the same as any reserved word as
the language wouldn’t be able to distinguish between them.
For similar reasons, many programming languages do not allow you to start a variable
name with a number as it would make it more difficult for a compiler or interpreter to
parse a program’s source code. Yet other languages require that variables begin with a
specific character (PHP for example requires that all variables begin with a dollar sign,
$ ).
In general, most programming languages allow you to use a combination of uppercase
A-Z and lowercase a-z letters as well as numbers, [0-9] and certain special characters
such as underscores _ or dollar signs, $ . Moreover, most programming languages (like
English) are case sensitive meaning that a variable name using lowercase letters is not
the same variable as one that uses uppercase letters. For example, the variables x and
X are different; the variables average , Average and AVERAGE are all different as well.
A few languages are case-insensitive meaning that they do not recognize differences in
lower and uppercase letters when used in variable identifiers. Even in these languages,
19
2. Basics
however, using a mixture of lowercase and uppercase letters to refer to the same variable
is discouraged: it is difficult to read, inconsistent, and just plain ugly.
Beyond the naming rules that languages may enforce, most languages have established
naming conventions; a set of guidelines and best-practices for choosing identifier names
for variables (as well as functions, methods, and class names). Conventions may be
widely adopted on a per-language basis or may be established within a certain library,
framework or by an organization that may have official style guides. Naming conventions
are intended to give source code consistency which ultimately improves readability and
makes it easier to understand. Following a consistent convention can also greatly reduce
the chance for errors and mistakes. Good naming conventions also has an aesthetic
appeal; code should be beautiful.
There are several general conventions when it comes to variables. An early convention,
but still in common use is underscore casing in which variable names consisting of more
than one word have words separated by underscore characters with all other characters
being lowercase. For example:
average_score , number_of_students , miles_per_hour
A variation on this convention is to use all uppercase letters such as MILES_PER_HOUR .
A more modern convention is to use lower camel casing (or just camel casing) in which
variable names with multiple words are written as one long word with the first letter in
each new word capitalized but with the first word’s first letter lowercase. For example:
averageScore , numberOfStudents , milesPerHour
The convention refers to the capitalized letters resembling the humps of a camel. One
advantage that camel casing has over underscore casing is that you’re not always straining
to type the underscore character. Yet another similar convention is upper camel casing,
also known as PascalCase 1 which is like camel casing, but the first letter in the first word
is also capitalized:
AverageScore , NumberOfStudents , MilesPerHour
Each of these conventions is used in various languages in different contexts which we’ll
explore more fully in subsequent sections (usually underscore lowercasing and camel
casing are used to denote variables and functions, PascalCase is used to denote user
defined types such as classes or structures, and underscore uppercasing is used to denote
static and constant variables). However, for our purposes, we’ll use lower camel casing
for variables in our pseudocode.
1
Rarely, this is referred to as DromedaryCase; a Dromedary is an Arabian camel.
20
2.2. Variables
There are exceptions and special cases to each of these conventions such as when a variable
name involves an acronym or a hyphenated word, etc. In such cases sensible extensions or
compromises are employed. For example, xmlString or priorityXMLParser (involving
the acronym Extensible Markup Language (XML)) may be used which keep all letters in
the acronym consistent (all lowercase or all uppercase).
In addition to these conventions, there are several best-practice principles when deciding
on identifiers.
• Be descriptive, but not verbose – Use variable names that describe what the
variable represents. The examples above, averageScore , numberOfStudents ,
milesPerHour clearly indicate what the variable is intended to represent. Using
good, descriptive names makes it your code self-documenting (a reader can make
sense of it without having to read extensive supplemental documentation).
Avoid meaningless variable names such as value , aVariable , or some cryptic
combination of v10 (its the 10th variable I’ve used!). Ambiguous variables such
as name should also be avoided unless the context makes its clear what you are
referring to (as when used inside of a Person object).
Single character variables are commonly used, but used in a context in which their
meaning is clearly understood. For example, variable names such as x , y are okay
if they are used to refer to points in the Euclidean plane. Single character variables
such as i , j are often used as index variables when iterating over arrays. In this
case, terseness is valued over descriptiveness as the context is very well understood.
As a general rule, the more a variable is used, the shorter it should be. For
example, the variable numStudents may be preferred over the full variable
numberOfStudents .
• Avoid abbreviations (or at least use them sparingly) – You’re not being charged by
the character in your code; you can afford to write out full words. Abbreviations can
help to write shorter variable names, but not all abbreviations are the same. The
word “abbreviation” itself could be abbreviated as “abbr.”, “abbrv.” or “abbrev.”
for example. Abbreviations are not always universally understood by all users,
may be ambiguous and non-standard. Moreover, modern IDEs provide automatic
code completion, relieving you of the need to type longer variable names. If the
abbreviation is well-known or understood from context, then it may make sense to
use it.
• Avoid acronyms (or at least use them sparingly) – Using acronyms in variable
names come with many of the same problems as abbreviations. However, if it makes
sense in the context of your code and has little chance of being misunderstood or
mistaken, then go for it. For example, in the context of a financial application,
APR (Annual Percentage Rate) would be a well-understood acronym in which case
21
2. Basics
the variable apr may be preferred over the longer annualPercentageRate .
• Avoid pluralizations, use singular forms – English is not a very consistent language
when it comes to rules like pluralizations. For most cases you simply add “s”; for
others you add “es” or change the “y” to “i” and add “es”. Some words are the
same form for singular and plural such as “glasses.”2 Other words have completely
different forms (“focus” becomes “foci”). Still yet there are instances in which
multiple words are acceptable: the plural of “person” can be “persons” or “people”.
Avoiding plural forms keeps things simple and consistent: you don’t need to be
a grammarian in order easily read code. One potential exception to this is when
using a collection such as an array to hold more than one element or the variable
represents a quantity that is pluralized (as with numberOfStudents above).
Though the guidelines above provide a good framework from which to write good variable
names, reasonable people can and do disagree on best practice because at some point as
you go from generalities to specifics, conventions become more of a matter of personal
preference and subjective aesthetics. Sometimes an organization may establish its own
coding standards or style guide that must be followed which of course trumps any of the
guidelines above.
In the end, a good balance must be struck between readability and consistency. Rules
and conventions should be followed, until they get in the way of good code that is.
2.2.2. Types
A variable’s type (or data type) is the characterization of the data that it represents. As
mentioned before, a computer only “speaks” in 0s and 1s (binary). A variable is merely
a memory location in which a series of 0s and 1s is stored. That binary string could
represent a number (either an integer or a floating point number), a single alphanumeric
character or series of characters (string), a Boolean type or some other, more complex
user-defined type.
The type of a variable is important because it affects how the raw binary data stored
at a memory location is interpreted. Moreover, some types take a different amount of
memory to store. For example, an integer type could take 32 bits while a floating point
type could take 64 bits. Programming languages may support different types and may
do so in different ways. In the next few sections we’ll describe some common types that
are supported by many languages.
2
These are called plurale tantum (nouns with no singular form) and singular tantum (nouns with no
plural form) for you grammarians. Words like “sheep” are unchanging irregular plurals; words whose
singular and plural forms are the same.
22
2.2. Variables
Numeric Types
At their most basic, computers are number crunching machines. Thus, the most basic
type of variable that can be used in a computer program is a numeric type. There are
several numeric types that are supported by various programming languages. The most
simple is an integer type which can represent whole numbers 0, 1, 2, etc. and their
negations, −1, −2, . . .. Floating point numeric types represent decimal numbers such
as 0.5, 3.14, 4.0, etc. However, neither integer nor floating point numbers can represent
every possible number since they use a finite number of bits to represent the number. We
will examine this in detail below. For now, let’s understand how a computer represents
both integers and floating point numbers in memory.
As humans, we “think” in base-10 (decimal) because we have 10 fingers and 10 toes.
When we write a number with multiple digits in base-10 we do so using “places” (ones
place, tens place, hundreds place, etc.). Mathematically, a number in base-10 can be
broken down into powers of ten; for example:
3, 201 = 3 × 103 + 2 × 102 + 0 × 101 + 1 × 100
In general, any number in base-10 can be written as the summation of powers of 10
multiplied by numbers 0–9,
ck × 10k + ck−1 × 10k−1 + · · · c1 · 101 + c0
In binary, numbers are represented in the same way, but in base-2 in which we only have
0 and 1 as symbols. To illustrate, let’s consider counting from 0: in base-10, we would
count 0, 1, 2, . . . , 9 at which point we “carry-over” a 1 to the tens spot and start over at
0 in the ones spot, giving us 10, 11, 12, . . . , 19 and repeat the carry-over to 20.
With only two symbols, the carry-over occurs much more frequently, we count 0, 1 and
then carry over and have 10. It is important to understand, this is not “ten”: we are
counting in base-2, so 10 is actually equivalent to 2 in base-10. Continuing, we have 11
and again carry over, but we carry it over twice giving us 100 (just like we’d carry over
twice when going from 99 to 100 in base-10). A full count from 0 to 16 in binary can be
found in Table 2.1. In many programming languages, a prefix of 0b is used to denote a
number represented in binary. We use this convention in the table.
As a fuller example, consider again the number 3,201. This can be represented in binary
23
2. Basics
as follows.
0b110010000001 = 1 × 211 + 1 × 210 + 0 × 29 + 0 × 28 +
1 × 27 + 0 × 26 + 0 × 25 + 0 × 24 +
0 × 23 + 0 × 22 + 0 × 21 + 1 × 20
= 211 + 210 + 27 + 20
= 2, 048 + 1, 024 + 128 + 1
= 3, 201
Representing negative numbers is a bit more com-
plicated and is usually done using a scheme called Base-10 Binary
two’s complement. We omit the details, but essen- 0 0b0
tially the first bit in the representation serves as a 1 0b1
sign bit: zero indicates positive, while 1 indicates 2 0b10
negative. Negative values are represented as a com- 3 0b11
plement with respect to 2n (a complement is where 4 0b100
0s and 1s are “flipped” to 1s and 0s). 5 0b101
When represented using two’s complement, binary 6 0b110
numbers with n bits can represent numbers x in the 7 0b111
range 8 0b1000
−2n−1 ≤ x ≤ 2n−1 − 1 9 0b1001
10 0b1010
Note that the upper bound follows from the fact 11 0b1011
that 12 0b1100
n−2
X
0b 11 . . . 011 = 2i = 2n−1 − 1 13 0b1101
| {z } i=0 14 0b1110
n bits 15 0b1111
The −1 captures the idea that we start at zero. The 16 0b10000
exponent in the upper bound is n − 1 since we need
one bit to represent the sign. The lower bound Table 2.1.: Counting in Binary
n−1
represents the idea that we have 2 possible values (n − 1 since we need one bit for
the sign bit) and we don’t need to start at zero, we can start at −1. Table 2.2 contains
ranges for common integer types using various number of bits.
n (number of bits) minimum maximum
8 -128 127
16 -32,768 32,767
32 -2,147,483,648 2,147,483,647
64 -9,223,372,036,854,775,808 9,223,372,036,854,775,807
128 ≈ −3.4028 × 1038 ≈ 3.4028 × 1038
Table 2.2.: Ranges for various signed integer types
24
2.2. Variables
Some programming languages allow you to define variables that are unsigned in which
the sign bit is not used to indicate positive/negative. With the extra bit we can represent
numbers twice as big; using n bits we can represent numbers x in the range
0 ≤ x ≤ 2n − 1
Floating point numbers in binary are represented in a manner similar to scientific notation.
Recall that in scientific notation, a number is normalized by multiplying it by some power
of 10 so that it its most significant digit is between 1 and 9. The resulting normalized
number is called the significand while the power of ten that the number was scaled by is
called the exponent (and since we are base-10, 10 is the base). In general, a number in
scientific notation is represented as:
significand × baseexponent
For example,
exponent
z}|{
14326.123 = 1.4326123 × 10 4
| {z } |{z}
significand base
Sometimes the notations 1.4326123e + 4, 1.4326123e4 or 1.4326123E4 are used. As before,
we can see that a fractional number in base-10 can be seen as a summation of powers of
10:
1.4326123 = 1 × 101 + 4 × 10−1 + 3 × 10−2 + 2 × 10−3 +
6 × 10−4 + 1 × 10−5 + 2 × 10−6 + 3 × 10−7
In binary, floating point numbers are represented in a similar way, but the base is 2,
consequently a fractional number in binary is a summation of powers of 2. For example,
110.011 =1 × 22 + 1 × 21 + 0 × 20 + 0 × 2−1 + 1 × 2−2 + 1 × 2−3
1 1 1
=1 × 4 + 1 × 2 + 0 × 1 + 0 × + 1 × + 1 ×
2 4 8
1 1
=4 + 2 + 0 + 0 + +
4 8
=6.375
In binary, the significand is often referred to as a mantissa. We also normalize a binary
floating point number so that the mantissa is between 12 and 1. This is where the term
floating point comes from: the decimal point (more generally called a radix point) “floats”
left and right to ensure that the number is always normalized. The example above would
normalized to
0.110011 × 23
Here, 0.110011 is the mantissa and 3 is the exponent (which in binary would be 0b11).
25
2. Basics
Name Bits Exponent Bits Mantissa Bits Significant Digits Approximate
of Precision Range
Half 16 5 10 ≈ 3.3 103 ∼ 104.5
Single 32 8 23 ≈ 7.2 10−38 ∼ 1038
Double 64 11 52 ≈ 15.9 10−308 ∼ 10308
Quadruple 128 15 112 ≈ 34.0 10−4931 ∼ 104931
Table 2.3.: Summary of Floating-point Precisions in the IEEE 754 Standard. Half and
quadruple are not widely adopted.
Most modern programming languages implement floating point numbers according to the
Institute of Electrical and Electronics Engineers (IEEE) 754 Standard [20] (also called
the International Electrotechnical Commission (IEC) 60559 [19]). When represented
in binary, a fixed number of bits must be used to represent the sign, mantissa and
exponent. The standard defines several precisions that each use a fixed number of bits
with a resulting number of significant digits (base-10) of precision. Table 2.3 contains a
summary of a few of the most commonly implemented precisions.
Just as with integers, the finite precision of floating point numbers results in several limi-
tations. First, irrational numbers such as π = 3.14159 . . . can only be approximated out
to a certain number of digits. For example, with single precision π ≈ 3.1415927 which is
accurate only to the 6th decimal place and with double precision, π ≈ 3.1415926535897931
approximate to only 15 decimal places.3 In fact, regardless of how many bits we allow in
our representation, an irrational number like π (that never repeats and never terminates)
will only ever be an approximation. Real numbers like π require an infinite precision,
but computers are only finite machines.
Even numbers that have a finite representation (rational numbers) such as 13 = 0.333 are
not represented exactly when using floating point numbers. In double precision binary,
1
= 0b1.0101010101010101010101010101010101010101010101010101 × 2−2
3
which when represented in scientific notation in decimal is
3.3333333333333330 × 10−1
That is, there are only 16 digits of precision, after which the remaining (infinite) sequence
of 3s get cut off.
Programming languages usually only support the common single and double precisions
defined by the IEEE 754 standard as those are commonly supported by hardware.
3
The first 80 digits of π are
3.14159265358979323846264338327950288419716939937510582097494459230781640628620899
though only 39 digits of π are required to accurately calculate the volume of the known universe to
within one atom.
26
2.2. Variables
However, there are languages that support arbitrary precision (also called multiprecision)
numbers and yet other languages that have many libraries to support “big number”
arithmetic. Arbitrary precision is still not infinite: instead, as more digits are needed,
more memory is allocated. If you want to compute 10 more digits of π, you can but at a
cost. To support the additional digits, more memory is allocated. Also, operations are
performed in software using many operations which can be much slower than performing
fixed-precision arithmetic directly in hardware. Still, there are many applications where
such accuracy or large numbers are absolutely essential.
Characters & Strings
Another type of data is textual data which can either be single characters or a sequence
of characters which are called strings. Strings are sometimes used for human readable
data such as messages or output, but may also model general data. For example, DNA
is usually encoded using strings consisting of the characters C, G, A, T (corresponding
to the nucleases cytosine, guanine, adenine, and thymine). Numerical characters and
punctuation can also be used in strings in which case they do not represent numbers,
but instead may represent textual versions of numerical data.
Different programming languages implement characters and strings in different ways (or
may even treat them the same). Some languages implement strings by defining arrays
of characters. Other languages may treat strings as dynamic data types. However, all
languages use some form of character encoding to represent strings. Recall that computers
only speak in binary: 0s and 1s. To represent a character like the capital letter “A”, the
binary sequence 0b1000001 is used. In fact, the most common alphanumeric characters
are encoded according to the American Standard Code for Information Interchange
(ASCII) text standard. The basic ASCII text standard assigns characters to the decimal
values 0–127 using 7 bits to encode each character as a number. Table 2.4 contains a
complete listing of standard ASCII character set.
The ASCII table was designed to enforce a lexicographic ordering: letters are in alphabetic
order, uppercase precede lowercase versions, and numbers precede both. This design
allows for an easy and natural comparison among strings, “alpha” would come before
“beta” because they differ in the first letter. The characters have numerical values 97
and 98 respectively; since 97 < 98, the order follows. Likewise, “Alpha” would come
before “alpha” (since 65 < 97), and “alpha” would come before “alphanumeric”: the
sixth character is empty in the first string (usually treated as the null character with
value 0) while it is “n” in the second (value of 110). This is the ordering that we would
expect in a dictionary.
There are several other nice design features built into the ASCII table. For example, to
convert between uppercase and lowercase versions, you only need to “flip” the second
bit (0 for uppercase, 1 for lowercase). There are also several special characters that
27
2. Basics
Binary Dec Character Binary Dec Character Binary Dec Character
0b000 0000 0 \0 Null character 0b010 1011 43 + 0b101 0110 86 V
0b000 0001 1 Start of Header 0b010 1100 44 , 0b101 0111 87 W
0b000 0010 2 Start of Text 0b010 1101 45 - 0b101 1000 88 X
0b000 0011 3 End of Text 0b010 1110 46 . 0b101 1001 89 Y
0b000 0100 4 End of Transmission 0b010 1111 47 / 0b101 1010 90 Z
0b000 0101 5 Enquiry 0b011 0000 48 0 0b101 1011 91 [
0b000 0110 6 Acknowledgment 0b011 0001 49 1 0b101 1100 92 \
0b000 0111 7 \a Bell 0b011 0010 50 2 0b101 1101 93 ]
0b000 1000 8 \b Backspace 0b011 0011 51 3 0b101 1110 94 ^
0b000 1001 9 \t Horizontal Tab 0b011 0100 52 4 0b101 1111 95
0b000 1010 10 \n Line feed 0b011 0101 53 5 0b110 0000 96 ‘
0b000 1011 11 \v Vertical Tab 0b011 0110 54 6 0b110 0001 97 a
0b000 1100 12 \f Form feed 0b011 0111 55 7 0b110 0010 98 b
0b000 1101 13 \r Carriage return 0b011 1000 56 8 0b110 0011 99 c
0b000 1110 14 Shift Out 0b011 1001 57 9 0b110 0100 100 d
0b000 1111 15 Shift In 0b011 1010 58 : 0b110 0101 101 e
0b001 0000 16 Data Link Escape 0b011 1011 59 ; 0b110 0110 102 f
0b001 0001 17 Device Control 1 0b011 1100 60 < 0b110 0111 103 g
0b001 0010 18 Device Control 2 0b011 1101 61 = 0b110 1000 104 h
0b001 0011 19 Device Control 3 0b011 1110 62 > 0b110 1001 105 i
0b001 0100 20 Device Control 4 0b011 1111 63 ? 0b110 1010 106 j
0b001 0101 21 Negative Ack 0b100 0000 64 @ 0b110 1011 107 k
0b001 0110 22 Synchronous idle 0b100 0001 65 A 0b110 1100 108 l
0b001 0111 23 End of Trans. Block 0b100 0010 66 B 0b110 1101 109 m
0b001 1000 24 Cancel 0b100 0011 67 C 0b110 1110 110 n
0b001 1001 25 End of Medium 0b100 0100 68 D 0b110 1111 111 o
0b001 1010 26 Substitute 0b100 0101 69 E 0b111 0000 112 p
0b001 1011 27 Escape 0b100 0110 70 F 0b111 0001 113 q
0b001 1100 28 File Separator 0b100 0111 71 G 0b111 0010 114 r
0b001 1101 29 Group Separator 0b100 1000 72 H 0b111 0011 115 s
0b001 1110 30 Record Separator 0b100 1001 73 I 0b111 0100 116 t
0b001 1111 31 Unit Separator 0b100 1010 74 J 0b111 0101 117 u
0b010 0000 32 (space) 0b100 1011 75 K 0b111 0110 118 v
0b010 0001 33 ! 0b100 1100 76 L 0b111 0111 119 w
0b010 0010 34 " 0b100 1101 77 M 0b111 1000 120 x
0b010 0011 35 # 0b100 1110 78 N 0b111 1001 121 y
0b010 0100 36 $ 0b100 1111 79 O 0b111 1010 122 z
0b010 0101 37 % 0b101 0000 80 P 0b111 1011 123 {
0b010 0110 38 & 0b101 0001 81 Q 0b111 1100 124 |
0b010 0111 39 ’ 0b101 0010 82 R 0b111 1101 125 }
0b010 1000 40 ( 0b101 0011 83 S 0b111 1110 126 ~
0b010 1001 41 ) 0b101 0100 84 T 0b111 1111 127 Delete
0b010 1010 42 * 0b101 0101 85 U
Table 2.4.: ASCII Character Table. The first and second column indicate the binary and
decimal representation respectively. The third column visualizes the resulting
character when possible. Characters 0–31 and 127 are control characters that
are not printable or print whitespace. The encoding is designed to impose a
lexicographic ordering: A–Z are in order, uppercase letters precede lowercase
letters, numbers precede letters and are also in order.
28
2.2. Variables
need to be escaped to be defined. For example, though your keyboard has a tab and an
enter key, if you wanted to code those characters, you would need to specify them in
some way other than using those keys (since typing those keys will affect what you are
typing rather than specifying a character). The standard way to escape characters is to
use a backslash along with another, single character. The three most common are the
(horizontal) tab, \t, the endline character, \n, and the null terminating character, \0.
The tab and endline character are used to specify their whitespace characters respectively.
The null character is used in some languages to denote the end of a string and is not
printable.
ASCII is quite old, originally developed in the early sixties. President Johnson first
mandated that all computers purchased by the federal government support ASCII in 1968.
However, it is quite limited with only 128 possible characters. Since then, additional
extensions have been developed. The Extended ASCII character set adds support for
128 additional characters (numbered 128 through 255) by adding 1 more bit (8 total).
Included in the extension are support for common international characters with diacritics
such as ü, n
~ and £ (which are characters 129, 164, and 156 respectively).
Even 256 possible characters are not enough to represent the wide array of international
characters when you consider languages like Chinese Japanese Korean (CJK). Unicode
was developed to solve this problem by establishing a standard encoding that supports
1,112,064 possible characters, though only a fraction of these are actually currently
assigned.4 Unicode is backward compatible, so it works with plain ASCII characters. In
fact, the most common encoding for Unicode, UTF-8 uses a variable number of bytes to
encode characters. 1-byte encodings correspond to plain ASCII, there are also 2, 3, and
4-byte encodings.
In most programming languages, strings literals are defined by using either single or
double quotes to indicate where the string begins and ends. For example, one may be
able to define the string "Hello World" . The double quotes are not part of the string,
but instead specify where the string begins and ends. Some languages allow you to use
either single or double quotes. PHP for example would allow you to also define the same
string as 'Hello World' . Yet other languages, such as C distinguish the usage of single
and double quotes: single quotes are for single characters such as 'A' or '\n' while
double quotes are used for full strings such as "Hello World" .
In any case, if you want a single or double quote to appear in your string you need to
escape it similar to how the tab and endline characters are escaped. For example, in C
'\'' would refer to the single quote character and "Dwayne \"The Rock\" Johnson"
would allow you to use double quotes within a string. In our pseudocode we’ll use the
stylized double quotes, “Hello World” in any strings that we define. We will examine
4
As of 2012, 110,182 are assigned to characters, 137,468 are reserved for private use (they are valid
characters, but not defined so that organizations can use them for their own purposes), with 2,048
surrogates and 66 non-character control codes. 864,348 are left unassigned meaning that we are
well-prepared for encoding alien languages when they finally get here.
29
2. Basics
string types more fully in Chapter 8.
Boolean Types
A Boolean is another type of variable that is used to hold a truth value, either true or
false, of a logical statement. Some programming languages explicitly support a built-in
Boolean type while others implicitly support them. For languages that have explicit
Boolean types, typically the keywords true and false are used, but logical expressions
such as x ≤ 10 can also be evaluated and assigned to Boolean variables.
Some languages do not have an explicit Boolean type and instead support Booleans
implicitly, sometimes by using numeric types. For example, in C, false is associated with
zero while any non-zero value is associated with true. In either case, Boolean values are
used to make decisions and control the flow of operations in a program (see Chapter 3).
Object & Reference Types
Not everything is a number or string. Often, we wish to model real-world entities such
as people, locations, accounts, or even interactions such as exchanges or transactions.
Most programming languages allow you to create user-defined types by using objects or
structures. Objects and structures allow you to group multiple pieces of data together
into one logical entity; this is known as encapsulation. For example, a Student object may
consist of a first-name, last-name, GPA, year, major, etc. Grouping these separate pieces
of data together allows us to define a more complex type. We explore these concepts in
more depth in Chapter 10.
In contrast to the built-in numeric, character/string, and Boolean types (also called
primitive data types) user-defined types do not necessarily take a fixed amount of memory
to represent. Since they are user-defined, it is up to the programmer to specify how
they get created and how they are represented in memory. A variable that refers to an
object or structure is usually a reference or pointer: a reference to where the object is
stored in memory on a computer. Many programming languages use the keyword null
(or sometimes NULL or a some variation) to indicate an invalid reference. The null
keyword is often used to refer to uninitialized or “missing” data.
Another common user-defined type is an enumerated type which allows a user to define a
list of keywords associated with integers. For example, the cardinal directions, “north”,
“south”, “east”, and “west” could be associated with the integers 0, 1, 2, 3 respectively.
Defining an enumerated type then allows you to use these keywords in your program
directly without having to rely on mysterious numerical values, making a program more
readable and less prone to error.
30
2.2. Variables
2.2.3. Declaring Variables: Dynamic vs. Static Typing
In some languages, variables must be declared before they can be referred to or used.
When you declare a variable, you not only give it an identifier, but also define its type.
For example, you can declare a variable named numberOf Students and define it to be
an integer. For the life of that variable, it will always be an integer type. You can only
give that variable integer values. Attempts to assign, say, a string type to an integer
variable may either result in a syntax error or a runtime error when the program is
executed or lead to unexpected or undefined behavior. A language that requires you to
declare a variable and its type is a statically typed language.
The declaration of a variable is typically achieved by writing a statement that includes
the variable’s type (using a built-in keyword of the language) along with the variable
name. For example, in C-style languages, a line like
int x;
would create an integer variable associated with the identifier x .
In other languages, typically interpreted languages, you do not have to declare a variable
before using it. Such languages are generally referred to as dynamically typed languages.
Instead of declaring a variable to have a particular type, the type of a variable is
determined by the type of value that is assigned to it. If you assign an integer to a
variable it becomes an integer. If you assign a string to it, it becomes a string type.
Moreover, a variable’s type can change during the execution of a program. If you reassign
a value to a variable, it dynamically changes its type to match the type of the value
assigned.
In PHP for example, a line like
$x = 10;
would create an integer variable associated with the identifier $x . In this example, we
did not declare that $x was an integer. Instead, it was inferred by the value that we
assigned to it (10).
At first glance it may seem that dynamically typed languages are better. Certainly
they are more flexible (and allow you to write less so-called “boilerplate” code), but
that flexibility comes at a cost. Dynamically typed variables are generally less efficient.
Moreover, dynamic typing opens the door to a lot of potential type mismatching errors.
For example, you may have a variable that is assumed to always be an integer. In a
dynamically typed language, no such assumption is valid as a reassignment can change
the variable’s type. It is impossible to enforce this assumption by the language itself and
may require a lot of extra code to check a variable’s type and deal with “type safety”
issues. The advantages and disadvantages of each continue to be debated.
31
2. Basics
1 {
2 int a;
3 {
4 //this is a new code block inside the outer block
5 int b;
6 //at this point in the code, both a and b are in-scope
7 }
8 //at this point, only a is in-scope, b is out-of-scope
9 }
Code Sample 2.1.: Example of variable scoping in C
2.2.4. Scoping
The scope of a variable is the section of code in which a variable is valid or “known.”
In a statically typed language, a variable must be declared before it can be used. The
code block in which the variable is declared is therefore its scope. Outside of this code
block, the variable is invalid. Attempts to reference or use a variable that is out-of-scope
typically result in a syntax error. An example using the C programming language is
depicted in Code Sample 2.1.
Scoping in a dynamically typed language is similar, but since you don’t declare a variable,
the scope is usually defined by the block of code where you first use or reference the
variable. In some languages using a variable may cause that variable to become globally
scoped.
A globally scoped variable is valid throughout the entirety of a program. A global variable
can be accessed and referenced on every line of code. Sometimes this is a good thing:
for example, we could define a variable to represent π and then use it anywhere in our
program. We would then be assured that every computation involving π would be using
the same definition of π (rather than one line of coding using the approximation 3.14
while another uses 3.14159).
On the same token, however, global variables make the state and execution of a program
less predictable: if any piece of code can access a global variable, then potentially any
piece of code could change that variable. Imagine some questionable code changing the
value of our global π variable to 3. For this reason, using global variables is generally
considered bad practice.5 Even if no code performs such an egregious operation, the
fact that anything can change the value means that when testing, you must test for
5
Coders often say “globals are evil” and indeed have often demonstrated that they have low moral
standards. Global variables that is. Coders are always above reproach.
32
2.3. Operators
the potential that anything will change the value, greatly increasing the complexity
of software testing. To capture the advantages of a global variable while avoiding the
disadvantages, it is common to only allow global constants; variables whose values cannot
be changed once set.
Another argument against globally scoped variables is that once the identifier has been
used, it cannot be reused or redefined for other purposes (a floating point variable with
the identifier pi means we cannot use the identifier pi for any other purpose) as
it would lead to conflicts. Defining many globally scoped variables (or functions, or
other elements) starts to pollute the namespace by reserving more and more identifiers.
Problems arise when one attempts to use multiple libraries that have both used the same
identifiers for different variables or functions. Resolving the conflict can be difficult or
impossible if you have no control over the offending libraries.
2.3. Operators
Now that we have variables, we need a way to work with variables. That is, given two
variables we may wish to add them together. Or we may wish to take two strings and
combine them to form a new string. In programming languages this is accomplished
through operators which operate on one or more operands. An operator takes the values
of its operands and combines them in some way to produce a new value. If an operator
is applied to variable(s), then the values used in the operation are the values stored in
the variable at the time that the operator is evaluated.
Many common operators are binary in that they operate on two operands such as common
arithmetic operations like addition and multiplication. Some operators are unary in that
they only operate on one variable. The first operator that we look at is a unary operator
and allows us to assign values to variables.
2.3.1. Assignment Operators
The assignment operator is a unary operator that allows you to take a value and assign
it to a variable. The assignment operator usually takes the following form: the value is
placed on the right-hand-side of the operator while the variable to which we are assigning
the value is placed on the left-hand-side of the operator. For our pseudocode, we’ll use a
generic “left-arrow” notation:
a ← 10
which should be read as “place the value 10 into the variable a.” Many C-style pro-
gramming languages commonly use a single equal sign for the assignment operator. The
example above might be written as
33
2. Basics
a = 10;
It is important to realize that when this notation is used, it is not an algebraic declaration
like a = b which is an algebraic assertion that the variables a and b are equal. An
assignment operator is different: it means place the value on the right-hand-side into the
variable on the left-hand-side. For that reason, writing something like
10 = a;
is invalid syntax. The left-hand-side must be a variable.
The right-hand-side, however, may be a literal, another variable, or even a more complex
expression. In the example before,
a ← 10
the value 10 was acting as a numerical literal: a way of expressing a (human-readable)
value that the computer can then interpret as a binary value. In code, we can conveniently
write numbers in base-10; when compiled or interpreted, the numerical literals are
converted into binary data that the computer understands and placed in a memory
location corresponding to the variable. This entire process is automatic and transparent
to the user. Literals can also be strings or other values. For example:
message ← “hello world”
We can also “copy” values from one variable to another. Assuming that we’ve assigned
the value 10 to the variable a, we can then copy it to another variable b:
b←a
This does not mean that a and b are the same variable. The value that is stored in the
variable a at the time that this statement is executed is copied into the variable b. There
are now two different variables with the same value. If we reassign the value in a, the
value in b is unaffected. This is illustrated in Algorithm 2.1
1 a ← 10
2 b←a
//a and b both store the value 10 at this point
3 a ← 20
//now a has the value 20, but b still has the value 10
4 b ← 25
//a still stores a value of 20, b now has a value of 25
Algorithm 2.1: Assignment Operator Demonstration
The right-hand-side can also be a more complex expression, for example the result of
summing two numbers together.
34
2.3. Operators
2.3.2. Numerical Operators
Numerical operators allow you to create complex expressions involving either numerical
literals and/or numerical variables. For most numerical operators, it doesn’t matter if
the operands are integers or floating point numbers. Integers can be added to floating
point numbers without much additional code for example.
The most basic numerical operator is the unary negation operator. It allows you to
negate a numerical literal or variable. For example,
a ← −10
or
a ← −b
The usage of a negation is so common that it is often not perceived to be an operator
but it is.
Addition & Subtraction
You can also add (sum) two numbers using the + (plus) operator and subtract using the
− (minus) operator in a straightforward way. Note that most languages can distinguish
the minus operator and the negation operator by how you use it just like a mathematical
expression. If applied to one operand, it is interpreted as a negation operator. If applied
to two operands, it represents subtraction. Some examples can be found in Algorithm
2.2.
1 a ← 10
2 b ← 20
3 c←a+b
4 d←a−b
//c has the value 30 while d has the value −10
5 c ← a + 10
6 d ← −d
//c now has the value 20 and d now has the value 10
Algorithm 2.2: Addition and Subtraction Demonstration
Multiplication & Division
You can also multiply and divide literals and variables. In mathematical expressions
multiplication is represented as a × b or a · b or simply just ab and division is represented
35
2. Basics
as a÷b or a/b or ab . In our pseudocode, we’ll generally use a·b and ab , but in programming
languages it is difficult to type these symbols. Usually programming languages use *
for multiplication and / for division. Similar examples are provided in Algorithm 2.3.
1 a ← 10
2 b ← 20
3 c←a·b
4 d ← ab
//c has the value 200 while d has the value 0.5
Algorithm 2.3: Multiplication and Division Demonstration
Careful! Some languages specify that the result of an arithmetic operation on variables
of a certain type must match. That is, an integer plus an integer results in an integer. A
floating point number divided by a floating point number results a floating point number.
When we mix types, say an integer and a floating point number, the result is generally a
floating point number. For the most part this is straightforward. The one tricky case is
when we have an integer divided by another integer, 3/2 for example.
Since both operands are integers, the result must be an integer. Normally, 3/2 = 1.5,
but since the result must be an integer, the fractional part gets truncated (cut-off) and
only the integral part is kept for the final result. This can lead to weird results such as
1/3 = 0 and 99/100 = 0. The result is not rounded down or up; instead the fractional
part is completely thrown out. Care must be taken when dividing integer variables in a
statically typed language. Type casting can be used to force variables to change their
type for the purposes of certain operations so that the full answer is preserved. For
example, in C we can write
1 int a = 10;
2 int b = 20;
3 double c;
4 int d;
5 c = (double) a / (double) b;
6 d = a / b;
7 //the value in c is correctly 0.5 but the value in d is 0
36
2.3. Operators
Integer Division
Recall that in arithmetic, when you divide integers a/b, b might not go into a evenly in
which case you get a remainder. For example, 13/5 = 2 with a remainder r = 3. More
generally we have that
a = qb + r
Where a is the dividend, b is the divisor, q is the quotient (the result) and r is the
remainder. We can also perform integer division in most programming languages. In
particular, the integer division operator is the operator that gives us the remainder of
the integer division operation in a/b. In mathematics this is the modulo operator and is
denoted
a mod b
For example,
13 mod 5 = 3
It is possible that the remainder is zero, for example,
10 mod 5 = 0
Many programming languages support this operation using the percent sign. For example,
c = a % b;
2.3.3. String Concatenation
Strings can also be combined to form new strings. In fact, strings can often be combined
with non-string variables to form new strings. You would typically do this in order to
convert a numerical value to a string representation so that it can be output to the user
or to a file for longterm storage. The operation of combining strings is referred to as
string concatenation. Some languages support this through the same plus operator that
is used with addition. For example,
message ← “hello ” + “world!”
which combines the two strings to form one string containing the characters “hello world!”,
storing the value into the message variable. For our pseudocode we’ll adopt the plus
operator for string concatenation.
The string concatenation operator can also sometimes be combined with non-string
types; numerical types for example. This allows you to easily convert numbers to a
human-readable, base-10 format so that they can be printed to the output. For example
suppose that the variable b contains the value 20, then
message ← “the answer is ” + b
37
2. Basics
might result in the string “the answer is 20” being stored in the variable message.
Other languages use different symbols to distinguish concatenation and addition. Still
yet other languages do not directly support an operator for string concatenation which
must instead be done using a function.
2.3.4. Order of Precedence
In mathematics, when you write an expression such as:
a+b·c
you interpret it as “multiply b and c and then add a.” This is because multiplication has
a higher order of precedence than addition. The order of precedence (sometimes referred
to as order of operations) is a set of rules which define the order in which operations
should be evaluated. In this case, multiplication is performed before addition. If, instead,
we had written
(a + b) · c
we would have a different interpretation: “add a and b and then multiply the result by
c.” That is, the inclusion of parentheses changes the order in which we evaluate the
operations. Adding parentheses can have no effect (if we wrote a + (bc) for example), or
it can cause operations with a lower order of precedence to be evaluated first as in the
example above.
Numerical operators are similar when used in most programming languages. The same
order of precedence is used and parentheses can be used to change the order of evaluation.
2.3.5. Common Numerical Errors
When dealing with numeric types it is important to know and understand their limitations.
In mathematics, the following operations might be considered invalid.
• Division by zero: ab where b = 0. This is an undefined operation in mathematics
and also in programming languages. Depending on the language, any number of
things may happen. It may be a fatal error or exception; the program may continue
executing but give “garbage” results from then on; the result may be a special value
such as null, “NaN” (not-a-number) or “INF” (a special representation of infinity).
It is best to avoid such an operation entirely using conditionals statements and
defensive programming (see Chapter 3).
• Other potentially
√ invalid operations involve common mathematical functions. For
example, −1 would be a complex result, i which some languages do support.
38
2.3. Operators
However, many do not. Similarly, the natural logarithm of zero, ln (0) and negative
values, ln (−1) is undefined. In either case you could expect a result like “NaN” or
“INF.”
• Still other operations seem like they should be valid, but because of how numbers
are represented in binary, the results are invalid. Recall that for a 32-bit signed,
two’s complement number, the maximum representable value is 2,147,483,647.
Suppose this maximum value is stored in a variable, b. Now suppose we attempt
to add one more,
c←b+1
Mathematically we’d expect the result to be 2,147,483,648, but that is more than
the maximum representable integer. What happens is something called arithmetic
overflow. The actual number stored in binary in memory for 2,147,483,647 is
0b0 |11 .{z
. . 11}
31 1s
When we add 1 to this, it is carried over all the way to the 32nd bit, giving the
result
0b1 |00 .{z
. . 00}
31 0s
in binary. However, the 32nd bit is the sign bit, so this is a negative number.
In particular, if this is a two’s complement integer, it has the decimal value
−2, 147, 483, 648 which is obviously wrong. Another example would be if we have a
“large number, say 2 billion and attempt to double it (multiply by 2). We would
expect 4 billion as a result, but again overflow occurs and the result (using 32-bit
signed two’s complement integers) is −294, 967, 296.
• A similar phenomenon can happen with floating point numbers. If an operation
(say multiplying two “small” numbers together) results in a number that is smaller
than the smallest floating point number that can be represented, the result is said
to have resulted in underflow. The result can essentially be zero, or an error can
be raised to indicate that underflow has occurred. The consequences of underflow
can be very complex.
• Floating-point operations can also result in a loss of precision even if no overflow
or underflow occurs. For example, when adding a very large number a and a very
small number b, the result might be no different from the value of a. This is because
(for example) double precision floating point numbers only have about 16 significant
digits of precision with the least significant digits being cutoff in order to preserve
the magnitude.
√
As another example, suppose we compute 2 = 1.41421356 . . .. If we squared the
result, mathematically we would expect to get 2. However, since we only have a
certain number of digits of precision, squaring the result in a computer may result
in a value slightly different from 2 (either 1.9999998 or 2.0000001).
39
2. Basics
2.3.6. Other Operators
Many programming languages support other “convenience” operators that allow you to
perform common operations using less code. These operators are generally syntactic
sugar: the don’t add any functionality. The same operation could be achieved using
other operators. However, they do add simpler or more terse syntax for doing so.
Increment Operators
Adding or subtracting one to a variable is a very common operation. So common, that
most programming languages define increment operators such as i++ and i-- which
add one and subtract one from the variables applied. The same effect could be achieved
by writing
i ← (i + 1) and i ← (i − 1)
but the increment operators provide a shorthand way of expressing the operation.
The operators i++ and i-- are postfix operators: the operator is written after (post)
the operand. Some languages define similar prefix increment operators, ++i and --i .
The effect is similar: each adds or subtracts one from the variable i . However, the
difference is when the operator is used in a larger expression. A postfix operator retains
the original value for the expression, a prefix operator takes on the new, incremented
value in the expression.
To illustrate, suppose the variable i has the value 10. In the following line of code, i is
incremented and used in an expression that adds 5 and stores the result in a variable x :
x = 5 + (i++);
The value of x after this code is 15 while the value of i is now 11. This is because
the postfix operator increments i , but i++ retains the value 10 in the expression. In
contrast, with the line
x = 5 + (++i);
the variable i again now has the value 11, but the value of x is 16 since ++i takes
on the new, incremented value of 11. Appropriately using each can lead to some very
concise code, but it is important to remember the difference.
Compound Assignment Operators
If we want to increment or decrement a variable by an amount other than 1 we can do
so using compound assignment operators that combine an arithmetic operator and an
assignment operator into one. For example, a += 10 would add 10 to the variable a .
40
2.4. Basic Input/Output
1 int a = 10;
2 a += 5; //adds 5 to a
3 a -= 3; //subtracts 3 from a
4 a *= 2; //multiplies a by 2
5 a /= 4; //divides a by 4
6
7 //you can also use compound assignment operators with variables:
8 int b = 5;
9 a += b; //adds the value stored in b to a
10 a -= b; //subtracts the value stored in b from a
11 a *= b; //multiplies a by b
12 a /= b; //divides a by b
Code Sample 2.2.: Compound Assignment Operators in C
The same could be achieved by coding a = a + 10 , but the former is a bit shorter as
we don’t have to repeat the variable.
You can do the same with subtraction, multiplication, and division. More examples
using the C programming language can be found in Code Snippet 2.2. It is important to
note that these operators are not, strictly speaking, equivalent. That is, a += 10 is not
equivalent to a = a + 10 . They have the same effect, but the first involves only one
operator while the second involves two operators.
2.4. Basic Input/Output
Not all variables can be coded using literals. Sometimes a program needs to read in
values as input from a user who can give different values on different runs of a program.
Likewise, a computer program often needs to produce output to the user to be of any
use.
The most basic types of programs are interactive programs that interact with a human
user. Generally, the program may interactive the user to enter some input value(s) or
make some choices. It may then compute some values and respond to the user with some
output. In the following sections we’ll overview the various types of input and output
(I/O for short) that are available.
41
2. Basics
2.4.1. Standard Input & Output
The standard input (stdin for short), standard output (stdout) and standard error (stderr)
are three standard communication streams that are defined by most computer systems.
Though perhaps an over simplification, the keyboard usually serves as a standard input
device while the monitor (or the system console) serves as a standard output device. The
standard error is usually displayed in the same display but may be displayed differently
on some systems (it is typeset in red in some consoles that support color to indicate that
the output is communicating an error).
As a program is executing, it may prompt a user to enter input. A program may wait
(called blocking) until a user has typed whatever input they want to provide. The user
typically hits the enter key to indicate their input is done and the program resumes,
reading the input provided via the standard input. The program may also produce
output which is displayed to the user.
The standard input and output are generally universal: almost any language, and
operating system will support them and they are the most basic types of input/output.
However, the type of input and output is somewhat limited (usually limited to text-based
I/O) and doesn’t provide much in the way of input validation. As an example, suppose
that a program prompts a user to enter a number. Since the input device (keyboard) is
does not really restrict the user, a more obstinate user may enter a non-numeric value,
say “hello”. The program may crash or provide garbage output with such input.
2.4.2. Graphical User Interfaces
A much more user-oriented way of reading input and displaying output is to use a
Graphical User Interface (GUI). GUIs can be implemented as traditional “thick-client”
applications (programs that are installed locally on your machine) or as “thin-client”
applications such as a web application. They typically support general “widgets” such as
input boxes, buttons, sliders, etc. that allow a user to interact with the program in a
more visual way. They also allow the programmer to do better input validation. Widgets
could be design so that only good input is allowed by creating modal restrictions: the
user is only allowed to select one of several “radio” buttons for example. GUIs also
support visual feedback cues to the user: popups, color coding, and other elements can
be used to give feedback on errors and indicate invalid selections.
Graphical user interfaces can also make use of more modern input devices: mice, touch
screens with gestures, even gaming devices such as the Kinect allow users to use a full
body motion as an input mechanism. We discuss GUIs in more detail in Chapter 13. To
begin, we’ll focus more on plain textual input and output.
42
2.4. Basic Input/Output
Language Standard Output String Output
C printf() sprintf()
Java System.out.printf() String.format()
PHP printf() sprintf()
Table 2.5.: printf() -style Methods in Several Languages. Languages support format-
ting directly to the Standard Output as well as to strings that can be further
used or manipulated. Most languages also support printf() -style formatting
to other output mechanisms (streams, files, etc.).
2.4.3. Output Using printf() -style Formatting
Recall that many languages allow you to concatenate a string and a non-string type in
order to produce a string that can then be output to the standard output. However,
concatenation doesn’t provide much in the way of customizability when it comes to
formatting output. We may want to format a floating point number so that it only prints
two decimal places (as with US currency). We may want to align a column of data so
that number places match up. Or we may want to justify text either left or right.
Such data formatting can be achieved through the use of a printf() -style formatting
function. The ideas date back to the mid-60s, but the modern printf() comes from
the C programming language. Numerous programming languages support this style
of formatted output ( printf() stands for print f ormatted). Most support either
printing the resulting formatted output to the standard output as well as to strings and
other output mechanisms (files, streams, etc.). Table 2.5 contains a small sampling of
printf() -style functions supported in several languages. We’ll illustrate this usage
using the C programming language for our examples, but the concepts are generally
universal across most languages.
The function works by providing it a number of arguments. The first argument is always
a string that specifies the formatting of the result using several placeholders (flags that
begin with a percent sign) which will be replaced with values stored in variables but
in a formatted manner. Subsequent arguments to the function are the list of variables
to be printed; each argument is delimited by a comma. Figure 2.3 gives an example
of of a printf() statement with two placeholders. The placeholders are ultimately
replaced with the values stored in the provided variables a, b. If a, b held the values 10
and 2.718281, the code would end up printing
The value of a = 10, the value of b is 2.718281
Though there are dozens of placeholders that are supported, we will focus only on a few:
• %d formats an integer variable or literal
43
2. Basics
Format String
printf("The value of a = %d, the value of b is %f\n", a, b);
Print List
Placeholders
Figure 2.3.: Elements of a printf() statement in C
• %f formats a floating point variable or literal
• %c formats a single character variable or literal
• %s formats a string variable or literal
Misuse of placeholders may result in garbage output. For example, using an integer
placeholder, %d , but providing a string argument; since strings cannot be (directly)
converted to integers, the output will not be correct.
In addition to these placeholders, you can also add modifiers. A number n between
the percent sign and character ( %nd , %nf , %ns )) specifies that the result should be
formatted with a minimum of n columns. If the output takes less than n columns,
printf() will pad out the result with spaces so that there are n columns. If the output
takes n or more columns, then the modifier will have no effect (it specifies a minimum
not a maximum).
Floating-point numbers have a second modifier that allows you to specify the number of
digits of precision to be formatted. In particular, you can use the placeholder %n.mf in
which n has the same meaning, but m specifies the number of decimals to be displayed.
By default, 6 decimals of precision are displayed. If m is greater than the precision of the
number, zeros are usually used for subsequent digits; if m is smaller than the precision of
the number, rounding may occur. Note that the n modifier includes the decimal point
as a column. Both modifiers are optional.
Finally, each of these modifiers can be made negative (example: %-20d ) to left-justify
the result. By default, justification is to the right. Several examples are illustrated in
Code Sample 2.3 with the results in Code Sample 2.4.
2.4.4. Command Line Input
Not all programs are interactive. In fact, the vast majority of software is developed to
interact with other software and does not expect that a user is sitting at the console
44
2.4. Basic Input/Output
1 int a = 4567;
2 double b = 3.14159265359;
3
4 printf("a=%d\n", a);
5 printf("a=%2d\n", a);
6 printf("a=%4d\n", a);
7 printf("a=%8d\n", a);
8
9 //by default, prints 6 decimals of precision
10 printf("b=%f\n", b);
11 //the .m modifier is optional:
12 printf("b=%10f\n", b);
13 //the n modifier is also optional:
14 printf("b=%.2f\n", b);
15 //note that this rounds!
16 printf("b=%10.3f\n", b);
17 //zeros are added so that 15 decimals are displayed
18 printf("b=%20.15f\n", b);
Code Sample 2.3.: printf() examples in C
a=4567
a=4567
a=4567
a= 4567
b=3.141593
b= 3.141593
b=3.14
b= 3.142
b= 3.141592653590000
Code Sample 2.4.: Result of computation in Code Sample 2.3. Spaces are highlighted
with a for clarity.
45
2. Basics
constantly providing it with input. Most languages and operating systems support
non-interactive input from the Command Line Interface (CLI). This is input that is
provided at the command line when the program is executed. Input provided from the
command line are usually referred to as command line arguments. For example, if we
invoke a program named myProgram from the command line prompt using something
like the following:
~>./myProgram a 10 3.14
Then we would have provided 4 command line arguments. The first argument is usually
the program’s name, all subsequent arguments are separated by whitespace. Command
line arguments are provided to the program as strings and it is the program’s responsibility
to convert them if needed and to validate them to ensure that the correct expected
number and type of arguments were provided.
Within a program, command line arguments are usually referred to as an argument vector
(sometimes in a variable named argv ) and argument count (sometimes in a variable
named argc ). We explore how each language supports this in subsequent chapters.
2.5. Debugging
Making mistakes in programming is inevitable. Even the most expert of software
developers make mistakes.6 Errors in computer programs are usually referred to as
bugs. The term was popularized by Grace Hopper in 1947 while working on a Mark
II Computer at a US Navy research lab. Literally, a moth stuck in the computer was
impeding its operation. Removing the moth or “debugging” the computer fixed it. In
this section we will identify general types of errors and outline ways to address them.
2.5.1. Types of Errors
When programming, there are several types of errors that can occur. Some can be easily
detected (or even easily fixed) by compilers and other modern code analysis tools such
as IDEs.
6
A severe security bug in the popular unix bash shell utility went undiscovered for 25 years before it
was finally fixed in September 2014, missed by thousands of experts and some of the best coders in
the world.
46
2.5. Debugging
Syntax Errors
Syntax errors are errors in the usage of a programming language itself. A syntax error
can be a failure to adhere to the rules of the language such as misspelling a keyword or
forgetting proper “punctuation” (such as missing an ending semicolon). When you have a
syntax error, you’re essentially not “speaking the same language.” You wouldn’t be very
comprehensible if you started injecting non-sense words or words from different language
when speaking to someone in English. Similarly, a computer can’t understand what
you’re trying to say (or what directions you’re trying to give it) if you’re not speaking
the same language.
Typically syntax errors prevent you from even compiling a program, though syntax
errors can be a problem at runtime with interpreted languages. When a syntax error is
encountered, a compiler will fail to complete the compilation process and will generally
quit. Ideally, the compiler will give reasons for why it was unable to compile and will
hopefully identify the line number where the syntax error was encountered with a hint on
what was wrong. Unfortunately, many times a compiler’s error message isn’t too helpful
or may indicate a problem on one line where the root cause of the problem is earlier
in the program. One cannot expect too much from a compiler after all. If a compiler
were able to correctly interpret and fix our errors for us, we’d have “natural language”
programming where we could order the computer to execute our commands in plain
English. If we had this science fiction-level of computer interaction we wouldn’t need
programming languages at all.
Fixing syntax errors involves reading and interpreting the compiler error messages,
reexamining the program and fixing any and all issues to conform to the syntax of
the programming language. Fixing one syntax error may enable the compiler to find
additional syntax errors that it had not found before. Only once all syntax errors have
been resolved can a program actually compile. For interpreted languages, the program
may be able to run up to where it encounters a syntax error and then exits with a fatal
error. It may take several test runs to resolve such errors.
Runtime Errors
Once a program is free of syntax errors it can be compiled and be run. However, that
doesn’t mean that the program is completely free of bugs, just that it is free of the types
of bugs (syntax errors) that the compiler is able to detect. A compiler is not able to
predict every action or possible event that could occur when a program is actually run.
A runtime error is an error that occurs while a program is being executed. For example,
a program could attempt to access a file that does not exist, or attempt to connect to a
remote database, but the computer has lost its network connection, or a user could enter
bad data that results in an invalid arithmetic operation, etc.
47
2. Basics
A compiler cannot be expected to detect such errors because, by definition, the conditions
under which runtime errors occur occur at runtime, not at compile time. One run of
a program could execute successfully, while another subsequent run could fail because
the system conditions have changed. That doesn’t mean that we should not attempt to
mitigate the consequences of runtime errors.
As a programmer it is important to think about the potential problems and runtime
errors that could occur and make contingency plans accordingly. We can make reasonable
assumptions that certain kinds of errors may occur in the execution of our program and
add code to handle those errors if they occur. This is known as error handling (which
we discuss in detail in Chapter 6). For example, we could add code that checks if a user
enters bad input and then re-prompt them to enter good input. If a file is missing, we
could add code to create it as needed. By checking for these errors and preventing illegal,
potentially fatal operations, we practice defensive programming.
Logic Errors
Other errors may be a result of bad code or bad design. Computers do exactly as they
are told to do. Logic errors can occur if we tell the computer to do something that we
didn’t intend for them to do. For example, if we tell the computer to execute command
A under condition X, but we meant to have the computer execute command B under
condition Y , we have caused a logical error. The computer will perform the first set of
instructions, not the second as we intended. The program may be free of syntax errors
and may execute without any problems, but we certainly don’t get the results that we
expected.
Logic errors are generally only detected and addressed by rigorous software testing. When
developing software, we can also design a collection of test cases: a set of inputs along
with correct outputs that we would expect the program of code to produce. We can then
test the program with these inputs to see if they produce the same output as in the test
cases. If they don’t, then we’ve uncovered a logical error that needs to be addressed.
Rigorous testing can be just as complex (or even more complex) than writing the program
itself. Testing alone cannot guarantee that a program is free of bugs (in general, the
number of possible inputs is infinite; it is impossible to test all possibilities). However,
the more test cases that we design and pass the higher the confidence we have that the
program is correct.
Testing can also be very tedious. Modern software engineering techniques can help
streamline the process. Many testing frameworks have been developed and built that
attempt to automate the testing process. Test cases can be randomly generated and
test suites can be repeatedly run and verified throughout the development process.
Frameworks can perform regression testing to see if fixing one bug caused or uncovered
another, etc.
48
2.5. Debugging
2.5.2. Strategies
A common beginner’s way of debugging a program is to insert temporary print statements
throughout their program to see what values variables have at certain points in an attempt
to isolate where an error is occurring. This is an okay strategy for extremely simple
programs, but its the “poor man’s” way of debugging. As soon as you start writing
more complex programs you quickly realize that this strategy is slow, inefficient, and
can actually hide the real problems. The standard output is not guaranteed to work as
expected if an error has occurred, so print statements may actually mislead you into
thinking the problem occurs at one point in the program when it actually occurs in a
different part.
Instead, it is much better to use a proper debugging tool in order to isolate the problem.
A debugger is a program, that allows you to “simulate” an execution of your program.
You can set break points in your program on certain lines and the debugger will execute
your program up to those points. It then pauses and allows you to look at the program’s
state: you can examine the contents of memory, look at the values stored in certain
variables, etc. Debuggers will also allow you to resume the execution of your program
to the next break point or allow you to “step” through the execution of your program
line by line. This allows you to examine the execution of a program at human speed in
order to diagnose the exact point in execution where the problem occurs. IDEs allow
you to do this visually with a graphical user interface and easy visualization of variables.
However, there are command line debuggers such as GDB (GNU’s Not Unix! (GNU)
Debugger) that you interact with using text commands.
In general, debugging strategies attempt to isolate a problem to the smallest possible code
segment. Thus, it is best practice to design your code using good procedural abstraction
and place your code into functions and methods (see Chapter 5). It is also good practice
to create test cases and test suites as you develop these small pieces of code.
It can also help to diagnose a problem by looking at the nature of the failure. If some
test cases pass and others fail you can get a hint as to what’s wrong by examining the
key differences between the test cases. If one value passes and another fails, you can
trace that value as it propagates through the execution of your program to see how it
affects other values.
In the end, good debugging skills, just like good coding skills, come from experience. A
seasoned expert may be able to look at an error message and immediately diagnose the
problem. Or, a bug can escape the detection of hundreds of the best developers and
software tools and end up costing millions of dollars and thousands of man-hours.
49
2. Basics
2.6. Examples
Let’s apply these concepts by developing several prompt-and-compute style programs.
That is, the programs will prompt the user for input, perform some calculations, and
then output a result.
To write these programs, we’ll use pseudocode, an informal, abstract description of a
program/algorithm. Pseudocode does not use any language-specific syntax. Instead,
it describes processes at a high-level, making use of plain English and mathematical
notation. This allows us to focus on the actual process/program rather than worrying
about the particular syntax of a specific language. Good pseudocode is easily translated
into any programming language.
2.6.1. Temperature Conversion
Temperature can be measured in several different scales. The most common for everyday
use is Celsius and Fahrenheit. Let’s write a program to convert from Fahrenheit to
Celsius using the following formula:
5
C= · (F − 32)
9
The basic outline of the program will be three simple steps:
1. Read in a Fahrenheit value from the user
2. Compute a Celsius value using the formula above
3. Output the result to the user
This is actually pretty good pseudocode already, but let’s be a little more specific using
some of the operators and notation we’ve established above. The full program can be
found in Algorithm 2.4.
1 prompt the user to enter a temperature in Fahrenheit
2 F ← read input from user
3 C ← 59 · (F − 32)
4 Output C to the user
Algorithm 2.4: Temperature Conversion Program
50
2.7. Exercises
2.6.2. Quadratic Roots
A common math exercise is to find the roots of a quadratic equation with coefficients,
a, b, c,
ax2 + bx + c = 0
using the quadratic formula, √
−b ± b2 − 4ac
x=
2a
Following the same basic outline, we’ll read in the coefficients from the user, compute
each of the roots, and output the results to the user. We need two computations, one for
each of the roots which we label r1 , r2 . The full procedure is presented in Algorithm 2.5.
1 prompt the user to enter a
2 a ← read input from user
3 prompt the user to enter b
4 b ← read input from user
5 prompt the user to enter c
6 c ← read input from user
√
−b+ b2 −4ac
7 r1 ← 2a
√
−b− b2 −4ac
8 r2 ← 2a
9 Output “the roots of ax2 + bx + c are r1 , r2 ”
Algorithm 2.5: Quadratic Roots Program
2.7. Exercises
Exercise 2.1. Write a program that calculates mileage deduction for income tax using
the standard rate of $0.575 per mile. Your program will read in a beginning and ending
odometer reading and calculate the difference and total deduction. Take care that your
output is in whole cents. An example run of the program may look like the following.
INCOME TAX MILEAGE CALCULATOR
Enter beginning odometer reading--> 13505.2
Enter ending odometer reading--> 13810.6
You traveled 305.4 miles. At $.575 per mile,
your reimbursement is $175.61
51
2. Basics
Exercise 2.2. Write a program to compute the total “cost” C of a loan. That is, the
total amount of interest paid over the life of a loan. To compute this value, use the
following formula.
p · i · (1 + i)12n
C= ∗ 12n − p
(1 + i)12n − 1
where
• p is the starting principle amount
r
• i= 12
where r is the APR on the interval [0, 1]
• n is the number of years the loan is to be paid back
Exercise 2.3. Write a program to compute the annualized appreciation of an asset (say
a house). The program should read in a purchase price p, a sale price s and compute
their difference d = s − p (it should support a loss or gain). Then, it should compute an
appreciation rate: r = dp along with an (average) annualized appreciation rate (that is,
what was the appreciation rate in each year that the asset was held that compounded ):
1
(1 + r) y − 1
Where y is the number of years (possibly fractional) the asset was held (and r is on the
scale [0, 1]).
Exercise 2.4. The annual percentage yield (APY) is a much more accurate measure of
the true cost of a loan or savings account that compounds interest on a monthly or daily
basis. For a large enough number of compounding periods, it can be calculated as:
AP Y = ei − 1
where i is the nominal interest rate (6% = 0.06). Write a program that prompts the user
for the nominal interest rate and outputs the APY.
Exercise 2.5. Write a program that calculates the speed of sound (v, feet-per-second)
in the air of a given temperature T (in Fahrenheit). Use the formula,
r
5T + 297
v = 1086
247
Be sure your program does not lose the fractional part of the quotient in the formula
shown and format the output to three decimal places.
Exercise 2.6. Write a program to convert from radians to degrees using the formula
180 · rad
deg =
π
However, radians are on the scale [0, 2π). After reading input from the user be sure to
do some error checking and give an error message if their input is invalid.
52
2.7. Exercises
Exercise 2.7. Write a program to compute the Euclidean Distance between two points,
(x1 , y2 ) and (x2 , y2 ) using the formulate:
p
(x1 − x2 )2 + (y1 − y2 )2
Exercise 2.8. Write a program that will compute the value of sin(x) using the first 4
terms of the Taylor series:
x3 x5 x7
sin(x) ≈ x − + −
3! 5! 7!
In addition, your program will compute the absolute difference between this calculation
and a standard implementation of the sine function supported in your language. Your
program should prompt the user for an input value x and display the appropriate output.
Your output should looks something like the following.
Sine Approximation
===================
Enter x: 1.15
Sine approximation: 0.912754
Sine value: 0.912764
Difference: 0.000010
Exercise 2.9. Write a program to compute the roots of a quadratic equation:
ax2 + bx + c = 0
using the well-known quadratic formula:
√
−b ± b2 − 4ac
2a
Your program will prompt the user for the values, a, b, c and output each real root.
However, for “invalid” input (a = 0 or values that would result in complex roots), the
program will instead output a message that informs the user why that the inputs are
invalid (with a specific reason).
Exercise 2.10. One of Ohm’s laws can be used to calculate the amount of power in
Watts (the rate of energy conversion; 1 joule per second) in terms of Amps (a measure of
current, 1 amp = 6.241 × 1018 electrons per second) and Ohms (a measure of electrical
resistance). Specifically:
W = A2 · O
Develop a simple program to read in two of the terms from the user and output the third.
53
2. Basics
Exercise 2.11. Ohm’s Law models the current through a conductor as follows:
V
I=
R
where V is the voltage (in volts), R is the resistance (in Ohms) and I is the current (in
amps). Write a program that, given two of these values computes the third using Ohm’s
Law.
The program should work as follows: it prompts the user for units of the first value:
the user should be prompted to enter V, R, or I and should then be prompted for the
value. It should then prompt for the second unit (same options) and then the value. The
program will then output the third value depending on the input. An example run of
the program:
Current Calculator
==============
Enter the first unit type (V, R, I): V
Enter the voltage: 25.75
Enter the second unit type (V, R, I): I
Enter the current: 72
The corresponding resistance is 0.358 Ohms
Exercise 2.12. Consider the following linear system of equations in two unknowns:
ax + by = c
dx + ey = f
Write a program that prompts the user for the coefficients in such a system (prompt for
a, b, c, d, e, f ). Then output a solution to the system (the values for x, y). Take care to
handle situations in which the system is inconsistent.
Exercise 2.13. The surface area of a sphere of radius r is
4πr2
and the volume of a sphere with radius r is
4 3
πr
3
Write a program that prompts the user for a radius r and outputs the surface area
and volume of the corresponding sphere. If the radius entered is invalid, print an error
message and exit. Your output should look something like the following.
54
2.7. Exercises
Sphere Statistics
=================
Enter radius r: 2.5
area: 78.539816
volume: 65.449847
Exercise 2.14. Write a program that prompts for the latitude and longitude of two
locations (an origin and a destination) on the globe. These numbers are in the range
[−180, 180] (negative values correspond to the western and southern hemispheres). Your
program should then compute the air distance between the two points using the Spherical
Law of Cosines. In particular, the distance d is
d = arccos (sin(ϕ1 ) sin(ϕ2 ) + cos(ϕ1 ) cos(ϕ2 ) cos(∆)) · R
• ϕ1 is the latitude of location A, ϕ2 is the latitude of location B
• ∆ is the difference between location B’s longitude and location A’s longitude
• R is the (average) radius of the earth, 6,371 kilometers
Note: the formula above assumes that latitude and longitude are measured in radians r,
−π ≤ r ≤ π. See Exercise 2.6 for how to convert between them. Your program output
should look something like the following.
City Distance
========================
Enter latitude of origin: 41.9483
Enter longitude of origin: -87.6556
Enter latitude of destination: 40.8206
Enter longitude of destination: -96.7056
Air distance is 764.990931
Exercise 2.15. Write a program that prompts the user to enter in a number of days.
Your program should then compute the number of years, weeks, and days that number
represents. For this exercise, ignore leap years (thus all years are 365 days). Your output
should look something like the following.
Day Converter
=============
55
2. Basics
Enter number of days: 1000
That is
2 years
38 weeks
4 days
Exercise 2.16. The derivative of a function f (x) can be estimated using the difference
function:
f (x + ∆x) − f (x)
f 0 (x) ≈
∆x
That is, this gives us an estimate of the slope of the tangent line at the point x. Write a
program that prompts the user for an x value and a ∆x value and outputs the value of
the difference function for all three of the following functions:
f (x) = x2
f (x) = sin(x)
f (x) = ln(x)
Your output should looks something like the following.
Derivative Approximation
===================
Enter x: 2
Enter delta-x: 0.1
(x^2)' ~= 4.100000
sin'(x) ~= -0.460881
ln'x(x) ~= 0.487902
In addition, your program should check for invalid inputs: ∆x cannot be zero, and ln(x)
is undefined for x ≤ 0. If given invalid inputs, appropriate error message(s) should be
output instead.
Exercise 2.17. Write a program that prompts the user to enter two points in the plane,
(x1 , y1 ) and (x2 , y2 ) which define a line segment `. Your program should then compute and
output an equation for the perpendicular line intersecting the midpoint of `. You should
take care that invalid inputs (horizontal or vertical lines) are handled appropriately. An
example run of your program would look something like the following.
56
2.7. Exercises
Perpendicular Line
====================
Enter x1: 2.5
Enter y1: 10
Enter x2: 3.5
Enter y2: 11
Original Line:
y = 1.0000 x + 7.5000
Perpendicular Line:
y = -1.0000 x + 13.5000
Exercise 2.18. Write a program that computes the total for a bill. The program should
prompt the user for a sub-total. It should then prompt whether or not the customer is
entitled to an employee discount (of 15%) by having them enter 1 for yes, 2 for no. It
should then compute the new sub-total and apply a 7.35% sales tax, and print the receipt
details along with the grand total. Take care that you properly round each operation.
An example run of the program should look something like the following.
Please enter a sub-total: 100
Apply employee discount (1=yes, 2=no)? 1
Receipt
========================
Sub-Total $ 100.00
Discount $ 15.00
Taxes $ 6.25
Total $ 91.25
Exercise 2.19. The ROI (Return On Investment) is computed by the following formula:
Gain from Investment − Cost of Investment
ROI =
Cost of Investment
Write a program that prompts the user to enter the cost and gain (how much it was sold
for) from an investment and computes and outputs the ROI. For example, if the user
enters $100,000 and $120,000 respectively, the output look similar to the following.
57
2. Basics
Cost of Investment: $100000.00
Gain of Investment: $120000.00
Return on Investment: 20.00%
Exercise 2.20. Write a program to compute the real cost of driving. Gas mileage (in
the US) is usually measured in miles per gallon but the real cost should be measured in
how much it costs to drive a mile, that is, dollars per mile. Write a program to assist a
user in figuring out the real cost of driving. Prompt the user for the following inputs.
• Beginning odometer reading
• Ending odometer reading
• Number of gallons it took to fill the tank
• Cost of gas in dollars per gallon
For example, if the user enters 50,125, 50,430, 10 (gallons), and $3.25 (per gallon), then
your output should be something like the following.
Miles driven: 305
Miles per gallon: 30.50
Cost per mile: $0.11
Exercise 2.21. A bearing can be measured in degrees on the scale of [0, 360) with 0◦
being due north, 90◦ due east, etc. The (initial) directional bearing from location A to
location B can be computed using the following formula.
θ = atan2 sin(∆) · cos(ϕ2 ), cos(ϕ1 ) · sin(ϕ2 ) − sin(ϕ1 ) · cos(ϕ2 ) cos(∆)
Where
• ϕ1 is the latitude of location A
• ϕ2 is the latitude of location B
• ∆ is the difference between location B’s longitude and location A’s longitude
• atan2 is the two-argument arctangent function
Note: the formula above assumes that latitude and longitude are measured in radians r,
−π < r < π. To convert from degrees d (−180 < d < 180) to radians r, you can use the
58
2.7. Exercises
simple formula:
d
r= π
180
Write a program to prompt a user for a latitude/longitude of two locations (an origin and
a destination) and computes the directional bearing (in degrees) from the origin to the
destination. For example, if the user enters: 40.8206, −96.7056 (40.8206◦ N, 96.7056◦ W)
and 41.9483, −87.6556 (41.9483◦ N, 87.6556◦ W), your program should output something
like the following.
From (40.8206, -96.7056) to (41.9483, -87.6556):
bearing 77.594671 degrees
Exercise 2.22. General relativity tells us that time is relative to your velocity. As you
approach the speed of light (c = 299, 792 km/s), time slows down relative to objects
traveling at a slower velocity. This time dilation is quantified by the Lorentz equation
t
t0 = q
v2
1− c2
Where t is the time duration on the traveling space ship and t0 is the time duration on
the (say) Earth.
For example, if we were traveling at 50% the speed of light relative to Earth, one hour in
our space ship (t = 1) would correspond to
1
t0 = p = 1.1547
1 − (.5)2
hours on Earth (about 1 hour, 9.28 minutes).
Write a program that prompts the user for a velocity which represents the percentage
p of the speed of light (that is, p = vc ) and a time duration t in hours and outputs the
relative time duration on Earth.
For example, if the user enters 0.5 and 1 respectively as in our example, it should output
something like the following:
Traveling at 1 hour(s) in your space ship at
50.00% the speed of light, your friends on
Earth would experience:
1 hour(s)
9.28 minute(s)
59
2. Basics
Your output should be able to handle years, weeks, days, hours, and minutes. So if the
user inputs something like 0.9999 and 168, your output should look something like:
Traveling at 168.00 hour(s) in your space ship at
99.99% the speed of light, your friends on
Earth would experience:
1 year(s)
18 week(s)
3 day(s)
17 hour(s)
41.46 minute(s)
Exercise 2.23. Radioactive isotopes decay into other isotopes at a rate that is measured
by a half-life, H. For example, Strontium-90 has a half-life of 28.79 years. If you started
with 10 kilograms of Strontium-90, 28.79 years later you would have only 5 kilograms
(with the remaining 5 kilograms being Yttrium-90 and Zirconium-90, Strontium-90’s
decay products).
Given a mass m of an isotope with half-life H we can determine how much of the isotope
remains after y years using the formula,
(y/H)
1
r =m·
2
For example, if we have m = 10 kilograms of Strontium-90 with H = 28.79, after y = 2
years we would have
(2/28.79)
1
r = 10 · = 9.5298
2
kilograms of Strontium-90 left.
Write a program that prompts the user for an amount m (mass, in kilograms) of an
isotope and its half-life H as well as a number of years y and outputs the amount of
the isotope remaining after y years. For the example above your output should look
something like the following.
Starting with 10.00kg of an isotope with half-life
28.79 years, after 2.00 years you would have
9.5298 kilograms left.
60
2.7. Exercises
Exercise 2.24. In sports, the magic number is a number that indicates the combination
of the number of games that a leader in a division must win and/or the 2nd place team
must lose for the leader to clinch the division. The magic number can be computed using
the following formula:
G + 1 − WA − LB
where G is the number of games played in the season, WA is the number of wins the
leader currently has and LB is the number of losses the 2nd place team currently has.
Write a program that prompts the user to enter:
• G, the total number of games in the season
• WA the number of wins of the leading team
• LA the number of losses of the leading team
• WB the number of wins of the second place team
• LB the number of losses of the second place
Your program will then output the current win percentages of both teams, the magic
number of the leading team as well as the percentage of the remaining games that must
go in team A’s favor to satisfy the magic number (for this, we will assume A and B do
not play each other).
For example, if a user enters the values 162, 96, 58, 93, 62, the output should look
something like the following.
Team Wins Loss Perc Magic Number
A 96 58 62.34% 5
B 93 62 60.00%
With 15 total games remaining, 33.33% must go in Team A's favor
Exercise 2.25. The Doppler Effect is a change in the observed spectral frequency of
light when objects in space are moving toward or away from us. If the spectral frequency
of the object is known, then the relative velocity can be estimated based on either the
blue-shift (for objects traveling toward the observer) or the red-shift (for objects traveling
away from the observer) of the observed frequency.
The blue-shift equation to determine velocity is given by
λ
vb = c −1
λb
61
2. Basics
The red-shift equation to determine velocity is given by
λ
va = c 1 −
λr
where
• c is the speed of light (299,792.458 km/s)
• λ is the actual spectral line of the object (ex: hydrogen is 434nm)
• λr is the observed (red-shifted) spectral line and λb is the observed (blue-shifted)
spectral line
Write a program that prompts the user to enter which spectral shift they want to compute
(1 for blue-shift, 2 for red-shift). The program should then prompt for the spectral line
of an object and the observed (shifted) frequency and output the velocity of the distant
object. For example, if a user enters the values 1 (blue-shifted), 434 (nm) and 487 (nm),
the output should look something like the following.
Spectral Line: 434nm
Observed Line: 487nm
Relative Velocity: 32626.28 km/s
Exercise 2.26. Radiometric dating is a technique by which the age of rocks, minerals,
and other material can be estimated by measuring the proportion of radioactive isotopes
it still has to its decay products. It can be computed with the following formula:
D = D0 + N (eλt − 1)
where
• t is age of the sample,
• D is number of atoms of the daughter isotope in the sample,
• D0 is number of atoms of the daughter isotope in the original composition,
• N is number of atoms of the parent isotope in the sample
• λ is the decay constant of the parent isotope,
ln 2
λ=
t1/2
where t1/2 is the half-life of the parent isotope (in years).
62
2.7. Exercises
Write a program that prompts the user to enter D, D0 , N , and t1/2 and computes the
approximate age of the material, t.
For example, if the user were to enter 150, 50, 300, 28.8 (Strontium-90’s half-life) then
the program should output something like the following.
The sample appears to be 11.953080 years old.
Exercise 2.27. Suppose you have two circles each centered at (0, 0) and (d, 0) with radii
of R, r respectively. These circles may intersect at two points, forming an asymmetric
“lens” as in Figure 2.4.
The area of this lens can be computed using the following formula:
2
d + r 2 − R2
2
d + R2 − r 2
2 −1 2 −1
A = r cos + R cos −
2dr 2dR
1p
(−d + r + R)(d + r − R)(d − r + R)(d + r + R)
2
Write a program that prompts the user for the two radii and the x-offset d and computes
the area of this lens. Your program should handle the special cases where the two circles
do not intersect and when they intersect at a single point (the area is zero).
Figure 2.4.: Intersection of two circles.
63
3. Conditionals
When writing code, its important to be able to distinguish between one or more situations.
Based on some condition being true or false, you may want to perform some action if
its true, while performing another, different action if it is false. Alternatively, you may
simply want to perform one action if and only if the condition is true, and do nothing
(move forward in your program) if it is false.
Normally, the control flow of a program is sequential : each statement is executed top-to-
bottom one after the other. A conditional statement (sometimes called selection control
structures) interrupts this normal control flow and executes statements only if some
specified condition holds. The usual way of achieving this in a programming language is
through the use conditional statements such as the if statement, if-else statement, and
if-else-if statement.
By using conditional statements, we can design more expressive programs whose behavior
depends on their state: if the value of some variable is greater than some threshold, we
can perform action A, otherwise, we can perform action B. You do this on a daily basis
as you make decisions for yourself. At a cafe you may want to purchase the grande coffee
which costs $2. If you have $2 or more, then you’ll buy it. Otherwise, if you have less
than $2, you can settle for the normal coffee which costs $1. Yet still, if you have less
than $1 you’ll not be able to make a purchase. The value of your pocket book determines
your decision and subsequent actions that you take.
Similarly, our programs need to be able to “make decisions” based on various conditions
(they don’t actually make decisions for themselves as computer are not really “intelligent”,
we are simply specifying what should occur based on the conditions). Conditions in a
program are specified by coding logical statements using logical operators.
3.1. Logical Operators
In logic, everything is black and white: a logical statement is an assertion that is either
true or it is false. As previously discussed, some programming languages allow you to
define and use Boolean variables that can be assigned the value true or false. We can
also formulate statements that involve other types of variables whose truth values are
determined by the values of the variables at run time.
65
3. Conditionals
3.1.1. Comparison Operators
Suppose we have a variable age representing the age of an individual. Suppose we wish
to execute some code if the person is an adult, age ≥ 18 and a different piece of code if
they are not an adult, age < 18. To achieve this, we need to be able to make comparisons
between variables, constants, and even more complex expressions. Such logical statements
may not have a fixed truth value. That is, they could be true or false depending on the
value of the variables involved when the program is run.
Such comparisons are common in mathematics and likewise in programming languages.
Comparison operators are usually binary operators in that they are applied to two
operands: a left operand and a right operand. For example, if a, b are variables (or
constants or expressions), then the comparison,
a≤b
is true if the value stored in a is less than or equal to the value stored in b. Otherwise, if
the value stored in b is strictly less than the value stored in a, the expression is false.
Further, a, b are the operands and ≤ is the binary operator.
In general, operators do not commute. That is,
a ≤ b and b ≤ a
are not equivalent, just as they are not in mathematics. However,
a ≤ b and b ≥ a
are equivalent. Thus, the order of operands is important and can change the meaning
and truth value of an expression.
A full listing of binary operators can be found in Table 3.1. In this table, we present both
the mathematical notation used in our pseudocode examples as well as the most common
ways of representing these comparison operators in most programming languages. The
need for alternative representations is because the mathematical symbols are not part of
the ASCII character set common to most keyboards.
When using comparison operators, either operand can be variables, constants, or even
more complex expressions. For example, you can make comparisons between two variables,
a < b, a > b, a ≤ b, a ≥ b, a = b, a 6= b
or they can be between a variable and a constant
a < 10, a > 10, a ≤ 10, a ≥ 10, a = 10, a 6= 10
or
10 < b, 10 > b, 10 ≤ b, 10 ≥ b, 10 = b, 10 6= b
66
3.1. Logical Operators
Psuedocode Code Meaning Type
< < less than relational
> > greater than relational
≤ <= less than or equal to relational
≥ >= greater than or equal to relational
= == equal to equality
6= != not equal to equality
Table 3.1.: Comparison Operators
Comparisons can also be used with more complex expressions such as
√
b2 − 4ac < 0
which could commonly be expressed in code as
sqrt(b*b - 4*a*c) < 0
Observe that both operands could be constants, such as 5 ≤ 10 but there would be little
point. Since both are constants, the truth value of the expression is already determined
before the program runs. Such an expression could easily be replaced with a simple true
or false variable. These are referred to as tautologies and contradictions respectively.
We’ll examine them in more detail below.
Pitfalls
Sometimes you may want to check that a variable falls within a certain range. For
example, we may want to test that x lies in the interval [0, 10] (between 0 and 10 inclusive
on both ends). Mathematically we could express this as
0 ≤ x ≤ 10
and in code, we may try to do something like
0 <= x <= 10
However, when used in code, the operators <= are binary and must be applied to two
operands. In a language the first inequality, 0 <= x would be evaluated and would
result in either true or false. The result is then used in the second comparison which
results in a question such as true ≤ 10 or false ≤ 10.
Some languages would treat this as a syntax error and not allow such an expression to
be compiled since you cannot compare a Boolean value to a numerical value. However,
other languages may allow this, typically representing true with some nonzero value such
as 1 and false with 0. In either case, the expression would evaluate to true since both
67
3. Conditionals
0 ≤ 10 and 1 ≤ 10. However, this is clearly wrong: if x had a value of 20 for example, the
first expression would evaluate to false, making the entire expression true, but 20 6≤ 10.
The solution is to use logical operators to express the same logic using two comparison
operators (see Section 3.1.3).
Another common pitfall when programming is to mistake the assignment operator
(typically only one equals sign, = ) and the equality operator (typically two equal signs,
== ). As before, some languages will not allow it. The expression a = 10 would not have
a truth value associated with it. Attempts to use the expression in a logical statement
would be a syntax error. Other languages may permit the expression and would give it a
truth value equal to the value of the variable. For example, a = 10 would take on the
value 10 and be treated as true (nonzero value) while a = 0 would take on the value 0
and be treated as false (zero). In either case, we probably do not get the result that we
want. Take care that you use proper equality comparison operators.
Other Considerations
The comparison operators that we’ve examined are generally used for comparing numerical
types. However, sometimes we wish to compare non-numeric types such as single
characters or strings. Some languages allow you to use numeric operators with these
types as well.
Some dynamically typed languages (PHP, JavaScript, etc.) have additional rules when
comparison operators are used with mixed types (that is, we compare a string with a
numeric type). They may even have additional “strict” comparison operators such as
(a === b) and (a !== b) which are true only if the values and types match. So, for
example, (10 == "10") may be true because the values match, but (10 === "10")
would be false since the types do not match (one is an integer, the other a string). We
discuss specifics in subsequent chapters are they pertain to specific languages.
3.1.2. Negation
The negation operator is an operator that “flips” the truth value of the expression that
it is applied to. It is very much like the numerical negation operator which when applied
to positive numbers results in their negation and vice versa. When the logical negation
operator is applied to a variable or statement, it negates its truth value. If the variable
or statement was true, its negation is false and vice versa.
Also like the numerical negation operator, the logical negation operator is a unary
operator as it applies to only one operand. In modern logic, the symbol ¬ is used to
68
3.1. Logical Operators
a ¬a
false true
true false
Table 3.2.: Logical Negation, ¬ Operator
denote the negation operator1 , examples:
¬p, ¬(a > 10), ¬(a ≤ b)
We will adopt this notation in our pseudocode, however most programming languages use
the exclamation mark, ! for the negation operator, similar to its usage in the inequality
comparison operator, != . The negation operator applies to the variable or statement
immediately following it, thus
¬(a ≤ b) and ¬a ≤ b
are not the same thing (indeed, the second expression may not even be valid depending
on the language). Further, when used with comparison operators, it is better to use the
“opposite” comparison. For example,
¬(a ≤ b) and (a > b)
are equivalent, but the second expression is preferred as it is simpler. Likewise,
¬(a = b) and (a 6= b)
are equivalent, but the second expression is preferred.
3.1.3. Logical And
The logical and operator (also called a conjunction) is a binary operator that is true if
and only if both of its operands is true. If one of its operands is false, or if both of them
are false, then the result of the logical and is false.
Many programming languages use two ampersands, a && b to denote the logical And
operator.2 However, for our pseudocode we will adopt the notation And and we will
use expressions such as a And b. Table 3.3 contains a truth table representation of the
logical And operator.
1
This notation was first used by Heyting, 1930 [16]; prior to that the tilde symbol was used (∼p for
example) by Peano [34] and Whitehead & Russell [38]. However, the tilde operator has been adopted
to mean bit-wise negation in programming languages.
2
In logic, the “wedge” symbol, p ∧ q is used to denote the logical And. It was first used again by
Heyting, 1930 [16] but should not be confused for the keyboard caret, ˆ, symbol. Many programming
languages do use the caret as an operator, but it is usually the exclusive-or operator which is true if
and only if exactly one of its operands is true.
69
3. Conditionals
a b a And b
false false false
false true false
true false false
true true true
Table 3.3.: Logical And Operator
The logical And is used to combine logical statements to form more complex logical
statements. Recall that we couldn’t directly use two comparison operators to check that
a variable falls within a range, 0 ≤ x ≤ 10. However, we can now use a logical And to
express this:
(0 ≤ x) And (x ≤ 10)
This expression is true only if both comparisons are true.
Though the And operator is a binary operator, we can write statements that involve
more than one variable or expression by using multiple instances of the operator. For
example,
b2 − 4ac ≥ 0 And a 6= 0 And c > 0
The above statement would be evaluated left-to-right; the first two operands would be
evaluated and the result would be either true or false. Then the result would be used as
the first operand of the second logical And. In this case, if any of the operands evaluated
to false, the entire expression would be false. Only if all three were true would the
statement be true.
3.1.4. Logical Or
The logical or operator is the binary operator that is true if at least one of its operands
is true. If both of its operands are false, then the logical or is false. This is in contrast
to what is usually meant by “or” colloquially. If someone says “you can have cake
or ice-cream,” usually they implicitly also mean, “but not both.” With the logical or
operator, if both operands are true, the result is still true.
Many programming languages use two vertical bars (also referred to as Sheffer strokes),
|| to denote the logical Or operator.3 . However, for our pseudocode we will adopt the
notation Or, thus the logical or can be expressed as a Or b. Table 3.4 contains a truth
table representation of the logical Or operator.
As with the logical And, the logical Or is used to combine logical statements to make
3
In logic, the “vee” symbol, p ∨ q is used to denote the logical Or. It was first used by Russell, 1906
[36].
70
3.1. Logical Operators
a b a Or b
false false false
false true true
true false true
true true true
Table 3.4.: Logical Or Operator
more complex statements. For example,
(age ≥ 18) Or (year = “senior”)
which is true if the individual is aged 18 or older, is a senior, or is both 18 or older and
a senior. If the individual is aged less than 18 and is not a senior, then the statement
would be false.
We can also write statements with multiple Or operators,
a > b Or b > c Or a > c
which will be evaluated left-to-right. If any of the three operands is true, the statement
will be true. The statement is only false when all three of the operands is false.
3.1.5. Compound Statements
The logical And and Or operators can be combined to express even more complex logical
statements. For example, you can express the following statements involving both of the
operators:
a And (b Or c) a Or (b And c)
As an example, consider the problem of deciding whether or not a given year is a leap
year. The Gregorian calendar defines a year as a leap year if it is divisible by 4. However,
every year that is divisible by 100 is not a leap year unless it is also divisible by 400.
Thus, 2012 is a leap year (4 goes into 2012 503 times), however, 1900 was not a leap year:
though it is divisible by 4 (1900/4 = 475 with no remainder), it is also divisible by 100.
The year 2000 was a leap year: it was divisible by 4 and 100 thus it was divisible by 400.
When generalizing these rules into logical statements we can follow a similar process: A
year is a leap year if it is divisible by 400 or it is divisible by 4 and not by 100. This
logic can be modeled with the following expression.
year mod 400 = 0 Or (year mod 4 = 0 And year mod 100 6= 0)
When writing logical statements in programs it is generally best practice to keep things
simple. Logical statements should be written in the most simple and succinct (but
correct) way possible.
71
3. Conditionals
Tautologies and Contradictions
Some logical statements have the same meaning regardless of the variables involved. For
example,
a Or ¬a
is always true regardless of the value of a. To see this, suppose that a is true, then the
statement becomes
a Or ¬a = true Or false
which is true. Now suppose that a is false, then the statement is
a Or ¬a = false Or true
which again is true. A statement that is always true regardless of the truth values of its
variables is a tautology.
Similarly, the statement
a And ¬a
is always false (at least one of the operands will always be false). A statement that is
always false regardless of the truth values of its variables is a contradiction.
In most cases, it is pointless to program a conditional statement with tautologies or
contradictions: if an if-statement is predicated on a tautology it will always be executed.
Likewise, an if-statement involved with a contradiction will never be executed. In either
case, many compilers or code analysis tools may indicate and warn about these situations
and encourage you to modify the code or to remove “dead code.” Some languages may
not even allow you write such statements.
There are always exceptions to the rule. Sometimes you may wish to intentionally write
an infinite loop (see Section 4.5.2) for example in which case a statement similar to the
following may be written.
1 while true do
//some computation
2 end
De Morgan’s Laws
Another tool to simplify your logic is De Morgan’s Laws. When a logical And statement
is negated, it is equivalent to an unnegated logical Or statement and vice versa. That is,
¬(a And b) and ¬a Or ¬b
72
3.1. Logical Operators
Order Operator
1 ¬
2 And
3 Or
Table 3.5.: Logical Operator Order of Precedence
are equivalent to each other;
¬(a Or b) and ¬a And ¬b
are also equivalent to each other. Though equivalent, it is generally preferable to write
the simpler statement. From one of our previous examples, we could write
¬ ((0 ≤ x) And (x ≤ 10))
or we could apply De Morgan’s Law and simplify this to
(0 > x) Or (x > 10)
which is more concise and arguably more readable.
Order of Precedence
Recall that numerical operators have a well defined order of precedence that is taken from
mathematics (multiplication is performed before addition for example, see Section 2.3.4).
When working with logical operators, we also have an order of precedence that somewhat
mirrors those of numerical operators. In particular, negations are always applied first,
followed by And operators, and then lastly Or operators.
For example, the statement
a Or b And c
is somewhat ambiguous. We don’t just evaluate it left-to-right since the And operator
has a higher order of precedence (this is similar to the mathematical expression a + b · c
where the multiplication would be evaluated first). Instead, this statement would be
evaluated by evaluating the And operator first and then the result would be applied to
the Or operator. Equivalently,
a Or (b And c)
If we had meant that the Or operator should be evaluated first, then we should have
explicitly written parentheses around the operator and its operands like
(a Or b) And c
73
3. Conditionals
In fact, its best practice to write parentheses even if it is not necessary. Writing
parentheses is often clearer and easier to read and more importantly communicates intent.
By writing
a Or (b And c)
the intent is clear: we want the And operator to be evaluated first. By not writing the
parentheses we leave our meaning somewhat ambiguous and force whoever is reading the
code to recall the rules for order of precedence. By explicitly writing parentheses, we
reduce the chance for error both in writing and in reading. Besides, its not like we’re
paying by the character.
For similar operators of the same precedence, they are evaluated left-to-right, thus
a Or b Or c is equivalent to ((a Or b) Or c)
and
a And b And c is equivalent to ((a And b) And c)
3.1.6. Short Circuiting
Consider the following statement:
a And b
As we evaluate this statement, suppose that we find that a is false. Do we need to
examine the truth value of b? The answer is no: since a is false, regardless of the truth
value of b, the statement is false because it is a logical And. Both operands must be
true for an And to be true. Since the first is false, the second is irrelevant.
Now imagine evaluating this statement in a computer. If the first operand of an And
statement is false, we don’t need to examine/evaluate the second. This has some potential
for improved efficiency: if the second operand does not need to be evaluated, a program
could ignore it and save a few CPU cycles. In general, the speed up for most operations
would be negligible, but in some cases the second operand could be very “expensive” to
compute (it could be a complex function call, require a database query to determine,
etc.) in which case it could make a substantial difference.
Historically, avoiding even a few operations in old computers meant a difference on
the order of milliseconds or even seconds. Thus, it made sense to avoid unnecessary
operations. This is now known as short circuiting and to this day is still supported in
most programming languages.4 Though the differences are less stark in terms of CPU
resources, most developers and programmers have come to expect this behavior and write
statements under the assumption that short-circuiting will occur.
4
Historically, the short-circuited version of the And operator was known as McCarthy’s sequential
conjunction operation which was formally defined by John McCarthy (1962) as “if p then q, else
false”, eliminating the evaluation of q if p is false [23].
74
3.2. The If Statement
Short circuiting is commonly used to “check” for invalid operations. This is commonly
used to prevent invalid operations. For example, consider the following statement:
(d 6= 0 And 1/d > 1)
The first operand is checking to see if d is not zero and the second checks to see if its
reciprocal is greater than 1. With short-circuiting, if d = 0, then the second operand
will not be evaluated and the division by zero will be prevented. If d 6= 0 then the
first operand is true and so the second operand will be evaluated as normal. Without
short-circuiting, both operands would be evaluated leading to a division by zero error.
There are many other common patterns that rely on short-circuiting to avoid invalid or
undefined operations. For example, short-circuiting is used to check that a variable is
valid (defined or not Null) before using it, or to check that an index variable is within
the range of an array’s size before accessing a value.
Because of short-circuiting, the logical And is effectively not commutative. An operator
is commutative if the order of its operands is irrelevant. For example, addition and
multiplication are both commutative,
x+y =y+x x·y =y·x
but subtraction and division are not,
x − y 6= y − x x/y 6= y/x
In logic, the And and Or operators are commutative, but when used in most programming
languages they are not,
(a And b) 6= (b And a) and (a Or b) 6= (b Or a)
It is important to emphasize that they are still logically equivalent, but they are not
effectively equivalent: because of short-circuiting, each of these statements have a
potentially different effect.
The Or operator is also short-circuited: if the first operand is true, then the truth value
of the expression is already determined to be true and so the second operand will not be
evaluated. In the expression,
a Or b
if a evaluates to true, then b is not evaluated (since if either operand is true, the entire
expression is true).
3.2. The If Statement
Normally, the flow of control (or control flow) in a program is sequential. Each instruction
is executed, one after the other, top-to-bottom and in individual statements left-to-right
75
3. Conditionals
just as one reads in English. Moreover, in most programming languages, each statement
executes completely before the next statement begins. A visualization of this sequential
control flow can be found in the control flow diagram in Figure 3.1(a).
However, it is often necessary for a program to “make decisions.” Some segments of code
may need to be executed only if some condition is satisfied. The if statement is a control
structure that allows us to write a snippet of code predicated on a logical statement.
The code executes if the logical statement is true, and does not execute if the logical
statement is false. This control flow is featured in Figure 3.1(b)
An example using pseudocode can be found in Algorithm 3.1. The use of the keyword
“if” is common to most programming languages. The logical statement associated with
the if-statement immediately follows the “if” keyword and is usually surrounded by
parentheses. The code block immediately following the if-statement is bound to the
if-statement.
1 if (hconditioni) then
2 Code Block
3 end
Algorithm 3.1: An if-statement
As in the flow chart, if the hconditioni evaluates to true, then the code block bound to
the statement executes in its entirety. Otherwise, if the condition evaluates to false, the
code block bound to the statement is skipped in its entirety.
A simple if-statement can be viewed as a “do this if and only if the condition holds.”
Alternatively, “if this condition holds do this, otherwise don’t.” In either case, once the
if-statement finishes execution, the program returns to the normal sequential control
flow.
3.3. The If-Else Statement
An if-statement allows you to specify a code segment that is executed or is not executed.
An if-else statement allows you to specify an alternative. An if-else statement allows you
to define a condition such that if the condition is true, one code block executes and if
the condition is false, an entirely different code block executes.
The control flow of an if-else statement is presented in Figure 3.2. Note that Code
Block A and Code Block B are mutually exclusive. That is, one and only one of them is
executed depending on the truth value of the hconditioni. A presentation of a generic
if-else statement in our pseudocode can be found in Algorithm 3.2
76
3.3. The If-Else Statement
Statement 1
true Code
hconditioni
Block
Statement 2
false
Remaining
Statement 3 Program
(a) Sequential Flow Chart (b) If-Statement Flow Chart
Figure 3.1.: Control flow diagrams for sequential control flow and an if-statement. In
sequential control, statements are executed one after the other as they are
written. In an if-statement, the normal flow of control is interrupted and a
Code Block is only executed if the given condition is true, otherwise it is
not. After the if-statement, normal sequential control flow resumes.
77
3. Conditionals
true Code
hconditioni
Block A
false
Code
Block B
Remaining
Program
Figure 3.2.: An if-else Flow Chart
Just as with an if-statement, the keyword “if” is used. In fact, the if-statement is simply
just an if-else statement with the else block omitted (equivalently, we could have defined
an empty else block, but since it would have no effect, a simple if-statement with no
else block is preferred). It is common to most programming languages to use the “else”
keyword to denote the else block of code. Since there is only one hconditioni to evaluate
and it can only be true or false, it is not necessary to specify the conditions under which
the else block executes. It is assumed that if the hconditioni evaluates to false, the else
block executes.
As with an if-statement, the block of code associated with the if-statement as well as the
block of code associated with the else-statement are executed in their entirety or not at
all. Whichever block of code executes, normal flow of control returns and the remaining
program continues executing sequentially.
3.4. The If-Else-If Statement
An if-statement allows you to define a “do this or do not” and an if-else statement allows
you to define a “do this or do that” statement. Yet another generalization is an if-else-if
statement. Using such a statement you can define any number of mutually exclusive
code blocks.
78
3.4. The If-Else-If Statement
1 if (hconditioni) then
2 Code Block A
3 else
4 Code Block B
5 end
Algorithm 3.2: An if-else Statement
To illustrate, consider the case in which we have exactly three mutually exclusive
possibilities. At a particular university, there are three possible semesters depending
on the month. January through May is the Spring semester, June/July is the Summer
semester, and August through December is the Fall semester. These possibilities are
mutually exclusive because it cannot be both Spring and Summer at the same time
for example. Suppose we have the current month stored in a variable named month.
Algorithm 3.3 expresses the logic for determining which semester it is using an if-else-if
statement.
1 if (month ≥ January) And (month ≤ May) then
2 semester ← “Spring”
3 else if (month > May) And (month ≤ July) then
4 semester ← “Summer”
5 else
6 semester ← “Fall”
7 end
Algorithm 3.3: Example If-Else-If Statement
Let’s understand how this code works. First, the “if” and “else” keywords are used
just as the two previous control structures, but we are now also using the “else if”
keyword combination to specify an additional condition. Each condition, starting with
the condition associated with the if-statement is checked in order. If and when one of the
conditions is satisfied (evaluates to true), the code block associated with that condition
is executed and all other code blocks are ignored.
Each of the code blocks in an if-else-if control structure are mutually exclusive. One
and only one of the code blocks will ever execute. Similar to the sequential control flow,
the first condition that is satisfied is the one that is executed. If none of the conditions
is satisfied, then the code block associated with the else-statement is the one that is
executed.
In our example, we only identified three possibilities. You can generalize an if-else-if
statement to specify as many conditions as you like. This generalization is depicted in
79
3. Conditionals
true
Code
if(hcondition 1i) hcondition 1i
Block A
false
true
Code
else if(hcondition 2i) hcondition 2i
Block B
false
true
Code
else if(hcondition 3i) hcondition 3i
Block C
false
.. ..
. .
false
true
Code
else if(hcondition ni) hcondition ni
Block N
false
Code
else
Block M
Remaining
Program
Figure 3.3.: Control Flow for an If-Else-If Statement. Each condition is evaluated in
sequence. The first condition that evaluates to true results in the corre-
sponding code block being executed. After executing, the program continues.
Thus, each code block is mutually exclusive: at most one of them is executed.
80
3.4. The If-Else-If Statement
Algorithm 3.4 and visualized in Figure 3.3. Similar to the if-statement, the else-statement
and subsequent code block is optional. If omitted, then it may be possible that none of
the code blocks is executed.
1 if (hcondition 1i) then
2 Code Block A
3 else if (hcondition 2i) then
4 Code Block B
5 else if (hcondition 3i) then
6 Code Block C
7 ...
8 else
9 Code Block
10 end
Algorithm 3.4: General If-Else-If Statement
The design of if-else-if statements must be done with care to ensure that your statements
are each mutually exclusive and capture the logic you intend. Since the first condition
that evaluates to true is the one that is executed, the order of the conditions is important.
A poorly designed if-else-if statement can lead to bugs and logical errors.
As an example, consider describing the loudness of a sound by its decibel level in Algorithm
3.5.
1 if decibel ≤ 70 then
2 comf ort ← “intrusive”
3 else if decibel ≤ 50 then
4 comf ort ← “quiet”
5 else if decibel ≤ 90 then
6 comf ort ← “annoying”
7 else
8 comf ort ← “dangerous”
9 end
Algorithm 3.5: If-Else-If Statement With a Bug
Suppose that decibel = 20 which should be described as a “quite” sound. However, in the
algorithm, the first condition, decibel ≤ 70 evaluates to true and the sound is categorized
as “intrusive”. The bug is that the second condition, decibel ≤ 50 should have come first
in order to capture all decibel levels less than or equal to 50.
Alternatively, we could have followed the example in Algorithm 3.3 and completely
81
3. Conditionals
specified both lower bounds and upper bounds in our condition. For example, the
condition for “intrusive” could have been
(decibel > 50) And (decibel ≤ 70)
However, doing this is unnecessary if we order our conditions appropriately and we can
potentially write simpler conditions if we remember the fact that the if-else-if statement
is mutually exclusive.
3.5. Ternary If-Else Operator
Another conditional operator is the ternary if-then-else operator. It is often used to
write an expression that can take on one of two values depending on the truth value of a
logical expression. Most programming languages support this operator which has the
following syntax:
E ? X : Y
Here, E is a Boolean expression. If E evaluates to true, the statement takes on the
value X which does not need to be a Boolean value: it can be anything (an integer,
string, etc.). If E evaluates to false, the statement takes on the value Y .
A simple usage of this expression is to find the minimum of two values:
min = ( (a < b) ? a : b );
If a < b is true, then min will take on the value a. Otherwise it will take on the value b
(in which case a ≥ b and so b is minimal). Most programming languages support this
special syntax as it provides a nice convenience (yet another example of syntactic sugar).
3.6. Examples
3.6.1. Meal Discount
Consider the problem of computing a receipt for a meal. Suppose we have the subtotal
cost of all items in the meal. Further, suppose that we want to compute a discount
(senior citizen discount, student discount, or employee discount, etc.). We can then apply
the discount, compute the sales tax, and sum a total, reporting each detail to the user.
To do this, we first prompt the user to enter a subtotal. We can then ask the user if
there is a discount to be computed. If the user answers yes, then we again prompt them
for an amount (to allow different types of discounts). Otherwise, the discount will be
82
3.6. Examples
zero. We can then proceed to calculate each of the amounts above. To do this we’ll need
an if-statement. We could also use a conditional statement to check to see if the input
makes sense: we wouldn’t want a discount amount that is greater than 100%. The full
algorithm is presented in Algorithm 3.6.
1 Prompt the user for a subtotal
2 subT otal ← read input from user
3 discountP ercent ← 0
4 Ask the user if they want to apply a discount
5 hasDiscount ← get user input if hasDiscount = “yes” then
6 Prompt the user for a discount amount
7 discountP ercent ← read user input
8 end
9 if discountP ercent > 100 then
10 Error! Discount cannot be more than 100%
11 end
12 discount ← subT otal × discountP ercent
13 discountT otal ← subT otal − discount
14 tax ← taxRate × discountT otal
15 grandT otal ← discountT otal + tax
16 output subT otal, discountT otal, tax, grandT otal to user
Algorithm 3.6: A simple receipt program
3.6.2. Look Before You Leap
Recall that dividing by zero is an invalid operation in most programming languages (see
Section 2.3.5). Now that we have a means by which numerical values can be checked, we
can prevent such errors entirely.
Suppose that we were going to compute a quotient of two variables x/y. If y = 0, this
would be an invalid operation and lead to undefined, unexpected or erroneous behavior.
However, if we checked whether or not the denominator is zero before we compute the
quotient then we could prevent such errors. We present this idea in Algorithm 3.7.
1 if y 6= 0 then
2 q ← x/y
3 end
Algorithm 3.7: Preventing Division By Zero Using an If Statement
83
3. Conditionals
This approach to programming is known as defensive programming. We are essentially
checking the conditions for an invalid operation before performing that operation. In
the example above, we simply chose not to perform the operation. Alternatively, we
could use an if-else statement to perform alternate operations or handle the situation
differently. Defensive programming is akin to “looking before leaping”: before taking a
potentially dangerous step, you look to see if you are at the edge of a cliff, and if so you
don’t take that dangerous step.
3.6.3. Comparing Elements
Suppose we have two students, student A and student B and we want to compare them:
we want to determine which one should be placed first in a list and which should be
placed second. For this exercise let’s suppose that we want to order them first by their
last names (so that Anderson comes before Zadora). What if they have the same last
name, like Jane Smith and John Smith? If the last names are equal, then we’ll want to
order them by their first names (Jane before John). If both their first names and last
names are the same, we’ll say either order is okay.
Names will likely be represented using strings, so let’s say that <, = and > apply to
strings, ordering them lexicographically (which is consistent with alphabetic ordering).
We’ll first need to compare their last names. If equal, then we’ll need another conditional
construct. This is achieved by nesting conditional statements as in Algorithm 3.8.
1 if A’s last name < B’s last name then
2 output A comes first
3 else if A’s last name > B’s last name then
4 output B comes first
5 else
//last names are equal, so compare their first names
6 if A’s first name < B’s first name then
7 output A comes first
8 else if A’s first name > B’s first name then
9 output B comes first
10 else
11 Either ordering is fine
12 end
13 end
Algorithm 3.8: Comparing Students by Name
84
3.6. Examples
3.6.4. Life & Taxes
Another example in which there are several cases that have to be considered is computing
an income tax liability using marginal tax brackets. Table 3.6 contains the 2014 US
Federal tax margins and marginal rates for a married couple filing jointly based on the
Adjusted Gross Income (income after deductions).
AGI is over But not over Tax
0 $18,150 10% of the AGI
$18,150 $73,800 $1,815 plus 15% of the AGI in excess of
$18,150
$73,800 $148,850 $10,162.50 plus 25% of the AGI in excess of
$73,800
$148,850 $225,850 $28,925 plus 28% of the AGI in excess of
$148,850
$225,850 $405,100 $50,765 plus 33% of the AGI in excess of
$225,850
$405,100 $457,600 $109,587.50 plus 35% of the AGI in excess
of $405,100
$457,600 — $127,962.50 plus 39.6% of the AGI in excess
of $457,600
Table 3.6.: 2014 Tax Brackets for Married Couples Filing Jointly
In addition, one of the tax credits (which offsets tax liability) tax payers can take is the
child tax credit. The rules are as follows:
• If the AGI is $110,000 or more, they cannot claim a credit (the credit is $0)
• Each child is worth a $1,000 credit, however at most $3,000 can be claimed
• The credit is not refundable: if the credit results in a negative tax liability, the tax
liability is simply $0
As an example: suppose that a couple has $35,000 AGI (placing them in the second tax
bracket) and has two children. Their tax liability is
$1, 815 + 0.15 × ($35, 000 − $18, 150) = $4, 342.50
However, the two children represent a $2,000 refund, so their total tax liability would be
$2,342.50.
Let’s first design some code that computes the tax liability based on the margins and
rates in Table 3.6. We’ll assume that the AGI is stored in a variable named income.
Using a series of if-else-if statements as presented in Algorithm 3.9, the variable tax will
85
3. Conditionals
contain our initial tax liability.
1 if income ≤ 18, 150 then
2 tax ← .10 · income
3 else if income > 18, 150 And income ≤ 73, 800 then
4 tax ← 1, 815 + .15 · (income − 18, 150)
5 else if income > 73, 800 And income ≤ 148, 850 then
6 tax ← 10, 162.50 + .25 · (income − 73, 800)
7 else if income > 148850 And income ≤ 225, 850 then
8 tax ← 28, 925 + .28 · (income − 148, 850)
9 else if income > 225, 850 And income ≤ 405, 100 then
10 tax ← 50, 765 + .33 · (income − 225, 850)
11 else if income > 405, 100 And income ≤ 457, 600 then
12 tax ← 109, 587.50 + .35 · (income − 405, 100)
13 else
14 tax ← 127, 962.50 + .396 · (income − 457, 600)
15 end
Algorithm 3.9: Computing Tax Liability with If-Else-If
We can then compute the amount of a tax credit and adjust the tax accordingly by using
similar if-else-if and if-else statements as in Algorithm 3.10.
1 if income ≥ 110, 000 then
2 credit ← 0
3 else if numberOf Children ≤ 3 then
4 credit ← numberOf Children ∗ 1, 000
5 else
6 credit ← 3000
7 end
//Now adjust the tax, taking care that its a nonrefundable credit
8 if credit > tax then
9 tax ← 0
10 else
11 tax ← (tax − credit)
12 end
Algorithm 3.10: Computing Tax Credit with If-Else-If
86
3.7. Exercises
3.7. Exercises
Exercise 3.1. Write a program that prompts the user for an x and a y coordinate in
the Cartesian plane and prints out a message indicating if the point (x, y) lies on an axis
(x or y axis, or both) or what quadrant it lies in (see Figure 3.4).
y
Quadrant II Quadrant I
x
Quadrant III Quadrant IV
Figure 3.4.: Quadrants of the Cartesian Plane
Exercise 3.2. A BOGO (Buy-One, Get-One) sale is a promotion in which a person
buys two items and receives a 50% discount on the less expensive one. Write a program
that prompts the user for the cost of two items, computes a 50% discount on the less
expensive one, and then computes a grand total.
Exercise 3.3. Price Per Mile. Write a program to determine which type of gas is the
better deal with respect to price-per-mile driven. For example, suppose unleaded costs
$2.50 per gallon and your vehicle is able to get an average of 30 miles per gallon. The
true cost of unleaded is thus 8.33 cents per mile. Now suppose that the ethanol fuel costs
only $2.25 per gallon but only yields 25 miles per gallon, thus 9 cents per mile, a worse
deal.
Write a program that prompts the user to enter the price (per gallon) of one type of gas
as well as the miles-per-gallon. Then prompt for the same two values for a second type
of gas and compute the true cost of each type. Print a message indicating which type of
gas is the better deal. For example, if the user enters the values above the output would
look something like:
87
3. Conditionals
Gas A: $0.0833 per mile
Gas B: $0.0900 per mile
Gas A is the better deal.
Exercise 3.4. Various substances have different boiling points. A selection of substances
and their boiling points can be found in Table 3.7. Write a program that prompts the
user for the observed boiling point of a substance in degrees Celsius and identifies the
substance if the observed boiling point is within 5% of the expected boiling point. If the
data input is more than 5% higher or lower than any of the boiling points in the table, it
should output Unknown substance.
Substance Boiling Point (C)
Methane -161.7
Butane -0.5
Water 100
Nonane 150.8
Mercury 357
Copper 1187
Silver 2193
Gold 2660
Table 3.7.: Expected Boiling Points
Exercise 3.5. Electrical resistance in various metals can be measured using nano-ohm
metres (nΩ · m). Table 3.8 gives the resistivity of several metals.
Material Resistivity (nΩ · m)
Copper 16.78
Aluminum 26.50
Beryllium 35.6
Potassium 72.0
Iron 96.10
Table 3.8.: Resistivity of several metals
Write a program that prompts the user for an observed resistivity of an unknown material
(as nano-ohm metres) and identifies the substance if the observed resistivity is within
±3% of the known resistivity of any of the materials in Table 3.8. If the input value lies
outside the ±3% range, output Unknown substance.
Exercise 3.6. The visible light spectrum is measured in nanometer (nm) frequencies.
Ranges roughly correspond to visible colors as depicted in Table 3.9.
88
3.7. Exercises
Color Wave length range (nm)
Violet 380 – 450
Blue 450 – 475
Indigo 476 – 495
Green 495 – 570
Yellow 570 – 590
Orange 590 – 620
Red 620 - 750
Table 3.9.: Visible Light Spectrum Ranges
Write a program that takes an integer corresponding to a wavelength and outputs the
corresponding color. If the value lies outside the ranges it should output Not a visible
wavelength. If a value lies within multiple color ranges it should print all that apply
(for example, a wavelength of 495 is “Indigo-green”).
Exercise 3.7. A certain production of steel is graded according to the following condi-
tions:
(i) Hardness must be greater than 50
(ii) Carbon content must be less than 0.7
(iii) Tensile strength must be greater than 5600
A grade of 5 thru 10 is is assigned to the steel according to the conditions in Table 3.10.
Write a program that will read in the hardness, carbon content, and tensile strength as
Grade Conditions
10 All three conditions are met
9 Conditions (i) and (ii) are met
8 Conditions (ii) and (iii) are met
7 Conditions (i) and (iii) are met
6 If only 1 of the three conditions is met
5 If none of the conditions are met
Table 3.10.: Grades of Steel
inputs and output the corresponding grade of the steel.
Exercise 3.8. A triangle can be characterized in terms of the length of its three sides.
In particular, an equilateral triangle is a triangle with all three sides being equal. A
triangle such that two sides have the same length is isosceles and a triangle with all three
sides having a different length is scalene. Examples of each can be found in Figure 3.5.
In addition, the three sides of a triangle are valid only if the sum of any two sides is
strictly greater than the third length.
89
3. Conditionals
Write a program to read in three numbers as the three sides of a triangle. If the three
sides do not form a valid triangle, you should indicate so. Otherwise, if valid, your
program should output whether or not the triangle is equilateral, isosceles or scalene.
(a) Equilateral Triangle (b) Isosceles Triangle (c) Scalene Triangle
Figure 3.5.: Three types of triangles
Exercise 3.9. Body Mass Index (BMI) is a healthy statistic based on a person’s mass
and height. For a healthy adult male BMI is calculated as
m
BMI = · 703.069579
h2
where m is the person’s mass (in lbs) and h is the person’s height (in whole inches).
Write a program that reads in a person’s mass and height as input and outputs a
characterization of the person’s health with respect to the categories in Table 3.11.
Range Category
BMI < 15 Very severely underweight
15 ≤ BMI < 16 Severely underweight
16 ≤ BMI < 18.5 Underweight
18.5 ≤ BMI < 25 Normal
25 ≤ BMI < 30 Overweight
30 ≤ BMI < 35 Obese Class I
35 ≤ BMI < 40 Obese Class II
BMI ≥ 40 Obese Class III
Table 3.11.: BMI Categories
Exercise 3.10. Let R1 and R2 be rectangles in the plane defined as follows. Let (x1 , y1 )
be point corresponding to the lower-left corner of R1 and let (x2 , y2 ) be the point of its
upper-right corner. Let (x3 , y3 ) be point corresponding to the lower-left corner of R2 and
let (x4 , y4 ) be the point of its upper-right corner.
Write a program to determine the intersection of these two rectangles. In general, the
intersection of two rectangles is another rectangle. However, if the two rectangles abut
each other, the intersection could be a horizontal or vertical line segment (or even a
point). It is also possible that the intersection is empty. Your program will need to
distinguish between these cases.
90
3.7. Exercises
y
(8.5, 8.25)
(6, 7.5)
(4, 5.5)
(2, 1)
x
Figure 3.6.: Intersection of Two Rectangles
If the intersection of R1 , R2 is a rectangle, R3 , your program should output two points
(the lower-left and upper-right corners of R3 ) as well as the area of R3 . If the intersection
is a line segment, your program should output the two end-points and whether it is a
vertical or horizontal line segment. Finally, if the intersection is empty your program
should output “empty intersection”. Your program should also be robust enough to
check that the input is valid (it should not accept empty or “reversed” rectangles).
Your program should read in x1 , y1 , x2 , y2 , x3 , y3 , x4 , y4 from the user and perform the
computation above. As an example, the values 2, 1, 6, 7.5, 4, 5.5, 8.5, 8.25 would correspond
to the two rectangles in Figure 3.6.
The output for this instance should look something like the following.
Intersecting rectangle: (4, 5.5), (6, 7.5)
Area: 4.00
Exercise 3.11. Write an app to help people track their cell phone usage. Cell phone
plans for this particular company give you a certain number of minutes every 30 days
which must be used or they are lost (no rollover). We want to track the average number
of minutes used per day and inform the user if they are using too many minutes or can
afford to use more.
Write a program that prompts the user to enter the following pieces of data:
91
3. Conditionals
• Number of minutes in the plan per 30 day period, m
• The current day in the 30 day period, d
• The total number of minutes used so far u
The program should then compute whether the user is over, under, or right on the average
daily usage under the plan. It should also inform them of how many minutes are left
and how many, on average, they can use per day for the rest of the month. Of course, if
they’ve run out of minutes, it should inform them of that too.
For example, if the user enters m = 250, d = 10, and u = 150, your program should print
out something similar to the following.
10 days used, 20 days remaining
Average daily use: 15 min/day
You are EXCEEDING your average daily use (8.33 min/day),
continuing this high usage, you'll exceed your minute plan by
200 minutes.
To stay below your minute plan, use no more than 5 min/day.
Of course, if the user is under their average daily use, a different message should be
presented. You are allowed/encouraged to compute any other stats for the user that you
feel would be useful.
Exercise 3.12. Write a program to help a floor tile company determine how many tiles
they need to send to a work site to tile a floor in a room. For simplicity, assume that all
rooms are perfectly rectangular with no obstructions; we will also omit any additional
measurements related to grouting.
Further, we will assume that all tile is laid in a grid pattern centered at the center of the
room. That is, four tiles will meet at their corners at the center of the room with tiles
laid out to the edge of the room. Thus, it may be the case that the final row and/or
column at the edge may need to be cut. Also note that if the cut is short enough, the
remaining tile can be used on the other end of the room (same goes for the corners).
The program will take the following input:
• w - the width of the room
• l - the length of the room
92
3.7. Exercises
Center of the room Center of the room
10.0 10.0
0.9 0.9 0.4 0.4
9.8 8.8
(a) Example 1 (b) Example 2
Figure 3.7.: Examples of Floor Tiling
• t - width/length of the tile (all tiles are perfectly square)
If we can use whole tiles to perfectly fit the room, then we do so. For example, on
the input (10, 10, 1), we could perfectly tile a 10 × 10 room with 100 1 × 1 tiles. If the
tiles don’t perfectly fit, then we have to consider the possibility of waste and/or reuse.
Consider the examples in Figure 3.7.
The first example is from the input (9.8, 100, 1). In this case, we lay the tiles from the
center of the room (8 full tile lengths) but are left with 0.9 on either side. If we cut a
tile to fit the left side, we are left with only .1 tile which is too short for the right side.
Therefore, we are forced to waste the 0.1 length and cut a full tile for the right side. In
all, 100 tiles are required.
The second example is from the input (8.8, 100, 1). In this case, we again lay tiles from
the center of the room (8 full tile lengths) and are left with 0.4 lengths on either side.
Here, we can reuse the cut tile: cut a tile on one side 0.4 with 0.6 remaining, and cut 0.4
on the other side of the tile (with the center 0.2 length of the tile being waste). Thus,
both sides can be tiled with a single tile, meaning only 90 full tiles are needed to tile this
room.
You may further assume that tiles used on the length-side end of the room cannot be
used to tile the width-side of the room (and vice versa). Your program will compute and
output the number of tiles required.
93
4. Loops
Computers are really good at automation. A key aspect of automation is the ability to
repeat a process over and over on different pieces of data until some condition is met.
For example, if we have a collection of numbers and we want to find their sum we would
iterate over each number, adding it to a total, until we have examined every number.
Another example may include sending an email message to each student in a course. To
automate the process, we could iterate over each student record and for each student we
would generate and send the email.
Automated repetition is where loops come in handy. Computers are perfectly suited for
performing such repetitive tasks. We can write a single block of code that performs some
action or processes a single piece of data, then we can write a loop around that block of
code to execute it a number of times.
Loops provide a much better alternative than repeating (cut-paste-cut-paste) the same
code over and over with different variables. Indeed, we wouldn’t even do this in real
life. Suppose that you took a 100 mile trip. How would you describe it? Likely, you
wouldn’t say, “I drove a mile, then I drove a mile, then I drove a mile, . . .” repeated 100
times. Instead, you would simply state “I drove 100 miles” or maybe even, “I drove until
I reached my destination.”
Loops allow us to write concise, repeatable code that can be applied to each element in
a collection or perform a task over and over again until some condition is met. When
writing a loop, there are three essential components:
• An initialization statement that specifies how the loop begins
• A continuation (or termination) condition that specifies whether the loop should
continue to execute or terminate
• An iteration statement that makes progress toward the termination condition
The initialization statement is executed before the loop begins and serves as a way to set
the loop up. Typically, the initialization statement involves setting the initial value of
some variable.
The continuation statement is a logical statement (that evaluates to true or false) that
specifies if the loop should continue (if the value is true) or should terminate (if the value
is false). Upon termination, code returns to a sequential control flow and the program
95
4. Loops
Initialization:
i ← 1
Continuation: false
i ≤ 10?
true
loop body
Iteration:
repeat i ← (i + 1)
remaining
program
Figure 4.1.: A Typical Loop Flow Chart
96
4.1. While Loops
continues.
The iteration statement is intended to update the state of a program to make progress
toward the termination condition. If we didn’t make such progress, the loop would
continue on forever as the termination condition would never be satisfied. This is known
as an infinite loop , and results in a program that never terminates.
As a simple example, consider the following outline.
• Initialize the value of a variable i to 1
• While the value of i is less than or equal to 10 . . . (continuation condition)
• Perform some action (this is sometimes referred to as the loop body
• Iterate the variable i by adding one to its value
The code outline above specifies that some action is to be performed once for each value:
i = 1, i = 2, . . . , i = 10, after which the loop terminates. Overall, the loop executes a
total of 10 times. Prior to each of the 10 executions, the value of i is checked; as it is less
than or equal to 10, the action is performed. At the end of each of the 10 iterations, the
variable i is incremented by 1 and the termination condition is checked again, repeating
the process. There are several different types of loops that vary in syntax and style but
they all have the same three basic components.
4.1. While Loops
A while loop is a type of loop that places the three components in their logical order. The
initialization statement is written before the loop code. Typically the keyword while is
used to specify the continuation/termination condition. Finally, the iteration statement
is usually performed at the end of the loop inside the code block associated with the loop.
A small, counter-controlled while loop is presented in Algorithm 4.1 which illustrates the
previous example of iterating a variable i from 1 to 10.
1 i ← 1 //Initialization statement
2 while (i ≤ 10) do
3 Perform some action
4 i ← (i + 1) //Iteration statement
5 end
Algorithm 4.1: Counter-Controlled While Loop
Prior to the while statement, the variable i is initialized to 1. This action is only
97
4. Loops
performed once and it is done so before the loop code. Then, before the loop code is
executed, the continuation condition is checked. Since i = 1 ≤ 10, the condition evaluates
to true and the loop code block is executed. The last line of the code block is the iteration
statement, where i is incremented by 1 and now has a value of 2. The code returns to
the top of the loop and again evaluates the continuation condition (which is still true as
i = 2 ≤ 10).
On the 10th iteration of the loop when i = 10, the loop will execute for the last time. At
the end of the loop, i is incremented to 11. The loop still returns to the top and the
continuation condition is still checked one last time. However, since i = 11 6≤ 10, the
condition is now false and the loop terminates. Regular sequential control flow returns
and the program continues executing whatever code is specified after the loop.
4.1.1. Example
In the previous example we knew that we wanted the loop to execute ten times. Though
you can use a while loop in counter-controlled situations, while loops are typically used
in scenarios when you may not know how many iterations you want the loop to execute
for. Instead of a straightforward iteration, the loop itself may update a variable in a
less-than-predictable manner.
As an example, consider the problem of normalizing a number as is typically done in
scientific notation. Given a number x (for simplicity, we’ll consider x ≥ 1), we divide
it by 10 until its value is in the interval [1, 10), keeping track of how many times we’ve
divided by 10. For example, if we have the number x = 32, 145.234, we would divide by
10 four times, resulting in 3.2145234 so that we could express it as
3.2145234 × 104
A simple realization of this process is presented in Algorithm 4.2. Rather than some
fixed number of iterations, the number of times the loop executes depends on how large
x is. For the example mentioned, it executes 4 times; for an input of x = 10, 000, 000 it
would execute 7 times. A while loop allows us to specify the repetition process without
98
4.2. For Loops
having to know up front how many times it will execute.
Input : A number x, x ≥ 0
Output : x normalized, k its exponent
1 k←0
2 while x > 10 do
3 x ← (x/10)
4 k ← (k + 1)
5 end
6 output x, k
Algorithm 4.2: Normalizing a Number With a While Loop
4.2. For Loops
A for loop is similar to a while loop but allows you to specify the three components on
the same line. In many cases, this results in a loop that is more readable; if the code
block in a while loop is long it may be difficult to see the initialization, continuation,
and iteration statements clearly. For loops are typically used to iterate over elements
stored in a collection such as an array (see Chapter 7). Usually the keyword for is used
to identify all three components. A general example is given in Algorithm 4.3.
1 for ( hinitializationi; hcontinuationi; hiterationi ) do
2 Perform some action
3 end
Algorithm 4.3: A General For Loop
Note the additional syntax: in many programming languages, semicolons are used at
the end of executable statements. Semicolons are also used to delimit each of the three
loop components in a for-loop (otherwise there may be some ambiguity as to where
each of the components begins and ends). However, the semicolons are typically only
placed after the initialization statement and continuation condition and are omitted after
the iteration statement. A more concrete example is given in Algorithm 4.4 which is
equivalent to the counter-controlled while loop we examined earlier.
Though all three components are written on the same line, the initialization statement
is only ever executed once; at the beginning of the loop. The continuation condition is
checked prior to each and every execution of the loop. Only if it evaluates to true does
the loop body execute. The iteration condition is performed at the end of each loop
iteration.
99
4. Loops
1 for ( i ← 1; i ≤ 10; i ← (i + 1) ) do
2 Perform some action
3 end
Algorithm 4.4: Counter-Controlled For Loop
4.2.1. Example
As a more concrete example, consider Algorithm 4.5 in which we do the same iteration
(i will take on the values 1, 2, 3, . . . , 10), but in each iteration we add the value of i for
that iteration to a running total, sum.
1 sum ← 0
2 for ( i ← 1; i ≤ 10; i ← (i + 1) ) do
3 sum ← (sum + i)
4 end
Algorithm 4.5: Summation of Numbers in a For Loop
Again, the initialization of i = 1 is only performed once. On the first iteration of the loop,
i = 1 and so sum will be given the value sum + i = 0 + 1 = 1 At the end of the loop, i will
be incremented and will have a value of 2. The continuation condition is still satisfied, so
once again the loop body executes and sum will be given the value sum + i = 1 + 2 = 3.
On the 10th (last) iteration, sum will have a value 1 + 2 + 3 + · · · + 9 = 45 and i = 10.
Thus sum + i = 45 + 10 = 55 after which i will be incremented to 11. The continuation
condition is still checked, but since 11 6≤ 10, the loop body will not be executed and the
loop will terminate, resulting in a final sum value of 55.
4.3. Do-While Loops
Yet another type of loop is the do-while loop. One major difference between this type
of loop and the others is that it is always executed at least once. The way that this is
achieved is that the continuation condition is checked at the end of the loop rather than
prior to is execution. The same counter-controlled example can be found in Algorithm
4.6.
In contrast to the previous examples, the loop body is executed on the first iteration
without checking the continuation condition. Only after the loop body, including the
incrementing of the iteration variable i is the continuation condition checked. If true, the
loop repeats at the beginning of the loop body.
100
4.3. Do-While Loops
1 i←1
2 do
3 Perform some action
4 i ← (i + 1)
5 while i ≤ 10
Algorithm 4.6: Counter-Controlled Do-While Loop
Initialization:
i ← 1
loop body
Iteration:
i ← (i + 1)
Continuation:
i ≤ 10? true
false
remaining
program
Figure 4.2.: A Do-While Loop Flow Chart. The continuation condition is checked after
the loop body.
Do-while loops are typically used in scenarios in which the first iteration is used to “setup”
the continuation condition (thus, it needs to be executed at least once). A common
example is if the loop body performs an operation that may result in an error code (or
flag) that is either true (an error occurred) or false (no error occurred).
From this perspective, a do-while loop can also be seen as a do-until loop: perform a
task until some condition is no longer satisfied. The subtle wording difference implies
101
4. Loops
1 do
2 Read some data
3 isError ← result of reading
4 while isError
Algorithm 4.7: Flag-Controlled Do-While Loop
that we’ll perform the action before checking to see if it should be performed again.
4.4. Foreach Loops
Many languages support a special type of loop for iterating over individual elements
in a collection (such as a set, list, or an array). In general, such loops are referred to
as foreach loops. These types of loops are essentially syntactic sugar: iterating over a
collection could be achieved with a for loop or a while loop, but foreach loops provide a
more convenient way to iterate over a collections. We will revisit these loops when we
examine arrays in Chapter 7. For now, we look at a simple example in Algorithm 4.8.
1 foreach element a in the collection A do
2 process the element a
3 end
Algorithm 4.8: Example Foreach Loop
How the elements are stored in the collection and how they are iterated over is not our
(primary) concern. We simply want to apply the same block of code to each element,
the foreach loop handles the details on how each element is iterated over. The syntax
also provides a way to refer to each element (the a variable in the algorithm). On each
iteration of the loop, the foreach loop updates the reference a to the next element in
the array. The loop terminates after it has iterated through each and every one of the
elements. In this way, a foreach loop simplifies the syntax: we don’t have to specify any
of the three components ourselves. As a more concrete example, consider iterating over
each student in a course roster. For each student, we wish to compute their grade and
then email them the results. The foreach loop allows us to do this without worrying
about the iteration details (see Algorithm 4.9).
102
4.5. Other Issues
1 foreach (student s in the class C) do
2 g ← compute a’s grade
3 send a an email informing them of their grade g
4 end
Algorithm 4.9: Foreach Loop Computing Grades
4.5. Other Issues
4.5.1. Nested Loops
Just as with conditional statements, we can nest loops within loops to perform more
complex processes. Though you can do this with any type of loop, we present a simple
example using for loops in Algorithm 4.10.
1 n ← 10
2 m ← 20
3 for (i ← 1; i ≤ m; i ← (i + 1)) do
4 for (j ← 1; j ≤ n; j ← (j + 1)) do
5 output (i, j)
6 end
7 end
Algorithm 4.10: Nested For Loops
The outer for loop executes a total of 20 times while the inner for loop executes 10
times. Since the inner for loop is nested inside the outer loop, the entire inner loop
executes all 10 iterations for each of the 20 iterations of the outer loop. Thus, in
total the inner most output operation executes 10 × 20 = 200 times. Specifically, it
outputs (1, 1), (1, 2), . . . , (1, 10), (2, 1), (2, 2), . . . , (2, 10), (3, 1), . . . , (20, 10). Nested loops
are commonly used when iterating over elements in two-dimensional arrays such as
tabular data or matrices. Nested loops can also be used to process all pairs in a collection
of elements.
4.5.2. Infinite Loops
Sometimes a simple mistake in the design of a loop can make it execute forever. For
example, if we accidentally iterate a variable in the wrong direction or write the opposite
103
4. Loops
termination/continuation condition. Such a loop is referred to as an infinite loop. As an
example, suppose we forgot the increment operation from a previous example.
1 sum ← 0
2 i←1
3 while i ≤ 10 do
4 sum ← (sum + i)
5 end
Algorithm 4.11: Infinite Loop
In Algorithm 4.11 we never make progress toward the terminating condition! Thus, the
loop will execute forever, i will continue to have the value 0 and since 0 ≤ 10, the loop
body will continue to execute. Care is needed in the design of your loops to ensure that
they make progress toward the termination condition.
Most of the time an infinite loop is not something you want and usually you must terminate
your buggy program externally (sometimes referred to as “killing” it). However, infinite
loops do have their uses. A poll loop is a loop that is intended to not terminate. At a
system level, for example, a computer may poll devices (such as input/output devices)
one-by-one to see if there is any active input/output request. Instead of terminating,
the poll loop simply repeats itself, returning back to the first device. As long as the
computer is in operation, we don’t want this process to stop. This can be viewed as an
infinite loop as it doesn’t have any termination condition.
The Zune Bug
Though proper testing and debugging should reduce the likelihood of such bugs, there
are several notable instances in which an infinite loop impacted real software. One
such instance was the Microsoft Zune bug. The Zune was a portable music player, a
competitor to the iPod. At about midnight on the night of December 31st, 2008, Zunes
everywhere failed to startup properly. A firmware clock driver designed by a 3rd party
company contained the following code.
2008 was a leap year, so the check on line 2 evaluated to true. However, though December
31st, 2008 was the 366th day of the year ( days = 366 ) the third line evaluated to false
and the loop was repeated without any of the program state being updated. The problem
was “fixed” 24 hours later when it was the 367th day and line 3 worked. The problem
was that line 3 should have been days >= 366) .
The failure was that this code was never tested on the “corner cases” that it was designed
for. No one thought to test the driver to see if it worked on the last day of a leap year.
104
4.5. Other Issues
1 while(days > 365) {
2 if(IsLeapYear(year)) {
3 if(days > 366) {
4 days -= 366;
5 year += 1;
6 }
7 } else {
8 days -= 365;
9 year += 1;
10 }
11 }
Code Sample 4.1.: Zune Bug
The code worked the vast majority of the time, but this illustrates the need for rigorous
testing.
4.5.3. Common Errors
When writing loops its important to use the proper syntax in the language in which you
are coding. Many languages use semicolons to terminate executable statements. However,
the while statements are not executable: they are part of the control structure of the
language and do not have semicolons at the end. A misplaced semicolon could be a
syntax error, or it could be syntactically correct but lead to incorrect results. A common
error is to place a semicolon at the end of a while statement as in
while(count <= 10); //WRONG!!!
In this example, the while loop binds to an empty executable statement and results in
an infinite loop!
Other common errors are the result of misidentifying either the initialization statement
or the continuation condition. Starting a counter at 1 instead of zero, or using a ≤
comparison instead of a < , etc. These can lead to a loop being off-by-one resulting in a
logic error.
Other errors are the result of using improper variable types. Recall that operations
involving floating-point numbers can have round off and precision errors, 13 + 13 + 13 may
not be equal to one for example. It is best to avoid using floating-point numbers or
comparisons in the control of your loops. Boolean and integer types are much less error
105
4. Loops
prone.
Finally, you must always ensure that your loops are making progress toward the termina-
tion condition. A failure to properly increment a counter can lead to incorrect results or
even an infinite loop.
4.5.4. Equivalency of Loops
It might not seem obvious at first, but in fact, any type of loop can be re-written as
another type of loop and perform equivalent operations. That is, any while loop can be
rewritten as an equivalent for loop. Any do-while loop can be rewritten as an equivalent
while loop!
So why do we have different types of loops? The short answer is that we want our
programming languages to be flexible. We could design a language in which every loop
had to be a while loop for example, but there are some situations in which it would be
more “natural” to write code with a for loop. By providing several options, programmers
have the choice of which type of loop to write.
In general, there are no “rules” as to which loop to apply to which situation. There
are general trends, best practices, and situations where it is more common to use one
loop rather than another, but in the end it does come down to personal choice and style.
Some software projects or organizations may have established guidelines or style guide
that establishes such guidelines in the interest of consistency and uniformity.
4.6. Problem Solving With Loops
Loops can be applied to any problem that requires repetition of some sort or to simplify
repeated code. When designing loops, it is important to identify the three components
by asking the questions:
• Where does the loop start? What variables or other state may need to be initialized
or setup prior to the beginning of the loop?
• What code needs to be repeated? How can it be generalized to depend on loop
control variables? This helps you to identify and write the loop body.
• When should the loop end? How many times do we want it to execute? This helps
you to identify the continuation and/or termination condition.
• How do we make progress toward the termination condition? What variable(s)
need to be incremented and how?
106
4.7. Examples
4.7. Examples
4.7.1. For vs While Loop
Let’s consider how to write a loop to compute the classic geometric series,
∞
1 X
= xk = 1 + x + x2 + x3 + · · ·
1 − x k=0
Obviously a computer cannot compute an infinite series as it is required to terminate in
a finite number of steps. Thus, we can approach this problem in a number of different
ways.
One way we could approximate the series is to compute it out to a fixed number of terms.
To do so, we could initialize a sum variable to zero, then iteratively compute and add
terms to the sum until we have computed n terms. To keep track of the terms, we can
define a counter variable, k as in the summation.
Following our strategy, we can identify the initialization: k should start at 0. The iteration
is also easy: k should be incremented by 1 each time. The continuation condition should
continue the loop until we have computed n terms. However, since k starts at 0, we
would want to continue while k < n. We would not want to continue the iteration when
k = n as that would make n + 1 iterations (again since k starts at 0). Further, since
we know the number of iterations we want to execute, a for loop is arguably the most
appropriate loop for this problem. Our solution is presented in Algorithm 4.12.
Input : x, n ≥ 0
1
Output : An approximated value of 1−x
using a geometric series
1 sum ← 0
2 for (k = 0; k < n; k ← (k + 1)) do
3 sum ← (sum + xk )
4 end
5 output sum
Algorithm 4.12: Computing the Geometric Series Using a For Loop
As an alternative, consider the following approach: instead of computing a predefined
number of terms, what if we computed terms until the difference between the value in the
previous iteration and the value in the current iteration is negligible, say less than some
small amount. We could stop our computation because any further iterations would
only affect the summation less and less. That is, the current value represents a “good
enough” approximation. That way, if someone wanted an even better approximation,
they could specify a smaller .
107
4. Loops
This approach will be more straightforward with a while loop since the continuation
condition will be more along the lines of “while the estimation is not yet good enough,
continue the summation.” This approach will also be easier if we keep track of both
a current and a previous value of the summation, then computing and checking the
difference will be easier.
Input : x, > 0
1 sumprev ← 0
2 sumcurr ← 1
3 k←1
4 while |sumprev − sumcurr | ≥ do
5 sumprev ← sumcurr
6 sumcurr ← (sumcurr + xk )
7 k ← (k + 1)
8 end
9 output sum
Algorithm 4.13: Computing the Geometric Series Using a While Loop
On lines 1–2 we initialize our values to ensure that the while loop will execute at least
once. In the continuation condition, we use the absolute value of the difference as the
series can oscillate between negative and positive values.
4.7.2. Primality Testing
An integer n > 1 is called prime if the only integers that divide it evently are 1 and itself.
Otherwise it is called composite. For example, 30 is composite as it is divisible by 2, 3,
and 5 among others. However, 31 is prime as it is only divisible by 1 and 31.
Consider the problem of determining whether or not a given integer n is prime or
composite, referred to as primality testing. A straightforward
√ way of determining this is
to simply try dividing by every integer 2 up to n: if any of these integers divides n,
then n is composite.
√ Otherwise, if none of them do, n is prime. Observe that we only
need to go up to n since√ any prime divisor greater than that will correspond to some
prime divisor less than n.
A simple for loop can be constructed to capture this idea. Our
√ initialization clearly starts
at i = 2, incrementing by 1 each time until i has exceeded n. This solution is presented
in Algorithm 4.14. Of course this is certainly not the most efficient way to solve this
problem, but we will not go into more advanced algorithms here.
Now consider this more general problem: given an integer m > 1, determine how many
108
4.7. Examples
Input : n > 1
√
1 for (i ← 2; i ≤ n; i ← (i + 1)) do
2 if i divides n then
3 output composite
4 end
5 end
6 output prime
Algorithm 4.14: Determining if a Number is Prime or Composite
prime numbers ≤ m there are. A key observation is that we’ve already solved part of
the problem: determining if a given number is prime in the previous exercise. To solve
this more general problem, we could reuse or adapt our previous solution. In particular,
we could surround the previous solution in an outer loop and iterate over integers from
2 up to m. The inner loop would then determine if the integer is prime and instead of
outputting a result, could increment a counter of the number of primes it has found so
far. This solution is presented in Algorithm 4.15.
Input : m > 1
1 numberOf P rimes ← 0
2 for (j = 2; j ≤ m; j ← (j + 1)) do
3 isP rime ← true
√
4 for (i ← 2; i ≤ j; i ← (i + 1)) do
5 if (i divides j) then
6 isP rime ← f alse
7 end
8 end
9 if (isP rime) then
10 numberOf P rimes ← (numberOf P rimes + 1)
11 end
12 end
13 output numberOf P rimes
Algorithm 4.15: Counting the number of primes.
4.7.3. Paying the Piper
Banks issue loans to customers as one lump sum called a principle P that the borrower
must pay back over a number of terms. Usually payments are made on a monthly basis.
109
4. Loops
Further, banks charge an amount of interest on a loan measured as an Annual Percentage
Rate (APR). Given these conditions, the borrower makes monthly payments determined
by the following formula.
iP
monthlyP ayment =
1 − (1 + i)−n
apr
Where i = 12
is the monthly interest rate, and n is the number of terms (in months).
For simplicity, suppose we borrow P = $1, 000 at 5% interest (apr = 0.05) to be paid
back over a term of 2 years (n = 24). Our monthly payment would (rounded) be
.05
12
· 1000
monthlyP ayment = = $43.87
1 − (1 + .05
12
)−24
When the borrower makes the first month’s payment, some of it goes to interest, some of
it goes to paying down the balance. Specifically, one month’s interest on $1,000 is
0.05
$1, 000 · = $4.17
12
and so $43.87 − $4.17 = $39.70 goes to the balance, making the new balance $960.30.
The next month, this new balance is used to compute the new interest payment,
0.05
$960.30 · = $4.00
12
And so on until the balance is fully paid. This process is known as loan amortization.
Let’s write a program that will calculate a loan amortization schedule given the inputs as
described above. To start, we’ll need to compute the monthly payment using the formula
above and for that we’ll need a monthly interest rate. The balance will be updated
month-to-month, so we’ll use another variable to represent the balance. Finally, we’ll
want to track the current month in the loan schedule process.
Once we have these variables setup, we can start a loop that will repeat once for each
month in the loan schedule. We could do this using either type of loop, but for this
exercise, let’s use a while loop. Using our month variable, we’ll start by initializing it to
1 and run the loop through the last month, n.
On each iteration we compute that month’s interest and principle payments as above,
update the balance, and also be sure to update our month counter variable to ensure
we’re making progress toward the termination condition. On each iteration we’ll also
output each of these variables to the user. The full program can be found in Algorithm
4.16.
If we were to actually implement this we’d need to be more careful. This outlines the basic
process, but keep in mind that US dollars are only accurate to cents. A monthly payment
110
4.8. Exercises
can’t be $43.871 cents. We’ll need to take care to round properly. This introduces another
issue: by rounding the final month’s payment may not match the expected monthly
payment (we may over or under pay in the final month). An actual implementation may
need to handle the final month’s payment separately with different logic and operations
than are outside the loop.
Input : A principle, P , a number of terms, n, an APR, apr
Output : A loan amortization schedule
1 balance ← P //The initial balance is the principle
2 i ← apr
12
//monthly interest rate
iP
3 monthlyP ayment ← 1−(1+i)−n
4 month ← 1 //A month counter
5 while (month ≤ n) do
6 monthInterest ← i · balance
7 monthP rinciple ← monthlyP ayment − monthInterest
8 balance ← balance − monthP rinciple
9 month = (month + 1)
10 output month, monthInterest, monthP rinciple, balance
11 end
Algorithm 4.16: Computing a loan amortization schedule
4.8. Exercises
Exercise 4.1. Write a for-loop and a while-loop that accomplishes each of the following.
(a) Prints all integers 1 thru 100 on the same line delimited by a single space
(b) Prints all even integers 0 up to n in reverse order
(c) A list of integers divisible by 3 between a and b where a, b are parameters or inputs
(d) Prints all positive powers of two up to 230 : 1, 2, 4, . . . , 1073741824 one value per
line (try computing up to 231 and 232 and discern reasons for why it may fail)
(e) Prints all even integers 2 thru 200 on 10 different lines (10 numbers on each line)
in reverse order
(f) Prints the following pattern of numbers (hint: use two nested loops; the result can
be computed using some value of i + 10j)
111
4. Loops
11 21 31 41 51 61 71 81 91 101
12 22 32 42 52 62 72 82 92 102
13 23 33 43 53 63 73 83 93 103
14 24 34 44 54 64 74 84 94 104
15 25 35 45 55 65 75 85 95 105
16 26 36 46 56 66 76 86 96 106
17 27 37 47 57 67 77 87 97 107
18 28 38 48 58 68 78 88 98 108
19 29 39 49 59 69 79 89 99 109
20 30 40 50 60 70 80 90 100 110
Exercise 4.2. Civil engineers have come up with two different models on how a city’s
population will grow over the next several years. The first projection assumes a 10%
annual growth rate while the second projection assumes a linear growth rate of 50,000
additional citizens per year. Write a program to project the population growth under
both models. Take, as input, the initial population of the city along with a number of
years to project the population.
In addition, compute how many years it would take to double the population under each
model.
Exercise 4.3. Write a loan program similar to the amortization schedule program we
developed in Section 4.7.3. However, give the user an option to specify an extra monthly
payment amount in order to pay off the loan early. Calculate how much quicker the loan
gets paid off and how much they save in interest.
Exercise 4.4. The rate of decay of a radioactive isotope is given in terms of its half-life
H, the time lapse required for the isotope to decay to one-half of its original mass.
For example, the isotope Strontium-90 (90 Sr) has a half-life of 28.9 years. If we start
with 10kg of Strontium-90 then 28.9 years later you would expect to have only 5kg of
Strontium-90 (and 5kg of Yttrium-90 and Zirconium-90, isotopes which Strontium-90
decays into).
Write a program that takes the following input:
• Atomic Number (integer)
• Element Name
• Element Symbol
• H (half-life of the element)
• m, an initial mass in grams
112
4.8. Exercises
Your program will then produce a table detailing the amount of the element that remains
after each year until less than 50% of the original amount remains. This amount can be
computed using the following formula:
(y/H)
1
r =m×
2
y is the number of years elapsed, and H is the half-life of the isotope in years.
For example, using your program on Strontium-90 (symbol: Sr, atomic number: 38)
with a half-life of 28.9 years and an initial amount of 10 grams would produce a table
something like the following.
Strontium-90 (38-Sr)
Elapsed Years Amount
-------------------------
- 10g
1 9.76g
2 9.53g
3 9.30g
...
28 5.11g
29 4.99g
Exercise 4.5. Write a program that computes various statistics on a collection of
numbers that can be read in from the command line, as command line arguments, or via
other means. In particular, given n numbers,
x1 , x2 , . . . , xn
your program should compute the following statistics:
• The minimum number
• The maximum number
• The mean,
n
1X
µ= xi
n i=1
• The variance,
n
2 1X
σ = (xi − µ)2
n i=1
113
4. Loops
• And the standard deviation,
v
u n
u1 X
σ=t (xi − µ)2
n i=1
where n is the number of numbers that was provided. For example, with the numbers,
3.14, 2.71, 42, 3, 13
your output should look something like:
Minimum: 2.71
Maximum: 42.00
Mean: 12.77
Variance: 228.77
Standard
Deviation: 15.13
Exercise 4.6. The ancient Greek mathematician Euclid developed a method for finding
the greatest common divisor of two positive integers, a and b. His method is as follows:
1. If the remainder of a/b is 0 then b is the greatest common divisor.
2. If it is not 0, then find the remainder r of a/b and assign b to a and the remainder
r to b.
3. Return to step (1) and repeat the process.
Write a program that uses a function to perform this procedure. Display the two integers
and the greatest common divisor.
Exercise 4.7. Write a program to estimate the value of e ≈ 2.718281 . . . using the series:
∞
X 1
e=
k=0
k!
Obviously, you will need to restrict the summation to a finite number of n terms.
Exercise 4.8. The value of π can be expressed by the following infinite series:
1 1 1 1 1 1
π =4· 1− + − + − + − ···
3 5 7 9 11 13
114
4.8. Exercises
An approximation can be made by taking the first n terms of the series. For n = 4, the
approximation is
1 1 1
π ≈4· 1− + − = 2.8952
3 5 7
Write a program that takes n as input and outputs an approximation of π according to
the series above.
Exercise 4.9. The sine function can be approximated using the following Taylor series.
∞
X (−1)i 2i+1 x3 x5
sin (x) = x =x− + − ···
i=0
(2i + 1)! 3! 5!
Write a function that takes x and n as inputs and approximates sin x by computing the
first n terms in the series above.
Exercise 4.10. One way to compute π is to use Machin’s formula:
π 1 1
= 4 arctan − arctan
4 5 239
To compute the arctan function, you could use the following series:
∞
x x 3 x5 x7 X (−1)i
arctan x = − + − + ··· = x2i+1
1 3 5 7 i=0
2k + 1
Write a program to estimate π using these formulas but allowing the user to specify how
many terms to use in the series to compute it. Compare the estimate with the built-in
definition of π in your language.
Exercise 4.11. The arithmetic-geometric mean of two numbers x, y, denoted M (x, y) (or
√
agm(x, y)) can be computed iteratively as follows. Initially, a1 = 12 (x + y) and g1 = xy
(i.e. the normal arithmetic and geometric means). Then, compute
an+1 = 21 (an + gn )
√
gn+1 = an g n
The two sequences will converge to the same number which is the arithmetic-geometric
mean of x, y. Obviously we cannot compute an infinite sequence, so we compute until
|an − gn | < for some small number .
Exercise 4.12. The integral of a function is a measure of the area under its curve. One
numerical method for computing the integral of a function f (x) on an interval [a, b] is
the rectangle rule. Specifically, an interval [a, b] is split up into n equal subintervals of
size h = b−a
n
. Then the integral is approximated by computing:
Z b n−1
X
f (x)dx ≈ f (a + ih) · h
a i=0
115
4. Loops
Write a program to approximate an integral using the rectangle method. For this
particular exercise you will integrate the function
sin x
f (x) =
x
For reference, the function is depicted in Figure 4.3. Write a program that will read the
end points a, b and the number of subintervals n and computes the integral of f using
the rectangle method. It should then output the approximation.
sin x
Figure 4.3.: Plot of f (x) = x
Exercise 4.13. Another way to compute an integral is to a technique called Monte
Carlo Integration, a randomized numerical integration method.
Given the interval [a, b], we enclose the function in a region of interest with a rectangle
of a known area Ar . We then randomly select n points within the rectangle and count
the number of random points that are within the function’s curve. If m of the n points
are within the curve, we can estimate the integral to be
Z b
m
f (x) dx ≈ Ar
a n
Consider again the function f (x) = sin(x)
x
. Note that the global maximum and minimum
of this function are 1 and ≈ −0.2172 respectively. Therefore, we can also restrict the
rectangle along the y-axis from −.25 to 1. That is, the lower left of the rectangle will be
(a, −.25) and the upper right will be (b, 1) for a known area of
Ar = |a − b| × 1.25
Figure 4.4 illustrates the rectangle for the interval [−5, 5].
Write a program that will takes as input interval values a, b, and an integer n and perform
a Monte Carlo estimate of the integral of the function above. Realize that this is just an
approximation and it is randomized so your answers may not match exactly and may be
different on various executions of your program. Take care that you handle points within
the curve but under the x-axis correctly.
116
4.8. Exercises
Figure 4.4.: A rectangle for the interval [−5, 5].
Exercise 4.14. Consider a ball trapped in a 2-D box. Suppose that it has an initial
position (x, y) within the box (the box’s dimensions are specified by its lower left (x` , y` )
and an upper right (xr , yr ) points) along with an initial angle of travel θ in the range
[0, 2π). As the ball travels in this direction it will eventually collide with one of the sides
of the box and bounce off. For this model, we will assume no loss of velocity (it keeps
going) and its angle of reflection is perfect.
Write a program that takes as input, x, y, θ, x` , y` , xr , yr , and an integer n and computes
the first n − 1 Euclidean points on the box’s perimeter that the ball bounces off of in its
travel (include the initial point in your printout for a total of n points). You may assume
that the input will always be “good” (the ball will always begin somewhere inside the
box and the lower left and upper right points will not be reversed).
As an example, consider the inputs:
x = 1, y = 1, θ = .392699, x` = 0, y` = 0, xr = 4, yr = 3, n = 20
Starting at (1, 1), the ball travels up and to the right bouncing off the right wall. Figure
4.5 illustrates this and the subsequent bounces back and forth.
Your output should simply be the points and should look something like the following.
(1.000000, 1.000000)
(4.000000, 2.242640)
(2.171572, 3.000000)
(0.000000, 2.100506)
(4.000000, 0.443652)
(2.928929, 0.000000)
(0.000000, 1.213202)
(4.000000, 2.870056)
(3.686287, 3.000000)
(0.000000, 1.473090)
117
4. Loops
y
(1.284, 3)
(1, 1)
x
Figure 4.5.: Follow the bouncing ball
(3.556355, 0.000000)
(4.000000, 0.183764)
(0.000000, 1.840617)
(2.798998, 3.000000)
(4.000000, 2.502529)
(0.000000, 0.845675)
(2.041640, 0.000000)
(4.000000, 0.811179)
(0.000000, 2.468033)
(1.284282, 3.000000)
Exercise 4.15. An integer n ≥ 2 is prime if its only divisors are 1 and itself, n. For
example, 2, 3, 5, 7, 11, . . . are primes. Write a program that outputs all prime numbers 2
up to m where m is read as input.
Exercise 4.16. An integer n ≥ 2 is prime if the only integers that evenly divide it are 1
and n itself, otherwise it is composite. The prime factorization of an integer is a list of
its prime divisors along with their multiplicities. For example, the prime decomposition
of 188, 760 is:
188, 760 = 2 · 2 · 2 · 3 · 5 · 11 · 11 · 13
Write a program that takes an integer n as input and outputs the prime factorization of
n. If n is invalid, an appropriate error message should be displayed instead. Your output
should look something like the following.
118
4.8. Exercises
1001 = 7 * 11 * 13
Exercise 4.17. One way of estimating π is to randomly sample points within a 2 × 2
square centered at the origin. If the distance between the randomly chosen point (x, y)
and the origin is less than or equal to 1, then the point lies inside the unit circle centered
at the origin and we count it. If the point lies outside the circle then we can ignore it. If
y
x
Figure 4.6.: Sampling points in a circle
we sample n points and m of them lie within the circle, then π can be estimated as
4m
π≈
n
Given a point (x, y), its distance from the origin is simply
p
x2 + y 2
This idea is illustrated in Figure 4.6. Example code is given to randomly generate
numbers within a bound. Write a program that takes an integer n as input and randomly
samples n points within the 2 × 2 square and outputs an approximation of π.
Of course, you’ll need a way to generate random numbers within the range [−1, 1]. Since
you are using some randomization, the result is just an approximation and may not
match exactly or even be the same between two different runs of your program.
119
4. Loops
Figure 4.7.: Regular polygons
Exercise 4.18. A regular polygon is a polygon that is equiangular. That is, it has n
sides and n points whose angle from the center are all equal in measure. Examples for
n = 3 through n = 8 can be found in Figure 4.7.
Write a program that takes n and a radius r as inputs and computes the points of a
regular n-sided polygon centered at the origin (0, 0). Each point should be distance r
from the origin and the first point should lie on the positive x-axis. Each subsequent
point should be at an angle θ equal to 2π
n
from the previous point. Recall that given the
polar coordinates θ, r we can convert to cartesian coordinates (x, y) using the following.
x = r · cos θ
y = r · sin θ
Your program should be robust enough to check for invalid inputs. If invalid, an error
message should be printed and the program should exit.
For example, running your program with n = 5, r = 6 should produce the points of a
pentagon with “radius” 6. The output should look something like:
Regular 5-sided polygon with radius 6.0:
(6.0000, 0.0000)
(1.8541, 5.7063)
(-4.8541, 3.5267)
(-4.8541, -3.5267)
(1.8541, -5.7063)
Exercise 4.19. Let p1 = (x1 , y1 ) and p2 = (x2 , y2 ) be two points in the cartesian plane
which define a line segment. Suppose we travel along this line starting at p1 taking n
steps that are an equal distance apart until we reach p2 . We wish to know which points
correspond to each of these steps and which step along this path is closest to anther
point p3 = (x3 , y3 ). Recall that the distance between two points can be computed using
the Euclidean distance formula:
p
δ = (x1 − x2 )2 + (y1 − y2 )2
Write a program that takes three points and an integer n as inputs and outputs a sequence
of points along the line defined by p1 , p2 that are distance nδ apart from each other. It
120
4.8. Exercises
should also indicate which of these computed points is the closest to the third point.
For example, the execution of your program with inputs 0, 2, −5.5, 7.75, −2, 3, 10 should
produce output that looks something like:
(0.00, 2.00) to (-5.50, 7.75) distance: 7.9569
(0.00, 2.00)
(-0.55, 2.58)
(-1.10, 3.15)
(-1.65, 3.72) <-- Closest point to (-2, 3)
(-2.20, 4.30)
(-2.75, 4.88)
(-3.30, 5.45)
(-3.85, 6.02)
(-4.40, 6.60)
(-4.95, 7.17)
(-5.50, 7.75)
Exercise 4.20. The natural log of a number x is usually computed using some numerical
approximation method. One such method is to use the following Taylor series.
(x − 1)2 (x − 1)3 (x − 1)4
ln x = (x − 1) − + − + ···
2 3 4
However, this only works for |x − 1| ≤ 1 (except for x = 0) and diverges otherwise. For
x such that |x| > 1, we can use the series
y 1 1 1
ln = + 2 + 3 + ···
y−1 y 2y 3y
x
where y = x−1 . Of course such an infinite computation cannot be performed by a
computer. Instead, we approximate ln x by computing the series out to a finite number
of terms, n. Your program should print an error message and exit for x ≤ 0; otherwise it
should use the first series for 0 < x ≤ 1 and the second for x > 1.
Another series that has better convergence properties and works for any range of x is as
follows
1+y 1 2 1 4 1 6
ln x = ln = 2y 1 + y + y + y · · ·
1−y 3 5 7
(x−1)
where y = (x+1)
.
You will write a program that approximates ln x using these two methods computed to n
terms. You will also compute the error of each method by comparing the approximated
value to the standard math library’s log function.
121
4. Loops
Your program should accept x and n as inputs. It should be robust enough to reject
any invalid inputs (ln x is not defined for x = 0 you may also print an error for any
negative value; n must be at least one). It will then compute an approximation using
both methods and print the relative error of each method.
For example, the execution of your program with inputs 3.1415, 6 should produce output
that looks something like:
Taylor Series: ln(3.1415) ~= 1.11976
Error: 0.02494
Other Series: ln(3.1415) ~= 1.14466
Error: 0.00004
Exercise 4.21. There are many different numerical methods to compute the square root
of a number. In this exercise, you will implement several of these methods.
(a) The Exponential Identity Method involves the following identity:
√ 1
x = e 2 ln (x)
Which assumes the use of built-in (or math-library) functions for e and the natural
log, ln.
(b) The Babylonian Method involves iteratively computing the following recurrence:
1 x
ai = ai−1 +
2 ai−1
where a1 = 1.0. Computation is repeated until |ai − ai−1 | ≤ δ where δ is some
small constant value.
(c) A method developed for one of the first electronic computers (EDSAC [29]) involves
the following iteration. Let a0 = x, c0 = x − 1. Then compute
ai+1 = ai − ai2ci
c2 (c −3)
ci+1 = i 4i
The iteration is performed for as many iterations as specified (n), or until the
change
√ in a is negligible. The resulting value for a is used as an approximation for
x ≈ a. However, this method only works for values of x such that 0 < x < 3. We
can easily overcome this by scaling x by some power of 4 so that the scaled value
of x satisfies 12 ≤ x < 2. After applying the method we can then scale back up by
√
the appropriate value of 2 (since 4 = 2). Algorithm 4.17 describes how to scale x.
122
4.8. Exercises
Write a program to compute the square root of an input number using these methods
and compare your results.
1 power ← 0
2 while x < 12 do
//Scale up
3 x ← (x · 4)
4 power ← (power − 1)
5 end
6 while x ≥ 2 do
//Scale down
7 x ← x4
8 power ← (power + 1)
9 end
Algorithm 4.17: Scaling a value x so that it satisfies 12 ≤ x < 2. After execution,
power indicates what power of 2 the value x was scaled by.
Exercise 4.22. There are many different numerical methods to compute the natural
logarithm of a number, ln x. In this exercise, you will implement several of these methods.
(a) A formula version approximates the natural logarithm as:
π
ln(x) ≈ − m ln(2)
2M (1, 4/s)
Where M (a, b) is the arithmetic-geometric mean and s = x2m . In this formula, m
is a parameter (a larger m provides more precision).
(b) The standard Taylor Series for the natural logarithm is:
∞
X (−1)n+1
ln(x) = (x − 1)n
n=1
n
As we cannot compute an infinite series, we will simply compute the series to the
first m terms. Also note that this series is not convergent for values x > 1
(c) Borchardt’s algorithm is an iterative method that works as follows. Let
1+x √
a0 = b0 = x
2
Then repeat:
ak +bk
ak+1 = p 2
bk+1 = ak+1 bk
123
4. Loops
until the absolute difference between ak , bk is small; that is |ak − bk | < . Then the
logarithm is approximated as
x−1
ln(x) ≈ 2
ak + b k
(d) Newton’s method works if x is sufficiently close to 1. It works by setting y0 = 1
and then computing
x − e yn
yn+1 = yn + 2
x + e yn
The iteration is performed m times.
To ensure that some of the methods above work, you may need to scale the number x to
be as close as possible to 1. One way to do this is to divide or multiply by e until x is
close to 1. Suppose we divided by e k times; that is x = z · ek where z is close to 1. Then
ln(x) = ln(z · ek ) = ln(z) + ln(ek ) = ln(z) + k
Thus, we can apply the methods above to Newton’s method to z and add k to the result
to get ln(x). A similar trick can be used to ensure that the Taylor Series method is
convergent.
Exercise 4.23. Write a program that takes a positive integer n as a command line
argument and outputs a list of all pairs of integers x, y such that 1 ≤ x, y ≤ n whose
sum, x + y is prime. For example, if n = 5, the output should look something like the
following.
1 + 2 = 3 is prime
1 + 4 = 5 is prime
2 + 3 = 5 is prime
2 + 5 = 7 is prime
3 + 4 = 7 is prime
Exercise 4.24. Consider the following variation on the classical “FizzBuzz” challenge.
Write a program that will print out numbers 1 through n where n is provided as a
command line argument. However, if the number is a perfect square (that is, the square
of some integer; for example 1 = 12 , 4 = 22 , 9 = 32 , etc.) print “Go Huskers” instead. If
the number is a prime (2, 3, 5, 7, etc.) print “Go Cubs” instead.
Exercise 4.25. Implement a program to solve the classic “Rainfall Problem” (which
has been used in CS education studies to assess programming knowledge and skills).
Write an interactive program that repeatedly prompts the user to enter an integer (which
124
4.8. Exercises
represents the amount of rainfall on a particular day) until it reads the integer 99999.
After 99999 is entered, it should print out the correct average. That is, it should not count
the final 99999. Negative values should also be ignored. For example, if the user entered
the sequence 4 0 -1 10 99999 the output should look something like the following.
Average rainfall: 4.66
Exercise 4.26. Write a program that takes an integer n and a subsequent list of integers
as command line arguments and determines which number(s) between 1 and n are
missing from the list. For example, if the following numbers are given to the program:
10 5 2 3 9 2 8 8 your output should look something like:
Missing numbers 1 thru 10:
1, 4, 6, 7, 10
Exercise 4.27. Write a program that takes a list of pairs of numbers representing
latitudes/longitudes (on the scale [−180, 180] (negative values correspond to the southern
and western hemispheres). Then, starting with the first pair, calculate the intermediate
air distances between each location as well as a final total distance.
To compute air distance from location A to a location B, use the Spherical Law of
Cosines:
d = arccos (sin(ϕ1 ) sin(ϕ2 ) + cos(ϕ1 ) cos(ϕ2 ) cos(∆)) · R
where
• ϕ1 is the latitude of location A, ϕ2 is the latitude of location B
• ∆ is the difference between location B’s longitude and location A’s longitude
• R is the (average) radius of the earth, 6,371 kilometers
Note: the formula above assumes that latitude and longitude are measured in radians r,
−π ≤ r ≤ π. To convert from degrees deg (−180 ≤ deg ≤ 180) to radians r, you can use
the simple formula:
deg
r= π
180
For example, if the command line arguments were
40.8206 -96.756 41.8806 -87.6742 41.9483 -87.6556 28.0222 -81.7329
125
4. Loops
your output should look something like:
(40.8206, -96.7560) to (41.8806, -87.6742): 766.8053km
(41.8806, -87.6742) to (41.9483, -87.6556): 7.6836km
(41.9483, -87.6556) to (28.0222, -81.7329): 1638.7151km
Total Distance: 2413.2040
Exercise 4.28. A DNA sequence is made up of a sequence of four nucleotide bases, A,
C, G, T (adenine, cytosine, guanine, thymine). One particularly interesting statistic of a
DNA sequence is finding a CG island : a subsequence that contains the highest frequency
of guanine and cytosine.
For simplicity, we will be interested in subsequences of a particular length, n that will be
provided as part of the input.
Write a program that takes, as command line arguments, an integer n and a DNA
sequence. The program should then find all subsequences of the given DNA string of
length n with the maximal frequency of C and G in it. For example, if the DNA sequence
is
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGC
and the “window” size that we’re interested in is n = 5 then you would scan the sequence
and find every subsequence with the maximum number of C or G bases. Your output
should include all CG Islands (by indices) in the sequence similar to the following.
n = 5
highest frequency: 5 / 5 = 100.00%
CG Islands:
15 thru 20: CCCCC
16 thru 21: CCCCG
17 thru 22: CCCGG
18 thru 23: CCGGC
19 thru 24: CGGCC
42 thru 47: CCGGG
43 thru 48: CGGGG
44 thru 49: GGGGC
45 thru 50: GGGCC
126
4.8. Exercises
Exercise 4.29. Write a program that will assist people in saving for retirement using a
tax-deferred 401k program.
Your program will read the following inputs as command line arguments.
• An initial starting balance
• A monthly contribution amount (we’ll assume its the same over the life of the
savings plan)
• An (average) annual rate of return (on the scale [0, 1])
• An (average) annual rate of inflation (on the scale [0, 1])
• A number of years until retirement
Your program will then compute a monthly savings table detailing the (inflation-adjusted)
interest earned each month, contribution, and new balance. The inflation-adjusted rate
of return can be computed with the following formula.
1 + rate of return
−1
1 + inflation rate
To get the monthly rate, simply divide by 12. Each month, interest is applied to the
balance at this rate (prior to the monthly deposit) and the monthly contribution is added.
Thus, the earnings compound month to month.
Be sure that your program handles bad inputs as well as it can. It should also round to
the nearest cent for every figure. Finally, as of 2014, annual 401k contributions cannot
exceed $17,500. If the user’s proposed savings schedule violates this limit, display an
error message instead of the savings table.
For inputs 10000 500 0.09 0.012 10 your output should look something like the
following:
Month Interest Balance
1 $ 64.23 $ 10564.23
2 $ 67.85 $ 11132.08
3 $ 71.50 $ 11703.58
4 $ 75.17 $ 12278.75
5 $ 78.87 $ 12857.62
6 $ 82.58 $ 13440.20
7 $ 86.33 $ 14026.53
8 $ 90.09 $ 14616.62
9 $ 93.88 $ 15210.50
127
4. Loops
...
116 $ 678.19 $ 106767.24
117 $ 685.76 $ 107953.00
118 $ 693.37 $ 109146.37
119 $ 701.04 $ 110347.41
120 $ 708.75 $ 111556.16
Total Interest Earned: $ 41556.16
Total Nest Egg: $ 111556.16
Exercise 4.30. An affine cipher is an encryption scheme that encrypts messages using
the following function:
ek (x) = (ax + b) mod n
Where n is some integer and 0 ≤ a, b, x ≤ n − 1. That is, we fix n, which will be used to
encode an alphabet as in Table 4.1.
x character
0 (space)
1 A
2 B
3 C
.. ..
. .
25 Y
26 Z
27 .
28 !
Table 4.1.: Character Mapping for n = 29
Then we choose integers a, b to define the encryption function. Suppose a = 10, b = 13,
then
ek (x) = (10x + 13) mod 29
So to encrypt “HELLO!” we would encode it as 8, 5, 12, 12, 15, 27, then encrypt them,
ek (8) = (10 · 8 + 13) mod 29 = 6
ek (5) = (10 · 5 + 13) mod 29 = 5
ek (12) = (10 · 12 + 13) mod 29 = 17
ek (12) = (10 · 12 + 13) mod 29 = 17
ek (15) = (10 · 15 + 13) mod 29 = 18
128
4.8. Exercises
ek (28) = (10 · 28 + 13) mod 29 = 3
Which, when mapped back to characters using our encoding is “FEQQRC.”
To decrypt a message we need to invert the decryption function, that is,
dk (y) = a−1 · (y − b) mod n
where a−1 is the inverse of a modulo n. The inverse of an integer a is the value such that
(a · a−1 ) mod n = 1
so for a = 10, n = 29, the inverse, 10−1 mod 29 = 3 since 3 · 10 mod 29 = 1. Given a and
n, how can we find an inverse, a−1 ? Obviously it cannot be zero, nor can it be 1 (1 is its
own inverse). There is a simple algorithm (the Extended Euclidean Algorithm) that can
solve this problem, but n = 29 is small enough that a brute-force strategy of testing all
possibilities will suffice.
Write a program that takes a, b and an encrypted message as command line arguments
and decrypts the message. Your program should print the decrypted message and other
cipher information to the standard output. For example:
a = 10
b = 13
a^-1 = 3
Encrypted Message: FEQQRC
Decrypted Message: HELLO!
Exercise 4.31. A centroid (or barycenter) of a plane figure is the arithmetic mean of all
the points in the shape. The centroid of a non-self-intersecting closed polygon defined by
n vertices (x0 , y0 ), (x1 , y1 ), . . . , (xn1 , yn−1 ) is the point (Cx , Cy ) which can be computed
using:
n−1
1 X
Cx = (xi + xi+1 )(xi yi+1 − xi+1 yi )
6A i=0
n−1
1 X
Cy = (yi + yi+1 )(xi yi+1 − xi+1 yi )
6A i=0
with A being the polygon’s signed area:
129
4. Loops
(2, 3.6)
(2.468, 1.902)
(4.25, 2.1)
(1, 1.5)
(3.7, 1.5)
(2.25, 0.25)
Figure 4.8.: A polygon and its centroid. Whoo!
n−1
1X
A= (xi yi+1 − xi+1 yi )
2 i=0
In these formulas, the vertices are assumed to be numbered in order of their occurrence
along the polygon’s perimeter. Furthermore, the vertex (xn , yn ) = (x0 , y0 ).
Write a program that takes n pairs of x-y coordinates as command line arguments that
represent a polygon and computes its centroid. For example, the an input such as
1 1.5 2 3.6 4.25 2.1 3.7 1.5 2.25 0.25
would correspond to the polygon in Figure 4.8 with a centroid of (2.46, 1.90). The output
should look something like the following.
Centroid: (2.468405, 1.902874)
Exercise 4.32. Suppose we are given a set of n points (x0 , y0 ), (x1 , y1 ), . . . , (xn1 , yn−1 )
in the plane. Write a program that outputs instructions for someone to “walk” to each
point in the order that they are given starting at the origin by only going in the cardinal
directions (not “as the bird flies”). For example, if the following input is given,
3 5 2 7 9 5
Then the output should look like the following.
Go north 5.00 units
Go east 3.00 units
Go north 2.00 units
130
4.8. Exercises
Go west 1.00 units
Go south 2.00 units
Go east 7.00 units
Exercise 4.33. A histogram is a graphical representation of the distribution of numerical
data. Typically, a histogram is represented as a (vertical) bar graph. However, we’ll limit
our attention to graphing a horizontal ASCII histogram.
In particular, write a program that takes a sequence of numerical values representing
grades (on a 0–100 scale; reject any invalid values). The program will then display
a horizontal graph of the distribution of these values over 6 fixed ranges that looks
something like the following.
0 - 49 (2, 11.11%) ******
50 - 59 (1, 5.56%) ***
60 - 69 (1, 5.56%) ***
70 - 79 (5, 27.78%) **************
80 - 89 (4, 22.22%) ************
90 - 100 (5, 27.78%) **************
In the diagram, each star, * represents (at least) 2%
Exercise 4.34. Shannon entropy is a measure of information in a piece of data; specifi-
cally it is the expected value (average) of the information the data contains. A higher
entropy value corresponds to more random data while 0 indicates highly structured data.
Entropy is calculated using the following formula.
n
X
H(X) = − p(xi ) · log2 p(xi )
i=1
where x1 , x2 , . . . , xn are the distinct symbols in the data sequence X and p(xi ) is the
probability of the xi -th symbol. If the length of X is n, then this is simply
c(xi )
p(xi ) =
n
where c(xi ) is a count of the number of times xi appears in X. For example, the string
“Hello World” has 8 distinct symbols with the probability of “l” being .2727, “o” being
.1818 and the remaining being .0909. Thus the entropy would be
H(’Hello World’) = 2.845351
131
4. Loops
Write a program that takes a string as command line input (which may contain spaces)
and computes its entropy.
132
5. Functions
In mathematics, a function is a mapping from a set of inputs to a set of outputs such
that each input is mapped to exactly one output. For example, the function
f (x) = x2
maps numeric values to their squares. The input is a variable x. When we assign an
actual value to x and evaluate the function, then the function has a value, its output. For
example, setting x = 2 as input, the output would be 22 = 4. Mathematical functions
can have multiple inputs,
f (x, y) = x2 + y 2 f (x, y, z) = 2x + 3y − 4z
However, a function will only ever have a single output value.
In programming languages, a function (sometimes called subroutine or procedure) can
take multiple inputs and produce one output value. We’ve already seen some examples
of these functions. For example, most languages provide a math library that you can
use to evaluate the square root or sine of a value x. We’ve also seen some functions
with multiple input values such as the “power” function that allows you to compute
f (x, y) = xy . Finally, the main entry point to many programs is defined by a main
function.
More formally, a function is a sequence of instructions (code) that is packaged into a
unit that can be reused. A function performs a specific task: given a number of inputs,
it executes some sequence of operations (executes some code) and “returns” (outputs) a
result. The output can be captured into a variable or used in an expression by whatever
code invoked or “called” the function.
Defining and using functions in programming has numerous advantages. The most
obvious advantage is that it allows you a way to organize code. By separating a program
it into distinct units of code it is more organized and it is clearer what each piece or
segment of code does. This also facilitates top-down design: one way to approach a
problem is to split it up into a series of subproblems until each subproblem is either
trivial to deal with, or an existing, “off-the-shelf” solution already exists for it. Functions
may serve as the logical unit for each subproblem.
Another advantage is that by organizing code into functions, those functions can be reused
in multiple places either in your program/project or even in other programs/projects.
133
5. Functions
A prime example of this are the standard libraries available in most programming
languages that provide functions to perform standard input/output or mathematical
functions. These standard libraries provide functions that are used by thousands of
different programs across multiple different platforms.
Functions also form an isolated unit of code. This allows for better and easier testing.
By isolating pieces of code, we can rigorously test those pieces of code by themselves
without worrying about the larger program or contexts.
Functions facilitates procedural abstraction. Placing code into functions allows you to
abstract the details of how the function computes its answer. As an example: consider
a standard math library’s square root function: it may use some interpolation method,
a Taylor series, or some other method entirely to compute the square root of a given
number. However, by putting this functionality into a function, we, as programmers, do
not need to concern ourselves about these details. Instead, we simply use the function,
allowing us to focus on the larger issues at hand in our program.
5.1. Defining & Using Functions
Like variables, many programming languages may require that you declare a function
before you can use it. A function declaration may simply include a description of the
function’s input/output and name. A function declaration may require you to define the
function’s body at the same time or separately. Functions can also have scope: some
areas of the code may be able to “see” the function or know about it and be able to
invoke the function while other areas of the code may not be able to see the function
and therefore may not be able to invoke it.
Some interpreted programming languages use function hoisting which allows you to
use/invoke functions before you declare them. This works because the interpreter does
an initial scan of the code and identifies all function declarations. Only after it has
“hoisted” all functions into scope does it start to execute the program. Thus, a function
declaration can appear after it has been used and it will still work.
5.1.1. Function Signatures
A function is usually defined by its signature: every function can be identified by its
name (also called an identifier ), its list of input parameters, and its output. A function
signature allows the programming language to uniquely identify each function so that
134
5.1. Defining & Using Functions
when you invoke a function there is no ambiguity in which function you are calling.
1 Function sum(a, b)
2 x←a+b
3 return x
4 end
Algorithm 5.1: A function in pseudocode. In this case, the name (identifier) of
the function is sum and it has two parameters, a and b. Its body is contained in
lines 2–3. Its return value is indicated by the return statement on line 3.
A function declaration in pseudocode is presented in Algorithm 5.1. In the pseudocode,
explicit variable types are omitted, and thus the return type is inferred from the return
statement. In Figure 5.1 we have provided an example of a function declaration in the C
programming language with each element labeled.
Parameters
double getDistance(double x1, double y1, double x2, double y2);
Return Identifier
Type (name)
Figure 5.1.: A function declaration (prototype) in the C programming language with the
return type, identifier, and parameter list labeled.
Some languages only allow you to use one identifier for one function (like variables) while
other languages allow you to define multiple functions with the same identifier as long
as the parameter list is different (see Section 5.3.2 below). In general, like variables,
function names are case sensitive. Also similar to variables, modern lower camel casing
is used with function names.
When defining the parameters to a function (its input), you usually provide a comma
delimited list of variable names. In the case of statically typed languages, the types of
the variable parameters are also specified. The order is important as when you invoke
the function, the number of inputs must match the number of parameters in the function
declaration. The variable types may also need to match. In some dynamically typed
languages, you may be able to call functions with different types or you may be able to
omit some of the parameters (see Section 5.3.4 below).
Similarly, the return type of the function may need to be specified in statically typed
languages while with dynamic languages, functions may conditionally return different
types. We generally refer to the “return value” or “return type” because when a function
135
5. Functions
is done executing, it “returns” the control flow back to the line of code that invoked it,
returning its computed value.
You can also define functions that may not have any inputs or may not have any output.
Some languages use the keyword void to indicate no return value and such functions are
known as “void functions.” When a function doesn’t have any input values, its parameter
list is usually empty.
The function signature may be accompanied by the function body which contains the actual
code that specifies what the function does. Typically the function body is demarcated
with a code block using opening and closing curly brackets, { ... } . Within the
function you can generally write any valid code including declaring variables. When you
declare a variable inside a function, however, it is local to that function. That is, the
variable’s scope is only defined within the function. A local variable cannot be accessed
outside the function, indeed the local variable does not usually survive when the function
ends its execution and returns control back to line of code that called it. Function
parameters are essentially locally scoped variables as well and can usually be treated as
such.
5.1.2. Calling Functions
When a function has been defined and is in scope, you can invoke or “call” the function
by coding the function name and providing the input parameters which can be either
variables or literals. When provided as inputs, parameters are referred to as arguments
to the function. The arguments are typically provided as a comma delimited list and
placed inside parentheses.
Invoking a function changes the usual flow of control. When invoked, control flow is
transferred over to the function. When the function finishes executing the code in its
body, control flow returns to the point in the code that invoked it. It is common for a
program to be written so that a function calls another function and that function calls
another. This can form a deep chain of function calls in which the flow of control is
transferred multiple times. Upon the completion of each function, control is returned
back to the function that called it, referred to as the calling function.
If a function returns a value it can either be captured in a variable using an assignment
136
5.2. How Functions Work
operator or by using it in an expression.
1 a ← 10
2 b ← 20
3 c ← sum(a, b)
Algorithm 5.2: Using a function. We invoke a function by indicating its name
(identifier) and passing it arguments.
5.1.3. Organizing
Functions provide code organization, but functions themselves should also be organized.
We’ve seen this with standard libraries. Functions that provide basic input/output are
all grouped together into one library. Functions that involve math functions are grouped
together into a separate math library.
Some languages allow you to define and “import” individual libraries which organize
similar functions together. Some languages do this by collecting functions into “utility”
classes or modules. Only when you import these modules do the functions come into
scope and can be used in your code. If you do not import these modules, then the
functions are out of scope and cannot be used.
In some languages once a function is imported it is part of the global scope and can be
“seen” by any part of the code. This can cause conflicts: if you import modules from two
different libraries each with different functions that have the same name or signature,
then the two function definitions may be in conflict or it may make your code ambiguous
as to which function you intend to invoke. This is sometimes referred to as “polluting the
namespace.” There are several techniques that can avoid this situation. Some languages
allow you to place functions into a namespace to keep functions with the same name in
different “spaces.” Other languages allow you to place functions into different classes and
then invoke them by explicitly specifying which class’s function you want to call. Yet
other languages don’t have great support for function organization and it is the library
designer’s responsibility to avoid naming conflicts, typically by adding a library-specific
prefix to every function.
5.2. How Functions Work
To understand how functions work in practice, it is necessary to understand how a
program operates at a lower level. In particular, each program has a program stack (also
called a call stack). A stack is a data structure that holds elements in a Last-In First-Out
137
5. Functions
(LIFO) manner. Elements are added to the “top” of the stack in an operation called
push and elements can be removed from the top of the stack in an operation called pop.
In general, elements cannot be inserted or removed from the middle or “bottom” of the
stack.
In the context of a program, a call stack is used to keep track of the flow of control.
Depending on the operating system, compiler and architecture, the details of how
elements are stored in the program stack may vary. In general when a program begins,
the operating system loads it into memory at the bottom of the call stack. Global
variables (static data) are stored on top of the main program. Each time a function is
called, a new stack frame is created and pushed on top of the stack. This frame contains
enough space to hold values for the arguments passed to the function, local variables
declared and used by the function, as well as a space for a return value and a return
address. The return address is a memory location that the program should return to after
the execution of the function. That way, when the function finishes its execution, the
stack frame can be removed (popped) and the lower stack frame of the calling function
is preserved. This is a very efficient way to keep track of the flow of control in a program.
As each function calls another function, each stack frame is preserved by pushing a new
one on top of the program stack. Each time a function terminates execution and returns,
the removal of the stack frame means that all local variables go out of scope. Thus,
variables that are local to a function are not accessible outside the function.
To illustrate, consider the following snippet of C code. The main() function invokes
the average() function which in turn invokes the sum() function. Each invocation
creates a new stack frame on top of the last in the program stack which is depicted in
Figure 5.2.
1 double sum(double a, double b) {
2 double x = a + b;
3 return x;
4 }
5
6 double average(double a, double b) {
7 double y = sum(a, b) / 2.0;
8 return y;
9 }
10
11 int main(int argc, char **argv) {
12 double n = 10.0;
13 double m = 16.0;
14 double ave = average(n, m);
15 printf("average = %f\n", ave);
16 return 0;
17 }
138
5.2. How Functions Work
Unused stack space
Top of the stack
(low memory)
local variables x
sum() stack frame
return address, value ( 26.0 )
arguments a, b
local variables y
return address, value ( 13.0 ) average() stack frame
arguments a, b
local variables n, m, ave
return address, value ( 0 ) main() stack frame
arguments argc, argv
Global Variables
Static Content
Bottom of the stack
(high memory) Program Code
Figure 5.2.: Program Stack. At the bottom we have the program’s code, followed by
static content such as global variables. Each function call has its own stack
frame along with its own arguments and local variables. In particular, the
variable arguments a and b in two different stack frames are completely
different variables. Upon returning from the sum() function call, the top-
most stack frame would be popped and removed, returning to the code
for the average() function via the return address. The stack is depicted
bottom-up with high memory at the bottom and low memory at the top,
but this may differ depending on the architecture.
139
5. Functions
5.2.1. Call By Value
When a function is invoked, arguments are passed to it. When you invoke a function you
can pass it variables as arguments. However, the variables themselves are not passed to
the function, but instead the values stored in the variables at the time that you call the
function are passed to the function. This mechanism is known as call by value and the
variable values are passed by value to the function.
Recall that the arguments passed to a function are placed in a new stack frame for that
function. Thus, in reality copies of the values of the variables are passed to the function.
Any changes to the parameters inside the function have no effect on the original variables
that were “passed” to the function when it was invoked.
To illustrate, consider the following C code. We have a function sum that takes two
integer parameters a and b which are passed by value. Inside sum , we create another
variable x which is the sum of the two passed variables. We then change the value
of the first variable, a to 10 . Elsewhere in the code we call sum on two variables,
n , m with values 5 and 15 respectively. The invocation of the function sum means
that the two values, 5 and 15, stored in the variables are copied into a new stack frame.
Thus, changing the value to the first parameter changes the copy and has no effect on
the variable n . At the end of this code snippet n retains its original value of 5. The
program stack frames are depicted in Figure 5.3.
1 int sum(int a, int b) {
2 int x = a + b;
3 a = 10;
4 return x;
5 }
6
7 ...
8
9 int n = 5;
10 int m = 15;
11 int k = sum(n, m);
5.2.2. Call By Reference
Some languages allow you to pass a parameter to a function by providing its memory
address instead of the value stored in it. Since the memory address is being provided
to the function, the function is able to access the original variable and manipulate the
140
5.2. How Functions Work
0x0088 x = 20 0x0088 x = 20
sum() 0x0084 b = 15 sum() 0x0084 b = 15
stack frame 0x0080 a = 5 stack frame 0x0080 a = 10
.. ..
. .
0x0018 k 0x0018 k
calling function calling function
0x0014 m = 10 0x0014 m = 10
stack frame 0x0010 n = 5 stack frame 0x0010 n = 5
(a) Upon invocation of the sum() function, a new (b) The change to the variable a in the sum()
stack frame is created which holds the parameters function changes the parameter variable, but the
and local variable. The parameter variables a original variable n is unaffected.
and b are distinct from the original argument
variables n and m .
0x0088 x = 20 0x0088 x = 20
sum() 0x0084 b = 15 sum() 0x0084 b = 15
stack frame 0x0080 a = 10 stack frame 0x0080 a = 10
.. ..
. .
0x0018 k 0x0018 k = 20
calling function calling function
0x0014 m = 10 0x0014 m = 10
stack frame 0x0010 n = 5 stack frame 0x0010 n = 5
(c) When the sum() function finishes execution, (d) The returned value is stored in the variable k
its stack frame is removed and the variables a , and the variable n retains its original value.
b , and x are no longer valid. The return value
20 is stored in another return value location.
Figure 5.3.: Demonstration of Pass By Value. Passing variables by value means that
copies of the values stored in the variables are provided to the function.
Changes to parameter variables do not affect the original variables.
141
5. Functions
contents stored at that memory address. In particular, the function is now able to make
changes to the original variable. This mechanism is known as call by reference and the
variables are passed by reference.
To illustrate, consider the following C code. Here, the variable a is passed by reference
( b is still passed by value, the *a and &n in the following code are dereferencing and
referencing operators respectively. For details, see Section 18.2). Below when we invoke
the sum() function, we pass not the value stored in n , but the memory address of the
variable n . Thus, when we change the value of the variable a in the function, we are
actually changing the value of n (since we have access to its memory location). At the
conclusion of this snippet of code, the value stored in n has been changed to 10. The
program stack frames are depicted in Figure 5.4.
1 int sum(int *a, int b) {
2 int x = *a + b;
3 *a = 10;
4 return x;
5 }
6
7 ...
8
9 int n = 5;
10 int m = 15;
11 int k = sum(&n, m);
Whether or not a variable is passed by value or by reference depends on the language,
type of variable, and the syntax used.
5.3. Other Issues
5.3.1. Functions as Entities
In programming languages, any entity that can be stored in a variable or passed as
an argument to a function or returned as a value from a function is referred to as a
“first-class citizen.” Numerical values for example are usually first-class citizens as they
can be stored in variables and passed to functions.
Functional Programming is a programming language paradigm in which functions them-
selves are first-class citizens. That is, functions can be assigned to variables, functions
142
5.3. Other Issues
0x0088 x = 20 0x0088 x = 20
sum() 0x0084 b = 15 sum() 0x0084 b = 15
stack frame 0x0080 a = 0x0010 stack frame 0x0080 a = 0x0010
.. ..
. .
0x0018 k 0x0018 k
calling function calling function
0x0014 m = 10 0x0014 m = 10
stack frame 0x0010 n = 5 stack frame 0x0010 n = 10
(a) Upon invocation of the sum() function, a new (b) The change to the variable a in the sum()
stack frame is created which holds the parameters function actually changes what the variable a
and local variable. The parameter variable a references. That is, the original variable n .
holds the memory location of the original variable
n.
0x0088 x = 20 0x0088 x = 20
sum() 0x0084 b = 15 sum() 0x0084 b = 15
stack frame 0x0080 a = 0x0010 stack frame 0x0080 a = 0x0010
.. ..
. .
0x0018 k 0x0018 k = 20
calling function calling function
0x0014 m = 10 0x0014 m = 10
stack frame 0x0010 n = 10 stack frame 0x0010 n = 10
(c) When the sum() function finishes execution, (d) The returned value is stored in the variable k
its stack frame is removed and the variables a , and the value in the variable n has now changed.
b , and x are no longer valid. The return value
20 is stored in another return value location.
Figure 5.4.: Demonstration of Pass By Reference. Passing variables by reference means
that the memory address of the variables are provided to the function. The
function is able to make changes to the original variable because it knows
where it is stored.
143
5. Functions
can be passed to other functions as arguments, and functions can even return functions
as a result. This is done as a matter of course in functional programming languages
such as Haskell and Clojure, but many programming languages contain some functional
aspects.
For example, some languages support the same concept by using function pointers which
are essentially references to where the function is stored in memory. As a memory
location is essentially a number, it can be passed around in functions and be stored in a
variable. Purists would argue that this is not sufficient to call a function a “first-class
citizen” in such a language. They may argue that a language must be able to create
new functions at runtime for it to be considered a language in which functions are “true”
first-class citizens.
In any case, there are several advantages to being able to pass functions around as
arguments or store them in variables. Passing a function to another function as an
argument gives you the ability to provide a callback. A callback is simply a function
that gets passed to another function as an argument. The idea is that the function that
receives the callback will execute or “call back” the passed function at some point.
Using callbacks enables us to program a “generic” function that provides some generalized
functionality. Then more specific behavior can be be implemented in the callback function.
For example, we could create a generic sort function that sorts elements in a collection.
We could make the sort function generic so that it could sort any type of data: numbers,
strings, objects, etc. A callback would provide more specific behavior on how to order
individual elements in the sorted array.
As another example, consider GUI Programming in which we want to design a user
interface. In particular, we may be able to create a button element in our interface. We
need to be able to specify what happens when the user clicks the button. This could be
achieved by passing in a function as a callback to “register” it with the click “event.”
A related issue is anonymous functions (also known as lambda expressions). Typically, we
simply want to create a function so that we can pass it as a callback to another function.
We may have no intention of actually calling this function directly as it may not be of
much use other than passing it as a callback. Some languages allow you to define a
function “inline” without an identifier so that it can be passed to another function. Since
the function has no name and cannot be invoked by other sections of the code (other
than the function we passed it to), it is known as an anonymous function.
5.3.2. Function Overloading
Some languages do not allow you to define more than one function with the same name
in the same scope. This is to prevent ambiguity in the code. When you write code to
invoke a function and there are several functions with that name, which one are you
144
5.3. Other Issues
actually calling?
Some languages do allow you to define multiple functions with the same name as long as
they differ in either the number (also called arity) or type of parameters. For example,
you could define two absolute value, |x| functions with the same name, but one of them
takes a floating point number while the other takes an integer as its parameter. This
is known as function overloading because you are “overloading” the code by defining
multiple functions with the same name.
The ambiguity problem is solved by requiring that each function with the same name
differs in their parameters. If you invoke the absolute value function and pass it a floating
point number, clearly you meant to call the first version. If you passed it an integer, it is
clear that you intended to invoke the second version. Depending on the type and number
of arguments you pass to a function, the compiler or interpreter is able to determine
which version you intend to call and is able to make the right function call. This process
is known as static dispatch.
In a language without function overloading, we would be forced to use different names
for functions that perform the same operation but on different types.
5.3.3. Variable Argument Functions
Many languages allow you to define special functions that take a variable number of
parameters. Often they are referred to as “vararg” (short for variable argument) functions.
The syntax for doing so varies as does how you can write a function to operate on a
variable number of arguments (usually through some array or collection data structure).
The standard printf (print formatted) function found in many languages is a good
example of a vararg function. The printf function allows you to use one function to
print any number of variables or values. Without a vararg function, you would have to
implement a printf version for no arguments, 1 argument, 2 arguments, etc. Even
then, you would only be able to support up to n arguments for as many functions as
you defined. By using a vararg function, we can write a single function that operates
on all of these possibilities. It is import to note, a vararg function is not an example
of function overloading. There is still only one function defined, it just takes a variable
number of arguments.
5.3.4. Optional Parameters & Default Values
Suppose that you define a function which has, say, three parameters. Now suppose you
invoke the function but only provide it 2 of the 3 arguments that it expects. Some
languages would not allow this and it would be considered a syntax or runtime error. Yet
145
5. Functions
other languages may have very complex rules about what happens when an argument is
omitted. Some languages allow you to omit some arguments when calling functions as a
feature of the language. That is, the parameters to a function are optional.
When a language allows parameters to be optional, it usually also allows you to define
default values to the parameters if the calling function does not provide them. If a
user calls the function without specifying a parameter, it takes on the default value.
Alternatively, the default could be a non-value like “null” or “undefined.” Inside the
function you could implement logic that determined whether or not a parameter was
passed to the function and alter the behavior of the function accordingly.
5.4. Exercises
Exercise 5.1. Recall that the greatest common divisor (gcd) of two positive integers, a
and b is the largest positive integer that divides both a and b. Adapt the solution from
Exercise 4.6 into a function. If the language you use supports it, return the gcd via a
pass by reference variable.
Exercise 5.2. Write a function that scales an input x to to its scientific notation scale
so that 1 ≤ x < 10. If you language supports pass by reference, the amount that x is
shifted should be stored in a pass-by-reference parameter. For example, a call to this
function with x = 314.15 should return 3.1415 and the amount it is scaled by is n = −2.
Exercise 5.3. Write a function that returns the most significant digit of a floating point
number. The function should only return an integer in the range 1–9 (it should return
zero only if x = 0).
Exercise 5.4. Write a function that, given an integer x, sums the values of its digits.
That is, for x = 29423 the sum 2 + 9 + 4 + 2 + 3 = 20.
Exercise 5.5. Write a function to convert radians to degrees using the formula,
180 · rad
deg =
π
Write another function to covert degrees to radians.
Exercise 5.6. Write functions to compute the diameter, circumference and area of a
circle given its radius. If your language supports pass by reference, compute all three of
these with one function.
Exercise 5.7. The arithmetic-geometric mean of two numbers x, y, denoted M (x, y) (or
√
agm(x, y)) can be computed iteratively as follows. Initially, a1 = 12 (x + y) and g1 = xy
(i.e. the normal arithmetic and geometric means). Then, compute
an+1 = 12 (an + gn )
√
gn+1 = an g n
146
5.4. Exercises
The two sequences will converge to the same number which is the arithmetic-geometric
mean of x, y. Obviously we cannot compute an infinite sequence, so we compute until
|an − gn | < for some small number .
Exercise 5.8. Write a function to compute the annual percentage yield (APY) given an
annual percentage rate (APR) using the formula
AP Y = eAP R − 1
Exercise 5.9. Write a function that will compute the air distance between two locations
given their latitudes and longitudes. Use the formula as in Exercise 2.14.
Exercise 5.10. Write a function to convert a color represented in the RGB (red-green-
blue) color model (used in digital monitors) to a CMYK (cyan-magenta-yellow-key) used
in printing. RGB values are integers in the range [0, 255] while CMYK are fractional
numbers in the range [0, 1]. To convert to CMYK, you first need to scale each integer
value to the range [0, 1] by simply computing
r g b
r0 = , g0 = , b0 =
255 255 255
and then using the following formulas:
K = 1 − max{r0 , g 0 , b0 }
C = (1 − r0 − k)/(1 − k)
M = (1 − g 0 − k)/(1 − k)
Y = (1 − b0 − k)/(1 − k)
Exercise 5.11. Write a function to convert from CMYK to RGB using the following
formulas.
r = 255 · (1 − C) · (1 − K)
g = 255 · (1 − M ) · (1 − K)
b = 255 · (1 − Y ) · (1 − K)
Exercise 5.12. Write some functions to convert an RGB color to a gray scale, “removing”
the color values. An RGB color value is grayscale if all three components have the same
value. To transform a color value to grayscale, there there are several possible techniques.
The average method simply sets all three values to the average:
r+g+b
3
The lightness method averages the most prominent and least prominent colors:
max{r, g, b} + min{r, g, b}
2
147
5. Functions
The luminosity technique uses a weighted average to account for a human perceptual
preference toward green:
0.21r + 0.72g + 0.07b
Exercise 5.13. Adapt the methods to compute a square root in Exercise 4.21 into
functions.
Exercise 5.14. Adapt the methods to compute the natural logarithm in Exercise 4.22
into functions.
Exercise 5.15. Weight (mass in the presence of gravity) can be measured in several
scales: kilogram force (kgf), pounds (lbs), ounces (oz), or Newtons (N). To convert
between these scales, you can use the following facts:
• 1 kgf is equal to 2.20462 pounds
• There are 16 ounces in a pound
• 1 kgf is equal to 9.80665 Newtons
Write a collection of functions to convert between these scales.
Exercise 5.16. Length can be measured by several different units. We will concern
ourselves with the following scales: kilometer, mile, nautical mile, and furlong. A measure
in each one of these scales can be converted to another using the following facts.
• One mile is equivalent to 1.609347219 kilometers
• One nautical mile is equivalent to 1.15078 miles
• A furlong is 81 -th of a mile
Write a collection of functions to convert between these scales.
Exercise 5.17. Temperature can be measured in several scales: Celsius, Kelvin, Fahren-
heit, and Newton. To convert between these scales, you can use the following conversion
table.
From/To Celsius Kelvin Fahrenheit Newton
9 33
Celsius – c + 273.15 c 5 + 32 c 100
9
Kelvin k − 273.15 – 5
k − 459.67 .33k − 90.1395
Fahrenheit (f − 32) 59 5
9
f + 255.372 – 11
60
f − 8815
Newton n 100
33
100
33
n + 273.15 60
11
n + 32 –
Table 5.1.: Conversion Chart
Write a collection of functions to convert between these scales.
148
5.4. Exercises
Exercise 5.18. Energy can be measured in several different scales: calories (c), joules
(J), ergs (erg) and foot-pound force (ft-lbf) among others. To convert between these
scales, you can use the following facts:
• 1 erg equals 1.0 × 10−7 J
• 1 ft-lbs equals 1.3558 joules
• 1 calorie is equal to 4.184 joules
Write a collection of functions to convert between these scales.
Exercise 5.19. Pressure is a measure of force applied to the surface of an object per
unit area. There are several units that can be used to measure pressure:
• Pascal (Pa) which is one Newton per square meter
• Pound-force Per Square Inch (psi)
• Atmosphere (atm) or standard atmospheric pressure
• The torr, an absolute scale for pressure
To convert between these units, you can use the following formulas.
• 1 psi is equal to 6,894.75729 Pascals, 1 psi is equal to 0.06804596 atmospheres
• 1 atmosphere is equal to 101,325 Pascals
1 101,325
• 1 torr is equal to 760
atmosphere and 760
Pascals
Write a collection of functions to convert between these scales.
149
6. Error Handling
Writing perfect code is difficult. The more complex a system or code base, the more
likely it is to have bugs. That is, flaws or mistakes in a program that result in incorrect
behavior or unintended consequences. The term “bug” has been used in engineering
for quite a while. The term was popularized in the context of computer systems by
Grace Hopper who, when working on the Naval Mark II computer in 1946, tracked a
malfunction to a literal bug, a moth, trapped in a relay [2].
Some of the biggest modern engineering failures can be tracked to simple software bugs.
For example, on September 26th, 1983 a newly installed Soviet early warning system
gave indication that nuclear missiles had been launched on the Soviet Union by the
United States. Stanislav Petrov, a lieutenant colonel in the Soviet Air Defense Forces and
duty officer at the time, did not trust the new system and did not report the incident to
superiors who may have ordered a counter strike. Petrov was correct as the false alarm
was caused by sunlight reflections off of high altitude clouds as well as other bugs in the
newly deployed system [28].
In September 1999 the Mars Climate Orbiter, a project intended to study the Martian
climate and atmosphere was lost after it entered into the upper atmosphere of Mars and
disintegrated. The error was due to a subsystem that measured the craft’s momentum
in a non-standard pound force per second unit when all other systems expected the
standard newton second unit [1]. The loss of the project was calculated at over $125
million.
There are numerous other examples, some that have caused inconvenience to users (such
as the Zune bug mentioned in Section 4.5.2) to bugs in medical devices that have cost
dozens of lives to those resulting in the loss of millions of dollars [6].
In some sense, Software Engineering and programming is unique. If you build a bridge
and forget one bolt its likely not going to cause the bridge to collapse. If you draw
up plans for a development and the land survey is a few inches off overall, its not a
catastrophic problem. However, if you forget one character or are off by one number in a
program, it can cause a complete system failure.
There are a variety of reasons for why bugs make it into systems. Bugs could be the result
of a fundamental misunderstanding of the problem or requirements. Poor management
and the pressure of time constraints to deliver a project may make developers more
careless. A lack of proper testing may mean many more bugs survive the development
151
6. Error Handling
process than otherwise should have. Even expert programmers can overlook a simple
mistake when writing thousands of lines of code.
Given the potential for error, it is important to have good software development method-
ologies that emphasize testing a system at all levels. Working in teams where regular
code reviews are held so that colleagues can examine, critique, and catch potential bugs
are essential for writing robust code.
Modern coding tools and techniques can also help to improve the robustness of code. For
example, debuggers are tools that help a developer debug (that is, find and fix the cause
of an error) a program. Debuggers allow you to simulate the execution of a program
statement-by-statement and view the current state of the program such as variable values.
You can “step through” the execution line by line to find where an error occurs in order
to localize and identify a bug.
Other tools allow you to perform static analysis on source code to search for potential
problems. That is, problems that are not syntax errors and are not necessarily bugs
that are causing problems, but instead are anti-patterns or code smells. Anti-patterns
are essentially common bad-habits that can be found in code. They are an attempted
solution to a commonly encountered problem but which don’t actually solve the problem
or introduces new problems. Code smells are “symptoms” in a source code that indicate
a possible deeper design or implementation flaw. Failure to adhere to good programming
principles such as properly initializing variables or failure to check for null values are
examples of smells. Static analysis tools automatically examine the code base for potential
issues like these. For example, a lint (or linter) is a tool that can examine source code
suspicious or non-portable code or code that does not comply with generally accepted
standards or ways of doing things.
Even if code contains no bugs, it is still susceptible to errors. For example, a program
could connect to a remote database to query and process data. However, if the network
connection is temporarily unavailable, the program will not be able to execute properly.
Because of the potential of such errors, it is important to write code that is not only bug
free but is also robust and resilient. We must anticipate possible error conditions and
write code to detect, prevent, or recover from such errors. Generally, this is referred to
as error handling.
Much of what we now consider Software Engineering was pioneered by people like
Margaret Hamilton who was the lead Apollo flight software designer at NASA. During
the Apollo 11 Moon landing (1969), an error in one system caused the lander’s computer
to become overworked with data. However, because the system was designed with a
robust architecture, it could detect and handle such situations by prioritizing more
important tasks (those related to landing) over lower priority tasks. The resilience that
was built into the system is credited with its success [11].
152
6.1. Error Handling
6.1. Error Handling
In general, errors are potential conditions or situations that can reasonably be anticipated
by a developer. For example, if we write code to open and process a file, there are several
things that could go wrong. The file may not exist, or we may not have permission on
the system to read it, or the formatting in the file may be corrupted or not as expected.
Still yet, everything could be fine with the file, but it may contain erroneous or invalid
values.
If an error can be anticipated, we may be able to write code that detects the particular
error condition and handles it by executing code that may be able to recover from the
error condition. In the case of a missing file for example, we may be able to prompt the
user for an alternate file.
We may be able to detect but not necessarily recover from certain errors. For example, if
the file has been corrupted in example above, there may not be a way to properly “fix”
it. If it contains invalid data, we may not even want the program to fix it as it may
indicate a bug or other issue that needs to be addressed. Still yet, there may be some
error conditions that we cannot recover from at all as they are completely unexpected.
In such instances, we may want the error to result in the termination of the program in
which case the error is considered fatal.
6.2. Error Handling Strategies
There are several general strategies for performing error handling. We’ll look at two
general methods here: defensive programming and exceptions.
6.2.1. Defensive Programming
Defensive programming is a “look before you leap” strategy. Suppose we have a potentially
“dangerous” section of code; that is, a line or block of code whose execution could encounter
or result in an error condition. Before we execute the code, we perform a check to see
if the error condition is present (usually using a conditional statement). If the error
condition does not hold, then we proceed with the code as normal. However, if the error
condition does hold, instead of executing the code, we execute alternative code that
handles the error.
Suppose we are about to divide by a number. To prevent a division by zero error, we
can check if our denominator is zero or not. If it is, then we raise or handle the error
instead of performing the division. What should be done in such a case? We could, as an
alternative, use a predefined value as a result instead. Or we could notify the user and
153
6. Error Handling
ask for an alternative. Or we could log the error and proceed as normal. Or we could
decide that the error is so egregious that it should be fatal and terminate the execution
of the program.
Which is the right way to handle this error? It really depends on your design requirements
really. This raises the question, though: “who” is responsible for making these decisions?
Suppose we’re designing a function for a library that is not just for our project but others
as well (as is the case with the standard library functions). Further, the function we’re
designing could have multiple different error conditions that it checks for. In this scenario
there are two entities that could handle the errors: the function itself and the code that
invokes the function.
Suppose that we decide to handle the errors inside the function. As designers of the
function, we’ve made the decision to handle the errors for the user (the code that invokes
our function). Regardless of how we decide to handle the errors, this design decision has
essentially taken any decision making ability away from users. This is not very flexible
for someone using our code. If they have different design considerations or requirements,
they may need or want to handle the errors in a different way than we did.
Now suppose that we decide not to handle the errors inside our function. Defensive
programming may still be used to prevent the execution of code that results in an error.
However, we now need a way to communicate the error condition to the calling function
so that it can know what type of error happened and handle it appropriately.
Error Codes
One common pattern to communicate errors to a calling function is to use the return
type as an error code. Usually this is an integer type. By convention 0 is used to indicate
“no error” and various other non-zero values are used to indicate various types of errors.
Depending on the system and standard used, error codes may have a predefined value or
may be specific to an application or library.
One problem with using the return type to indicate errors is that functions are no longer
able to use the return type to return an actual computed value. If a language supports
pass by reference, then this is not generally a problem. However, even with such languages
there are situations where the return type must be used to return a value. In such cases,
the function can still communicate a general error message by returning some flag value
such as null.
Alternatively, a language may support error codes by using a shared global variable that
can be set by a function to indicate an error. The calling function can then examine the
variable to see if an error occurred during the invocation of the function.
154
6.2. Error Handling Strategies
Limitations
Defensive programming has its limitations. Let’s return to the example of processing a
file. To check for all four of the error conditions we identified, we would need a series of
checks similar to the following.
1 if file does not exists then
2 return an error code
3 end
4 if we do not have permissions then
5 return an error code
6 end
7 if the file is corrupted then
8 return an error code
9 end
10 if the file contains invalid values then
11 return an error code
12 end
13 process file data
A problem arises when an error condition is checked and does not hold. Then, later in
the execution, circumstances change and the error condition does hold. However, since
it was already checked for, the program remains under the assumption that the error
condition does not hold. For example, suppose that another process or program deletes
the file that we wish to process after its existence has been checked but before we start
processing it. Because of the sequential nature of our program, this type of error checking
is susceptible to these issues.
6.2.2. Exceptions
An exception is an event or occurrence of an anomalous, erroneous or “exceptional”
condition that requires special handling. Exceptions interrupt the normal flow of control
in a program by handing the flow of control over to exception handlers.
Languages usually support exception handling using a try-catch control structure such
as the following.
try {
//potentially dangerous code here
155
6. Error Handling
} catch(Exception e) {
//exception handling code here
}
The try is used to encapsulate potentially dangerous code, or simply code that would
fail if an error condition occurs. If an error occurs at some point within the try block,
control flow is immediately transferred to the catch block. The catch block is where
you specify how to handle the exception. If the code in the try block does not result in
an exception, then control flow will skip over the catch statement and resume normally
after.
It is important to understand how exceptions interrupt the normal control flow. For
example, consider the following pseudocode.
try {
statement1;
statement2;
statement3;
} catch(Exception e) {
//exception handling code here
}
Suppose statement1 executes with no error but that when statement2 executes, it
results an exception. Control flow is then transferred to the catch block, skipping
statement3 entirely. In general, there may not be a mechanism for your catch block
to recover and execute statement3 . Therefore, it may be necessary to make your
try-catch blocks fine-grained, perhaps having only a single statement within the try
statement.
Some languages only support a generic Exception and the type of error may need to be
communicated through other means such as a string error message. Still other languages
may support many different types of exceptions and you may be able to provide multiple
catch statements to handle each one differently. In such languages, the order in which
you place your catch statements may be important. Similar to an if-else-if statement,
the first one that matches the exception will be the one that executes. Thus, it is best
practice to order your catch blocks from the most specific to the most general.
Some languages also support a third finally control statement as in the following
example.
156
6.3. Exercises
try {
//potentially dangerous code here
} catch(Exception e) {
//exception handling code here
} finally {
//unconditionally executed code here
}
The try-catch block operates as previously described. However, the finally block
will execute regardless of whether or not an exception was raised. If no exception
was raised, then the try block will fully execute and the finally block will execute
immediately after. If an exception was raised, control flow will be transferred to the
catch block. After the catch block has executed, the finally block will execute.
finally blocks are generally used to handle resources that need to be “cleaned up”
whether or not an exception occurs. For example, opening a connection to a database
to retrieve and process data. Whether or not an exception occurs during this process
the connection will need to be properly closed as it represents a substantial amount of
resources (a network connection, memory and processing time on both the server and
client machines, etc.). Failure to properly close the connection may result in wasted
resources. By placing the clean up code inside a finally statement, we can be assured
that it will execute regardless of an error or exception.
In addition to handling exceptions, a language may allow you to “throw” your own
exceptions by using the keyword throw . In this way you can also practice defensive
programming. You could write a conditional statement to check for an error condition
and then throw an appropriate exception.
6.3. Exercises
Exercise 6.1. Rewrite the function to compute the GCD in Exercise 5.1 to handle
invalid inputs.
Exercise 6.2. Rewrite the function to compute statistics of a circle in Exercise 5.6 to
handle invalid input (negative radius).
Exercise 6.3. Rewrite the function to compute the annual percentage yield in Exercise
5.8 to handle invalid input.
Exercise 6.4. Rewrite the function to compute air distance in Exercise 5.9 to handle
invalid input (latitude/longitude values outside the range [−180, 180]).
157
6. Error Handling
Exercise 6.5. Rewrite the function to convert from RGB to CMYK in Exercise 5.10 to
handle invalid inputs (values outside the range [0, 255]).
Exercise 6.6. Rewrite the function to convert from CMYK to RGB in Exercise 5.11 to
handle invalid inputs.
Exercise 6.7. Rewrite the square root functions from Exercise 5.13 to handle invalid
inputs.
Exercise 6.8. Rewrite the natural logarithm functions from Exercise 5.14 to handle
invalid inputs.
Exercise 6.9. Rewrite the weight conversion functions from Exercise 5.15 to handle
invalid inputs.
Exercise 6.10. Rewrite the length conversion functions from Exercise 5.16 to handle
invalid inputs.
Exercise 6.11. Rewrite the temperature conversion functions from Exercise 5.17 to
handle invalid inputs.
Exercise 6.12. Rewrite the energy conversion functions from Exercise 5.18 to handle
invalid inputs.
Exercise 6.13. Rewrite the pressure conversion functions from Exercise 5.19 to handle
invalid inputs.
158
7. Arrays, Collections & Dynamic
Memory
Rarely do we ever deal with a single piece of data in a program. Instead, most data is
made up of a collection of similar elements. A program to compute grades would be
designed to operate on an entire roster of students. Scientific data represents a collection
of many different samples or measurements. A bank maintains and processes many
different accounts, etc.
Arrays are a way to collect similar pieces of data together in an ordered collection. The
pieces of data stored in an array are referred to as elements and are stored in an ordered
manner. That is, there is a “first” element, “second” element, etc. and a “last” element.
Though the elements are ordered, they are not necessarily sorted in any particular manner.
Instead, the order is usually determined by the order in which you place elements into
the array.
Some languages only allow you to store the same types of elements in an array. For
example, an integer array would only be able to store integers, an array of floating-point
numbers would only be able to store floating-point numbers. Other languages allow you
to create arrays that can hold mixed elements. A mixed array would be able to hold
elements of any type, so it could hold integers, floating-point numbers, strings, objects,
or even other arrays.
Some languages treat arrays as full-fledged object types that not only hold elements, but
have methods that can be called to manipulate or transform the contents of the array.
Other languages treat arrays as a primitive type, simply using arrays as storage data
structures.
Languages can vary greatly in how they implement and represent arrays of elements, but
many have the same basic usage patterns allowing you to create arrays and manipulate
their contents.
159
7. Arrays, Collections & Dynamic Memory
index 0 1 2 3 4 5 6 7 8 9
contents 2 3 5 7 11 13 17 19 23 29
Figure 7.1.: An integer array of size 10. Using zero-indexing, the first element is at index
0, the last at index 9.
7.1. Basic Usage
Creating Arrays
Though there can be great variation in how a language uses arrays, there are some
commonalities. Languages may allow you to create static arrays or dynamically allocated
arrays (see Section 7.2 below for a detailed discussion). Static arrays are generally created
using the program stack space while dynamically allocated arrays are stored in the heap.
In either case you generally declare an array by specifying its size. In statically typed
languages, you must also declare the array’s type (integer, floating-point, etc.).
Indexing Arrays
Once an array has been created you can use it by assigning values to it or by retrieving
values from it. Because there is more than one element, you must specify which element
you are assigning or retrieving. This is generally done through indexing. An index is
an integer that specifies an element in the array. The index is used in conjunction with
(usually) square brackets and the array’s identifier. For example, if the array’s identifier
is arr and the index is an integer value stored in the variable i , we would refer to the
i-th element using the syntax arr[i] . An example is presented in Figure 7.1.
For most programming languages, indices start at zero. This is known as zero-indexing.1
Thus, the first element is at arr[0] , the second at arr[1] etc. When an array is
stored in memory, each element is usually stored one after the other in one contiguous
space in memory. Further, each element is of a specific type which is represented using a
fixed number of bytes in memory. Thus the index actually acts as an offset in memory
from the beginning of the array. For example, if we have an array of integers which each
take 4 bytes each, then the 5th element would be stored at index 4, which is an an offset
equal to 4 × 4 = 16 bytes away from the beginning of the array. The first element, being
at index 0 is 4 × 0 = 0 bytes from the beginning of the array (that is, the first element is
at the beginning of the array).
Once an element has been indexed, it can essentially be treated as a regular variable,
1
Some languages do use 1-indexing but there are very strong arguments in favor of zero-indexing [13].
160
7.1. Basic Usage
assigning and retrieving values as you would regular variables. Care must be taken so
that you do not make a reference to an element that does not exist. For example, using a
negative index or an index i ≥ n in an array of n elements. Depending on the language,
indexing an array element that is out-of-bounds may result in undefined behavior, an
exception being thrown, or a corruption of memory.
Iteration
Since we can simply index elements in an array, it is natural to iterate over elements
in an array using a for loop. We can create a for loop using an index variable i which
starts at 0, and increments by one on each iteration, accessing the i-th element using the
syntax described above, arr[i] . One issue is that such a loop would need to know how
large the array is in order to define a terminating condition.
1 n ← size of array arr
2 for (i ← 0; i ≤ (n − 1); i ← (i + 1)) do
3 process element arr[i]
4 end
Some languages build the size of the array into a property that can be accessed. Java,
for example, has a arr.length property. Other languages provide functions that you
can use to determine their size. Still other languages (such as C), place the burden of
“bookkeeping” the size of an array on you, the programmer. Whenever you pass an array
to a function you need to also pass a size parameter that informs the function of how
many elements are in the array. Yet other functions may also require you to pass the
size of each element in the array.
Some languages also support a basic foreach loop (cf. Section 4.4). A foreach loop is
syntactic sugar that allows you to iterate over the elements in an array (usually in order)
without the need for boilerplate code that creates and increments an index variable.
1 foreach element a in arr do
2 process element a
3 end
The actual syntax may vary if a language supports such a loop.
161
7. Arrays, Collections & Dynamic Memory
Using Arrays in Functions
Most programming languages allow you to use arrays as both function parameters and as
return types. You can pass arrays to functions and functions can be defined that return
arrays. Typically, when arrays are passed to functions, they are passed by reference so
as to avoid making an entirely new copy of the array. As a consequence, if the function
makes changes to the array elements, those changes may be realized in the calling function.
Sometimes you may want this behavior. However, sometimes you may not want the
function to make changes to the passed array. Some languages allow you to use various
keywords to prevent any changes to the passed array.
If a function is designed to return an array, care must be taken to ensure that the correct
type of array is returned. Recall that static arrays are allocated on the call stack. It
would be inappropriate to return static arrays from a function as the array is part of
the stack frame that is destroyed when the function returns control back to the calling
function (we discuss this in detail below). Instead, if a function returns an array, it
should be an array that has been dynamically allocated (on the heap).
7.2. Static & Dynamic Memory
Recall that arrays can be declared as static arrays, meaning that when you declare them,
they are allocated and stored on the program’s call stack within the stack frame in which
they are declared. For example, if a function foo() creates a static array of 5 integers,
each requiring 4 bytes, then 20 contiguous bytes are allocated on the stack frame for
foo() to store the static array.
This can cause several potential problems. First, the typical stack space allocated for a
program is relatively small. It can be as large as a couple of Megabytes (MBs) or on
some older systems or those with limited resources, even on the order of a few hundred
Kilobytes (KBs). When dealing with data of any substantial size, you could quickly run
out of stack space, resulting in a stack overflow.
Another problem arises if we want to return a static array from a function. Recall that
when a function returns control to the calling function, its stack frame is popped off the
top and goes out-of-scope (see Section 5.2). Since the array is part of the stack frame of
the function, it too goes out of scope. Depending on how the system works, the contents
of the frame may be completely changed in the “bookkeeping” process of returning from
the function. Even if the contents remain unchanged when the function returns, they
will almost certainly be overwritten when another function call is made and a new stack
frame overwrites the old one. For these reasons, static arrays are of very limited use.
They must be kept small and cannot be returned from a function.
162
7.2. Static & Dynamic Memory
Demonstration in C
To make this concept a bit more clear, we’ll use a concrete example in the C programming
language. Consider the program code in Figure 7.2. Here, we have a function foo()
that creates a static integer array of size 5, int b[5]; . This memory is allocated on
the stack frame and then assigned values. Printing them in the function will give the
expected results,
b[0] = 5
b[1] = 10
b[2] = 15
b[3] = 20
b[4] = 25
1 #include <stdlib.h>
2 #include <stdio.h>
3
4 int * foo(int n) {
5 int i;
6 int b[5];
7 for(i=0; i<5; i++) {
8 b[i] = n * (i+1);
9 printf("b[%d] = %d\n", i, b[i]);
10 }
11 return b;
12 }
13
14 int main(int argc, char **argv) {
15 int i, m = 5;
16 int *a = foo(m);
17 for(i=0; i<5; i++) {
18 printf("a[%d] = %d\n", i, a[i]);
19 }
20 return 0;
21 }
Figure 7.2.: Example returning a static array
163
7. Arrays, Collections & Dynamic Memory
However, when the function foo() ends execution and returns control back to the
main() function, (sometimes called unwinding), the contents of foo() ’s stack frame
are altered as part of the process. Some of the contents are the same, but elements have
been completely altered. Printing the “returned” contents of the array gives us garbage:
a[0] = 1564158624
a[1] = 32767
a[2] = 15
a[3] = 20
a[4] = -626679356
This is not an issue when returning primitive types as the return value is placed in a
special memory location available to the calling function. Even in our example, the
return value is properly communicated to the calling function: its just that the returned
value is a pointer to the array’s location (which happens to be a memory address in the
“stale” stack frame). The stack frames are depicted in Figure 7.3.
7.2.1. Dynamic Memory
The solution to the problems presented by static arrays is to use dynamically allocated
arrays. Such arrays are not allocated and stored in the program call stack, but instead
are stored in another area called the heap. In fact, because of the shortcomings of static
arrays, some languages only allow you to use dynamically allocated arrays even if it is
done so implicitly.
Recall that when a program is loaded into memory, its code is placed on the program call
stack in memory. On top of that is any static data (global variables or data for example).
Subsequent function calls place new stack frames on top of that. In addition, at the
“other end” of the program’s memory space, the heap is allocated. The heap is a “pile” of
memory like the stack is, but it is less structured. The stack is one contiguous piece of
memory, but the heap may have “holes” in it as various chunks of it are allocated and
deallocated for the program. In general, the heap is larger but allocation and deallocation
is a more involved and more costly process while the stack is smaller and faster to
allocate/deallocate stack frames from.
Initially, a program is allocated a certain amount of memory for its heap. When a
program attempts to dynamically allocate memory, say for a new array of integers, it
makes a request to the operating system for a certain amount of memory (a certain
number of bytes). The system responds by allocating a chunk of the heap memory which
the program can then use to store elements in the array. Usually, the memory space is
164
7.2. Static & Dynamic Memory
stored as a pointer or reference. The reference is stored in a variable in a stack frame,
but the actual contents of the array are stored in the heap space.
Depending on the language and system, if a program uses all of its heap space and runs
out, the operating system may terminate the program or it may attempt to reserve even
more memory for the program.
Memory Management
If a program no longer needs a dynamically allocated memory space, it should “clean up”
after itself by deallocating or “freeing” the memory, releasing it back to the heap space
so that it can be reused either by the program or some other program or process on the
system. The process of allocating and deallocating memory is generally referred to as
memory management. If a program does not free up memory, it may eventually run out
and be forced to terminate. Even if it does not necessarily run out of available memory,
its performance may degrade or it may impact system performance.
If a program has poor memory management and fails to deallocate memory when it is
no longer needed, the memory “leaks”: the available memory gradually runs out because
it is not released back to the heap for reallocation. Programs which such poor memory
management are said to have a memory leak. Sometimes this is a consequence of a
dangling pointer: when a program dynamically allocates a chunk of memory but then
due to carelessness, loses the reference to the memory chunk, making it impossible to
free up.
Some languages have automatic garbage collection that handle memory management for
us. The language itself is able to monitor the dynamically allocated pieces of memory
and determine if any variable in the program still references it. If the memory is no
longer referenced, it is “garbage” and becomes eligible to be “collected.” The system
itself then frees the memory and makes it available to the program or operating system.
In such “memory managed” languages, we are responsible for allocating memory, but are
not (necessarily) responsible for deallocating it.
Even if a language offers automated memory management, it is still possible to have
memory leaks and other memory allocation issues. Automated memory management
does not solve all of our memory management problems. Moreover, it comes at a cost.
The additional resources and overhead required to monitor memory can have a significant
performance cost. However, with modern garbage collection systems and algorithms,
the performance gap between garbage collected languages and user-managed memory
languages has been shrinking. In any case, all program memory is reclaimed by the
operating system when the program terminates.
165
7. Arrays, Collections & Dynamic Memory
7.2.2. Shallow vs. Deep Copies
In most languages, an array variable is actually a reference to the array in memory.
We could create an array referred to by a variable A and then create another reference
variable B and set it “equal” to A. However, this is simply a shallow copy. Both the
reference variables refer to the same data in memory. Consequently, if we change the
value of an element in one, the change is realized in both.
Often, we want a completely different copy, referred to as a deep copy. With a deep copy,
A and B would refer to different memory blocks. Changes to one would not affect the
other. This distinction is illustrated in Figure 7.5.
7.3. Multidimensional Arrays
A normal array is usually one dimensional. One can think an array as a single “row” in a
table that contains a certain number of entries. Most programming languages allow you
to define multidimensional arrays. For example, two dimensional arrays would model
having multiple rows in a full table. You can also view two dimensional arrays as matrices
in mathematics. A matrix is a rectangular array of numbers that have a certain number
of rows and a certain number of columns.
As an example, consider the following 2 × 3 matrix (it has 2 rows and 3 columns):
1 9 −8
2.5 3 5
In mathematics, entries in a matrix are indexed via their row and column. For example,
ai,j would refer to the element in the i-th row and j-th column. Referring to the row
first and column second is referred to as row major ordering. If the number of rows and
the number of columns are the same, the matrix is referred to as a square matrix. For
example, the following is a square, 10 × 10 matrix.
2 68 9 44 80 79 77 59 27 2
3 86 22 42 58 24 45 39 7 47
5 7 17 12 29 56 68 14 65 3
7 35 64 69 79 56 52 77 82 85
11 55 36 5 25 6 22 25 72 37
13 20 37 74 3 53 87 70 3 78
17 72 68 26 11 6 63 70 29 16
19 59 6 26 87 18 82 27 75 19
23 73 30 80 51 14 34 67 59 58
29 48 2 39 18 21 33 28 40 34
166
7.4. Other Collections
We can do something similar in most programming languages. First, languages may
vary in how you can create multidimensional arrays, but you usually have to provide a
size for each dimension when you create them. Once created, you can index them by
providing multiple indices. For example, with a two dimensional array, we could provide
two indices each in their own square brackets arr[i][j] referring to the i-th row and
j-th column. Multidimensional arrays usually use the same 0-indexing scheme as single
dimensional arrays.
You can further generalize this and create 3-dimensional arrays, 4-dimensional arrays, etc.
However, the use cases for arrays of dimension 3 and certainly for arrays of dimension
4 or greater are rare. If you need to store such data, it may be more appropriate to
define a custom, user-defined structure or object (see Chapter 10) instead of a higher
dimensional array.
We usually think of 2-dimensional arrays as having the same number of elements in
each “row”. In the example above, both of the matrix’s rows had 3 elements in it. Some
languages allow you to create 2-dimensional arrays with a different number of elements
in each row. Special care must be taken to ensure that you do not index an element that
does not exist.
7.4. Other Collections
Aside from basic arrays, many languages have rich libraries of other dynamic collections.
Dynamic collections are not the same thing as dynamically allocated arrays. Once an
array is created, its size is fixed and cannot, in general, be changed. However, dynamic
collections can grow (and shrink) as needed when you add or remove elements from them.
Lists are ordered collections that are essentially dynamic arrays. Lists are ordered and
are usually zero-indexed just like arrays. Lists are generally objects and provide methods
that can be used to add, remove, and retrieve elements from the list. If you add an
element to a list, the list will automatically grow to accommodate it, so its size is not
fixed when created. Two common implementations of lists are array-based lists and
linked lists. Array-based lists indexarray-based list use an array to store elements. When
the array fills up, the list allocates a new, larger array to hold more elements, copying the
original contents over to the new array with a larger capacity. Linked lists hold elements
in nodes that are linked together. Adding a new element simply involves creating a new
node and linking it to the last element in the list.
Some languages also define what are called sets. Sets allow you to store elements
dynamically just like lists, but sets are generally unordered. There is no concept of a
first, second, or last element in a set. Iterating over the elements in a set could result
in a different enumeration of the elements each time. Elements in sets are also usually
unique. For example, a set containing integers would only ever contain one instance of
167
7. Arrays, Collections & Dynamic Memory
each integer. The value 10, for example, would only ever appear once. If you added 10
to a set that already contained it, the operation would have no effect on the set.
Another type of dynamic array are associative arrays (sometimes called dictionaries).
An associative array holds elements, but may not be restricted in how they are indexed.
In particular, a language that supports associative arrays may allow you to use integers
or strings as indices, or even any arbitrary object. Further, when using integers to index
elements, indices need not be fully defined nor contiguous. In an associative array you
could define an element at index 5 and then place the next element at index 10, skipping
index 6 through 9 which would remain undefined.
One way to look at associative arrays is as a map. A map is a data structure that
stores elements as key-value pairs. Both they keys and values could be any arbitrary
type (integers or strings) or object depending on the language. You could map account
numbers (stored as strings) to account objects, or vice versa. Using a smart data structure
like a map can make data manipulation a lot easier and more straightforward.
7.5. Exercises
Exercise 7.1. Write a function to return the index of the maximum element in an array
of numbers.
Exercise 7.2. Write a function to return the index of the minimum element in an array
of numbers.
Exercise 7.3. Write a function to compute the mean (average) of an array of numbers.
Exercise 7.4. Write a function to compute the standard deviation of an array of numbers,
v
u
u1 X N
σ= t (xi − µ)2
N i=1
where µ is the mean of the array of numbers.
Exercise 7.5. Write a function that takes two arrays of numbers that are sorted and
merges them into one array (retuning a new array as a result).
Exercise 7.6. Write a function that takes an integer n and produces a new array of size
n filled with 1s.
Exercise 7.7. Write a function that takes an array of numbers are computes returns
the median element. The median is defined as follows:
n+1
• If n is odd, the median is the 2
-th largest element
168
7.5. Exercises
n
• If n is even, the median is the average of the 2
and the ( n2 + 1)-th largest elements
Exercise 7.8. The dot product of two arrays (or vectors) of the same dimension is
defined as the sum of the product of each of their entries. That is,
n
X
ai × b i
i=1
Write a function to compute the dot product of two arrays (you may assume that they
are of the same dimension)
Exercise 7.9. The norm of an n-dimensional vector, ~x = (x1 , x2 , . . . , xn ) captures the
notion of “distance” in a higher dimensional space and is defined as
q
k~xk = x21 + · · · + x2n
Write a function that takes an array of numbers that represents an n-dimensional vector
and computes its norm.
Exercise 7.10. Write a function that takes two arrays A, B and creates and returns a
new array that is the concatenation of the two. That is, the new array will contain all
elements a followed by all elements in b.
Exercise 7.11. Write a function that takes an array of numbers A and an element x
and returns true/false if A contains x
Exercise 7.12. Write a function that takes an array of numbers A, an element x and
two indices i, j and returns true/false if A contains x somewhere between index i and j.
Exercise 7.13. Write a function that takes an array of numbers A and an element x
and returns the multiplicity of x; that is the number of times x appears in A.
Exercise 7.14. Write a function to compute a sliding window mean. That is, it computes
the average of the first m numbers in the array. The next value is the average of the
values index from 1 to m, then 2 to m + 1, etc. The last window is the average of the
last m elements. Obviously, m ≤ n (for m = n, this is the usual mean). Since there is
more than one value, your function will return a (new) array of means of size n − m + 1.
Exercise 7.15. Write a function to compute the mode of an array of numbers. The
mode is the most common value that appears in the array. For example, if the array
contained the elements 2, 9, 3, 4, 2, 1, 8, 9, 2, the mode would be 2 as it appears more than
any other element. The mode may not be unique; multiple elements could appear the
same, maximal number of times. Your function should simply return a mode.
Exercise 7.16. Write a function to find all modes of an array. That is, it should find
all modes in an array and return a new array containing all the mode values.
169
7. Arrays, Collections & Dynamic Memory
Exercise 7.17. Write a function to filter out certain elements from an array. Specifically,
the function will create a new array containing only elements that are greater than or
equal to a certain threshold δ.
Exercise 7.18. Write a function that takes an array of numbers and creates a new
“deep” copy of the array. In addition, the function should take a new “size” parameter
which will be the size of the copy. If the new size is less than the original, then the new
array will be a truncated copy. If the new size is greater then the copy will be padded
with zero values at the end.
Exercise 7.19. Write a function that takes an array A and two indices i, j and returns
a new array that is a subarray of A consisting of elements i through j.
Exercise 7.20. Write a function that takes two arrays A, B and creates and returns a
new array that represents the unique intersection of A and B. That is, an array that
contains elements that are in both A and B. However, elements should not be included
more than once.
Exercise 7.21. Write a function that takes two arrays A, B and creates and returns a
new array that represents the unique union of A and B. That is, an array that contains
elements that are either in A or B (or both). However, elements should not be included
more than once.
Exercise 7.22. Write a function that takes an array of numbers and returns the sum of
its elements.
Exercise 7.23. Write a function that takes an array of numbers and two indices i, j
and computes the sum of its elements between i and j inclusive.
Exercise 7.24. Write a function that takes two arrays of numbers and determines if
they are equal : that is, each index contains the same element.
Exercise 7.25. Write a function that takes two arrays of numbers and determines if
they both contain the same elements (though are not necessarily equal) regardless of
their multiplicity. That is, the function should return true even if the arrays’ elements
appear a different number of times or in a different order. For example [2, 2, 3] would be
equal to an array containing [3, 2, 3, 3, 3, 2, 2, 2].
Exercise 7.26. A suffix array is a lexicographically sorted array of all suffixes of a string.
Suffix arrays have many applications in text indexing, data compression algorithms and
in bioinformatics. Write a program that takes a string and produces its suffix array.
For example, the suffixes of science are science , cience , ience , ence , nce , ce ,
and e . The suffix array (sorted) would look something like the following.
170
7.5. Exercises
ce
cience
e
ence
ience
nce
science
Exercise 7.27. An array of size n represents a permutation if it contains all integers
0, 1, 2, . . . , (n−1) exactly once. Write a function to determine if an array is a permutation
or not.
Exercise 7.28. The k-th order statistic of an array is the k-th largest element. For our
purposes, k starts at 0, thus the minimum element is the 0-th order statistic and the
largest element is the n − 1-th order statistic.
Another way to view it is: suppose we were to sort the array, then the k-th order statistic
would be the element at index k in the sorted array. Write a function to find the k-th
order statistic.
Exercise 7.29. Write a function that takes two n × n square matrices A, B and returns
a new n × n matrix C which is the product, A × B. The product of two matrices of
dimension n × n is defined as follows:
n
X
cij = aik bkj
k=1
Where 1 ≤ i, j ≤ n and cij is the (i, j)-th entry of the matrix C.
Exercise 7.30. We can multiply a matrix by a single scalar value x by simply multiplying
each entry in the matrix by x. Write a function that takes a matrix of numbers and an
element x and performs scalar multiplication.
Exercise 7.31. Write a function that takes two matrices and determines if they are
equal (all of their elements are the same).
Exercise 7.32. Write a function that takes a matrix and an index i and returns a new
array that contains the elements in the i-th row of the matrix.
Exercise 7.33. Write a function that takes a matrix and an index j and returns a new
array that contains the elements in the j-th column of the matrix.
Exercise 7.34. Iterated Matrix Multiplication is where you take a square matrix, A
and multiply it by itself k times,
Ak = A
| ×A×
{z· · · × A}
k times
Write a function to compute the k-th power of a matrix A.
171
7. Arrays, Collections & Dynamic Memory
Exercise 7.35. The transpose of a square matrix is an operation that “flips” the matrix
along the diagonal from the upper left to the lower right. In particular the values mi,j
and mj,i are swapped. Write a function to transpose a given matrix
Exercise 7.36. Write a function that takes a matrix, a row index i, and a number x
and adds x to each value in the i-th row.
Exercise 7.37. Write a function that takes a matrix, a row index i, and a number x
and multiples each value in the i-th row with x.
Exercise 7.38. Write a function that takes a matrix, and two row indices i, j and swaps
each value in row i with the value in row j
Exercise 7.39. A special matrix that is often used is the identity matrix. The identity
matrix is an n × n matrix with 1s on its diagonal and zeros everywhere else. Write a
function that, given n, creates a new n × n identity matrix.
Exercise 7.40. Write a function to convert a matrix of integers to floating point numbers.
Exercise 7.41. Write a function to determine if a given matrix is a permutation matrix.
A permutation matrix is a matrix that represents a permutation of the rows of an identity
matrix. That is, A is a permutation matrix if every row and every column has exactly
one 1 and the rest are zeros.
Exercise 7.42. Write a function to determine if a given square matrix is symmetric. A
matrix is symmetric if mi,j = mj,i for all i, j.
Exercise 7.43. Write a function to compute the trace of a matrix. The trace of a matrix
is the sum of its elements along its diagonal.
Exercise 7.44. Write a function that returns a “resized” copy of a matrix. The function
takes a matrix of size n × m (not necessarily square) and creates a copy that is p × q (p, q
are part of the input to the function). If p < n and/or q < m, the values are “cut off”. If
p > n and/or q > m, the matrix is padded (to the right and to the bottom) with zeros.
Exercise 7.45. A submatrix is a matrix formed by selecting certain rows and columns
from a larger matrix. Write a function that constructs a submatrix from a larger matrix.
To do so, the function will take a matrix as well as two row indices i, j and two column
indices k, ` and it will return a new matrix which consists of entries from the i-th row
through the j-th row and k-th column through the `-th column.
For example, if A is
8 2 4 1
A = 10 4 2 3 .
12 42 1 0
then a call to this function with i = 1, j = 2, k = 2, ` = 3) should result in
2 3
A= .
1 0
172
7.5. Exercises
Exercise 7.46. The Kronecker product (http://en.wikipedia.org/wiki/Kronecker_
product) is a matrix operation on two matrices that produces a larger block matrix.
Specifically, if A is an m × n matrix and B is a p × q matrix, then the Kronecker product
A ⊗ B is the mp × nq block matrix:
a11 B · · · a1n B
A ⊗ B = ... .. ..
. .
am1 B · · · amn B
more explicitly:
a11 b11 a11 b12 ··· a11 b1q ··· ··· a1n b11 a1n b12 ··· a1n b1q
a11 b21 a11 b22 ··· a11 b2q ··· ··· a1n b21 a1n b22 ··· a1n b2q
.. .. .. .. .. ..
. ... ...
. . . . .
a11 bp1 a11 bp2
. ··· a11 bpq · · · · · · a1n bp1 a1n bp2 · · · a1n bpq
. .. .. .. .. .. ..
. . . . . . .
A⊗B= . .. .. ... .. .. .. .
.. . . . . .
a b
m1 11 am1 b12 · · · am1 b1q · · · · · · amn b11 amn b12 · · · amn b1q
a b
m1 21 am1 b22 · · · am1 b2q · · · · · · amn b21 amn b22 · · · amn b2q
.. .. ... .. .. .. ... ..
. . . . . .
am1 bp1 am1 bp2 · · · am1 bpq · · · · · · amn bp1 amn bp2 · · · amn bpq
Write a function that computes the Kronecker product.
Exercise 7.47. The Hadamard product is an entry-wise product of two matrices of
equal size. Let A, B be two n × m matrices, then the Hadamard product is defined as
follows.
a11 a12 · · · a1m b11 b12 · · · b1m a11 b11 a12 b12 · · · a1m b1m
a21 a22 · · · a2m b21 b22 · · · b2m a21 b21 a22 b22 · · · a2m b2m
A◦B = .. .. ◦ .. .. = ..
.. . . .. . . .. . . ..
. . . . . . . . . . . .
an1 an2 · · · anm bn1 bn2 · · · bnm an1 bn1 an2 bn2 · · · anm bnm
Write a function to compute the Hadamard product of two n × m matrices.
173
7. Arrays, Collections & Dynamic Memory
Stack Frame Variable Address Content
.. ..
. .
b[4] 0x5c44cb76 25
b[3] 0x5c44cb72 20
b[2] 0x5c44cb68 15
b[1] 0x5c44cb64 10
b[0] 0x5c44cb60 5
i 0x5c44cb56 5
foo n 0x5c44cb52 5
.. ..
. .
a 0x5c44cb34 NULL
m 0x5c44cb30 5
main i 0x5c44cb26 0
(a) Program stack at the end of the execution of foo() prior to
returning control back to main() .
Stack Frame Variable Address Content
.. ..
. .
b[4] 0x5c44cb76 -626679356
b[3] 0x5c44cb72 20
b[2] 0x5c44cb68 15
b[1] 0x5c44cb64 32767
b[0] 0x5c44cb60 1564158624
i 0x5c44cb56 5
foo n 0x5c44cb52 5
.. ..
. .
a 0x5c44cb34 0x5c44cb60
m 0x5c44cb30 5
main i 0x5c44cb26 0
(b) Upon returning, the stack frame is no longer valid; the pointer
variable a points to a stack memory address but the frame and
its local variables are no longer valid. Some have been overwritten
with other values. Subsequent usage or access of the values in a are
undefined behavior.
Figure 7.3.: Illustration of the pitfalls of returning a static array in C. Static arrays
are locally scoped and exist only within the function/block in which they
are declared. The program stack frame in which the variables are stored
is invalid when the function returns control back to the calling function.
Depending on how the system/compiler/language handles this unwinding
process, values may be changed, unavailable, etc.
174
7.5. Exercises
Heap Growth
Allocated Heap
Available Heap
Available Stack
Allocated Stack
Static Content
Stack Growth
Program Code
Figure 7.4.: Depiction of Application Memory. The details of how application memory
is allocated and how the stack/heap “grow” may vary depending on the
architecture. The figure shows stack memory growing “upward” while heap
allocation grows “downward.” Allocation and deallocation may fragment
the heap space though.
175
7. Arrays, Collections & Dynamic Memory
0 1 2 3 4 5 6 7 8 9
A 2 3 5 7 11 13 17 19 23 29
B
(a) A shallow copy. B refers to A which refers to the array. Thus, B implicitly
refers to the same array.
0 1 2 3 4 5 6 7 8 9
A 2 3 5 7 11 13 -1 19 23 29
B
(b) When an element in a shallow copy is changed, A[6] = -1; , it is changed
from the perspective of both A and B.
0 1 2 3 4 5 6 7 8 9
A 2 3 5 7 11 13 17 19 23 29
0 1 2 3 4 5 6 7 8 9
B 2 3 5 7 11 13 17 19 23 29
(c) A deep copy. B refers to its own copy of the array distinct from A. Both are
stored in separate memory locations.
0 1 2 3 4 5 6 7 8 9
A 2 3 5 7 11 13 -1 19 23 29
0 1 2 3 4 5 6 7 8 9
B 2 3 5 7 11 13 17 19 23 29
(d) When an element in a deep copy is changed, A[6] = -1; , it is changed
only in the array A. The element in B is unaffected.
Figure 7.5.: Shallow copies are when two references refer to the same data in memory
(a) and (b). Changes to one affect the other. Deep copies (c) and (d) are
distinct data in memory, changes to one do not affect the other.
176
8. Strings
A string is an ordered sequence of characters. We’ve previously seen string data types
as literals. Most languages allow you to define and use static string literals using the
double quote syntax. We used strings to specify output formatting using printf() -style
functions for example. When reading input from a user, we read it as a string and
converted the input to numbers. We also described some basic operations on strings
including concatenation. We now examine strings in more depth.
Programming languages vary greatly in how they represent string data types. Some
languages have string types built-in to the language and others require that you use
arrays and yet others treat strings as a special type of object. One issue with string
representations is determining where and how the string ends. Some languages use a
length prefix string representation. The length (the number characters in the string)
is stored in a special location at the beginning of a string. Then the string characters
are stored as an array. Other Object-Oriented Programming (OOP) languages use a
special character, the null-terminating character to denote the end of a string. Still
other languages store strings as arrays or dynamic arrays and the “bookkeeping” is done
internally as part of an object representation.
Other details vary as well. Most languages support the basic ASCII characters, others
have full Unicode support or support Unicode through a library. Most languages also
provide large libraries of functions and operations that make working with strings easier.
8.1. Basic Operations
Depending on how a language supports strings, it may support various basic operations
to create strings and assign them to variables. Usually languages allow you to create
and use string literals using the double quote syntax. Modifying a string or copying
one string into another may be supported by the built-in assignment operator or it may
require the use of a copy function. When copying strings, similar issues come into play
as with arrays. The “copy” could be a shallow copy or a deep copy (see Section 7.2.2).
Other basic operations may include accessing and/or modifying individual characters
in a string. In order to do so, we may also need to know a string’s length (so that we
do not access invalid characters). A language could provide this as part of the string
177
8. Strings
itself (usually called a property of the string) or through a function call. We can further
use such functionality to iterate over the individual characters in a string using an
index-controlled for-loop.
More advanced operations on strings include concatenation which is the operation of
combining one or more strings to create a new string. Concatenation simply appends one
string to the end of another string. Another common operation is to extract a substring
from a string, that is create a new string from a portion of another string. Commonly,
this is done via some standard function that may operate by specifying indices and/or
the length of the desired substring. Finally, it is also common to deal with collections
of strings. Some languages allow you to create arrays of strings or dynamic collections
(lists or sets) of strings. for languages in which strings are arrays of characters, an array
of strings might be implemented with a 2-dimensional array of characters.
8.2. Comparisons
When processing strings there are several other standard operations. In particular, we
often have need to make comparisons between two string variables or between a string
variable and a literal. Some languages allow you to use the same operators such as ==
or even < to make comparisons between strings. The implied behavior would compare
strings for equality (case sensitive) or for lexicographic order. For example “Apple” <
“Banana” might evaluate to true because “Apple” precedes “Banana” in alphabetic order.
Many languages, however, require that you make string comparisons using a function.
Using the equality operator == may be correct syntactically, but is usually making a
pointer or reference comparison which evaluates to true if and only if the two variables
represent the same memory address. Even if two string variables have the same content,
the equality operator may evaluate to false if they are distinct (deep) copies of the same
string. Likewise, the inequality operators <, ≤, etc. may only be comparing memory
addresses which is meaningless for comparing strings.
The solution that many languages provide is the use of a comparator, which is either a
function or an object that facilitates the comparison of strings (and more generally, any
object). Generally, a comparator function takes two arguments, a, b and compares them,
not just for equality, but for their relative order: does a “come before” b or does b “come
before” a, or are they equal. To distinguish between these three cases, a comparator
returns an integer value with the following general contract: it returns
• Something negative if a < b
• Zero if a = b
• Something positive if a > b
178
8.3. Tokenizing
Using this contract we can determine the relative ordering of any two strings. In general
we cannot make any assumptions about the actual value that a comparator returns, only
that it returns something negative or positive. The actual magnitude of the returned
value need not be −1 or +1, and it may not even have any predefined meaning.
8.3. Tokenizing
It is common to store different pieces of data as a string such that each individual piece
of data is demarcated by some delimiter. For example, Comma Separated Values (CSV)
or Tab Separated Values (TSV) data use commas and tabs to delimit data. For example,
the string
Smith,Joe,12345678,1985-09-08
is a CSV string holding data about a particular person (last name, first name, ID, date
of birth). Often we need to process such strings to extract each individual piece of data.
Processing such strings is usually referred to as parsing. In particular, a string is “split”
into a collection of individual strings called tokens (thus the process is also sometimes
referred to as tokenizing). In the example above, the string would be processed into
4 individual strings, Smith , Joe , 12345678 , and 1985-09-08 . Each string could
further be tokenized if needed, such as parsing the date of birth to extract the year,
month, and date.
Most languages provide a function to facilitate tokenization. Some do so by directly
returning an array or collection of the resulting tokens (usually with the delimiter
removed). Others have a more manual process that requires a loop structure to iterate
over each token.
8.4. Exercises
Exercise 8.1. Write functions to reverse a string. If appropriate, write versions to do
so by manipulating a given string and returning a new string that is a reversed copy.
Exercise 8.2. Write a function to replace all spaces in a string with two spaces.
Exercise 8.3. Write a program to take a phrase (International Business Machines) and
“acronymize” it by producing a string that is an upper-cased string of the first letter of
each word in the phrase (IBM).
Exercise 8.4. Write a function that takes a string containing a word and returns a
pluralized version according to the following rules.
179
8. Strings
1. If the noun ends in “y,” remove the “y” and add “ies”
2. If the noun ends in “s,” “ch,” or “sh,” add “es”
3. In all other cases, just add “s”
Exercise 8.5. Write a function that takes a string and determines if it is a palindrome
or not. A palindrome is a word that is spelled exactly the same when the letters are
reversed.
Exercise 8.6. Write a function to compute the longest common prefix of two strings.
For example, the longest common prefix of “global” and “glossary” is “glo”. If two
strings have no common prefix, then the longest common prefix is the empty string.
Exercise 8.7. Write a function to remove any whitespace from a given string. For exam-
ple, if the string passed to the function contains "Hello World How are you? "
then it should result in the string "HelloWorldHowareyou?"
Exercise 8.8. Write a function that takes a string and flips the case of each alphabetic
character in it. For example, if the input string is "GNU Image Processing Tool-Kit"
then it should output "gnu iMAGE pROCESSING tOOL-kIT"
Exercise 8.9. Write a function to validate a variable name according to the rules that it
must begin with an alphabetic character, a–z or A–Z but may contain any alphanumeric
character a–z, A–Z, 0–9, or underscores _ . Your function should take a string with a
possible variable name and return true or false depending on whether or not it is valid.
Exercise 8.10. Write a function to convert a string that represents a variable name using
under_score_casing to lowerCamelCasing . That is, it should remove all underscores,
and replace the first letter of each word with an uppercase (except the first word).
Exercise 8.11. Write a function that takes a string and another character c and counts
the number of times that c appears in the string.
Exercise 8.12. Write a function that takes a string and another character c and removes
all instances of c from the string. For example, a call to this function on the string
"Hello World" with c being equal to 'o' would result in the string "Hell Wrld" .
Exercise 8.13. Write a function that takes a string and two characters, c and d and
replaces all instances of c with d.
Exercise 8.14. Write a function to determine if a given string s contains a substring t.
The function should return true if t appears anywhere inside s and false otherwise.
Exercise 8.15. Write a function that takes a string s and returns a new string that
contains the first character of each word in s capitalized. You may assume that words
are separated by a single space. For example, if we call this function with the string
"International Business Machines" it should return "IBM" . If we call it with the
string "Flint Lockwood Diatonic Super Mutating Dynamic Food Replicator" it
should return "FLDSMDFR"
180
8.4. Exercises
Exercise 8.16. Write a function that trims leading and trailing white space from a
string. Inner whitespace should not be modified.
Exercise 8.17. Write a function that splits a string containing a unix path/file into its
three components: the directory path, the file base name and the file extension. For
example, if the input string is /usr/home/message.txt then the three components
would be /usr/home/ , message and txt respectively. For the purposes of this function,
you may assume that the path ends with the last forward slash (or is empty if none) and
that the extension is always after the last period. That is, you should be able to handle
inputs such as ../foo/bar/baz.old.txt .
Exercise 8.18. Write a function that (re)formats a string representing a telephone
number. Phone numbers can be written using a variety of formats, for example
1-402-555-1234 or +4025551234 or 402 555-1234 , etc. Assume that you will only
deal with 10 digit US phone numbers. Create a new string that uses the “standard”
format of (402) 555-1234 .
Exercise 8.19. Write a function that takes a string and splits it up to an array of
strings. The split will be length-based: the function will also take an integer n and will
split the given string up into strings of length n. It is possible that the last string will
not be of length n.
For example, if we pass "Hello World, how are you?" with n = 3 then it should
return an array of size 9 containing the strings "Hel" , "lo " , "Wor" , "ld," , " ho" ,
"w a" , "re " , "you" , "?"
Exercise 8.20. HyperText Markup Language (HTML) (Hypertext Markup Language)
is the primary document description language for the World Wide Web (WWW). Certain
characters are not rendered in browsers as they are special characters used in HTML; in
particular tags which begin and end with the < and > .
To display such characters correctly they need to be escaped (similar to how you need
to escape tabs \t and endline \n characters). Properly escaping these characters
is not only important for proper rendering, but there are also security issues involved
(Cross-Site Scripting Attacks).
Write a function that takes a string and escapes the HTML characters in Table 8.1.
Replace the following with this
& &
< <
> >
" "
Table 8.1.: Replacement HTML Characters
181
9. File Input/Output
A file is a block of data used for storing information. Normally, we think of a file as
something that is stored on a hard drive (or memory stick or other physical media),
but the concept of a file is much more general. For example, when a file is loaded
(“read”) by a program it then exists in main memory. An executable program itself is a
file (containing instructions to be executed), both stored on the hard drive and run in
memory.
In a typical unix-based system, everything is a file. Directories are files, executables are
files, devices are files, etc. Even the familiar standard input and standard output are
buffers that are treated as files that can be read from or written to.
Data files may be stored as binary data or as plaintext files. Plaintext files are still stored
as binary data, but are stored in an encoding using the ASCII text values. Binary files
will also have structure, but it depends on the application that produced the file to give
meaning to the data. For example, an image file in a Joint Photographic Experts Group
(JPEG) format is essentially just binary data but it has a very specific format that an
image viewer would be able to process, but, say, a text editor would not. Further, if the
binary format is corrupted, the image viewer might not be able to display the image
correctly
Typical programs are short lived, anywhere from a few milliseconds to maybe a user
“session.” We often want data to be saved across multiple runs of a program. We need
to save it or persist it in some durable storage medium (disk). Files provide a way to
achieve data persistence.
9.1. Processing Files
In general, processing data in a file involves three basic steps:
1. Open (or create) the file
2. Read from (or write to) the file
3. Close the file
183
9. File Input/Output
Depending on the language, the act of opening a file may determine if it will be read
from or written to. When read from, the file is referred to as an input file while a file
that is written to is an output file. Languages may also have different a different API or
functions to read/write or append to a file.
A file may be read line by line until the end of the end of the file has been reached.
Languages usually support this by using a special End Of File (EOF) flag or value to
indicate the end of a file has been reached.
A file is a resource just like memory and we need to properly manage it. We need to
make sure that we close a file once we are finished processing it. Depending on the
language and other factors such as the operating system, failure to close a file may result
in corrupted data. Though a file may be closed automatically for us when the program
terminates, its still best practice to properly close it.
9.1.1. Paths
When opening a file on a file system, it is necessary to specify which file you want to open.
This is typically done by specifying at least the name of the file. Often files will have
“extensions” which indicate the type of file it is such as .txt for text files or .html for
HTML files. However, file extensions are only for organizational purposes and have no
real bearing on what data is stored in the file.
More important is the path of the file. Usually, if no path is specified, then implicitly
we are opening the file in the Current Working Directory (CWD). For example, if we
open the file data.txt then we are opening the file in the same directory in which our
program is executing. When specifying a path we can either specify an absolute path
or a relative path. An absolute path specifies each and every subdirectory in the file
system from the root to the directory that the file is located in. The root directory is the
top-most directory in the file system. Each subdirectory is separated by some delimiter.
Windows systems use a backslash as a directory delimiter while the root directory is
specified using a “volume” name such as C:\ . For example, an absolute path on a
Windows system may look something like:
C:\applications\users\data\data.txt
On a Unix-based system, a forward slash is used as a directory delimiter and the root
directory is simply a single forward slash. The same directory structure in a Unix-based
system would look like the following.
/applications/users/data/data.txt
A path may also be relative to the current working directory. In most systems (Windows
and Unix-based) the current directory is denoted using a single period, . . You can use
184
9.1. Processing Files
this to specify directories deeper in the directory tree from the current directory. For
example (in Unix),
./app/data/data.txt
would refer to the directory app in the current working directory, the directory data
within that, and finally the file data.txt within that directory.
We can also refer to files further up the directory tree using the “parent” directory symbol
which is two periods, .. . For example,
../../system/data.txt
would refer to a file two levels up in the subdirectory system .
9.1.2. Error Handling
When dealing with files there are many potential error conditions that may be anticipated
and may need to be dealt with. Some types of errors that can occur include the following.
• Permission errors – Your program may not have the proper permissions to read or
write to a particular directory or file. For example, user-level processes typically
do not have permissions to read system-level files (such as password files) nor can
they write to them lest they corrupt critical system data.
• File Not Found errors – Your program may attempt to open a file that does not
exist. Sometimes, particularly when writing, the file will be created if it does not
exist. However, for reading, this may be a serious error.
• I/O Errors – We may be able to successfully find and open a file, but while
processing it something might go wrong with the file system that results in a
general input/output error.
• Formatting errors – As previously mentioned, the format of a file is highly dependent
on the application that created it (though there are universal data formats such as
XML or JavaScript Object Notation (JSON)). If the format is not as expected the
file may be corrupted and the program may not be able to successfully read data
from it.
Depending on the language, these errors may be fatal or may result in error codes or
error values that can be dealt with. Or they may result in exceptions that can be caught
and handled.
185
9. File Input/Output
/proc/self/
|-- attr
|-- cwd -> /proc
|-- fd
| `-- 3 -> /proc/15589/fd
|-- fdinfo
|-- net
| |-- dev_snmp6
| |-- netfilter
| |-- rpc
| | |-- auth.rpcsec.context
| | |-- auth.rpcsec.init
| | |-- auth.unix.gid
| | |-- auth.unix.ip
| | |-- nfs4.idtoname
| | |-- nfs4.nametoid
| | |-- nfsd.export
| | `-- nfsd.fh
| `-- stat
|-- root -> /
`-- task
`-- 15589
|-- attr
|-- cwd -> /proc
|-- fd
| `-- 3 -> /proc/15589/task/15589/fd
|-- fdinfo
`-- root -> /
Figure 9.1.: The Linux file system (like most file systems), defines a tree directory
structure. Each file and directory is contained in subdirectories all contained
within the root directory, / . This diagram was generated by the Tree
command, http://mama.indstate.edu/users/ice/tree/.
186
9.1. Processing Files
9.1.3. Buffered and Unbuffered
When processing files the input/output may be either buffered or unbuffered. A buffered
input or output “stream” is one in which data that is read/written is actually stored in
memory in a “buffer” until such a time as the buffer is “flushed” and the accumulated
data is passed to/from the actual file.
For example, in a buffered output file, our program could write several kilobytes of data
to the output file, but it might not actually be written to the file right away. Instead,
those kilobytes of data are stored in memory until the buffer fills up or some other event
takes place to cause the buffer to be flushed. At that point, the data stored in the buffer
is emptied and written to the file.
Buffered input/output is used because I/O operations are expensive in terms of system
resources and can slow the system down. Because of this, it is better to keep I/O
operations as infrequent as possible. Buffers help to reduce the number of I/O operations
performed by a program by making them less frequent.
There are some instances in which we want unbuffered I/O. When error messages are
written to the standard error output for example, we would prefer to know about errors
as soon as possible rather than waiting for error messages to accumulate in a buffer.
Using an unbuffered output means that data is written to the standard error (which is a
file) immediately. However, because errors are (hopefully) infrequent and (likely) fatal,
this is not a performance issue.
9.1.4. Binary vs Text Files
As previously mentioned, files can be stored as pure binary data or as plaintext (ASCII).
Depending on our application and the nature of the data being written to files, the choice
of which to use may be clear. If we want the data in our files to be human-readable, then
we need to store them as plaintext. However, in general, we should prefer storing data in
a binary format. The reason for this is that binary generally requires less space and is
more efficient to process.
Consider as an example, storing a collection of integers in a file. Each integer requires 4
bytes when represented in binary. However, when represented as a string, it requires as
many bytes as there are digits in the number. For example, the maximum representable
value of such an integer would be 231 − 1 = 2, 147, 483, 647, requiring 10 ASCII characters
and thus 10 bytes to represent, two and a half times as much memory as with the binary
representation. Further, if a lot of numbers are stored, each number (as a string) would
need to be delimited by yet another character. With a binary representation, no delimiter
would be necessary as we would know that each 4 byte block represents a single number.
This disparity can be even more stark with other types such as floating-point numbers.
187
9. File Input/Output
There are additional performance issues when reading/writing the data and converting
binary numbers to their string representations. With binary data no such parsing is
necessary. As long as the data does not need to be human-readable, binary formats
should be preferred.
9.2. Exercises
Exercise 9.1. Write a function that takes a string representing a file name and opens
and processes the file, returning all of its contents as a single string.
Exercise 9.2. Consider an irregular, 2-D simple polygon with n points,
(x1 , y1 ), (x2 , y2 ), . . . , (xn , yn )
The area A of the polygon can be computed as
n−1
1X
A= (xi yi+1 − xi+1 yi )
2 i=0
Note, that the initial and end point will be the same, (x0 , y0 ) = (xn , yn ). An example
polygon for n = 5 can be found in Figure 9.2.
Figure 9.2.: An example polygon for n = 5
Write a program to open and process a text file containing n coordinates. In particular,
the first line is a single integer n that indicates how many points should be read in. Each
line after that has the x, y coordinates of each point separated by a single space.
4
1.0 0.0
13.2 1.25
20.5 18.4
16.37 24.54
188
9.2. Exercises
After reading the file in, it will compute the area of the polygon according to the formula
above and output it to the user. For example, the output for the above file may be
something like Area of the polygon: 197.9135
Exercise 9.3. Write a program that processes an input text file and scrubs it of any
HTML characters that need to be escaped (see Exercise 8.20 for details). It should
produce a new output file with all special characters escaped.
Exercise 9.4. Write a program that spell checks a plain text file. The program will
open a text file and process each word separately, checking for proper spelling against a
standard dictionary.
You may assume that each word is separated by some whitespace (you may assume that
there are no multi-line hyphenated words). However, you should ignore all punctuation
(periods, question marks, etc.).
Use a standard American dictionary provided on your unix system which stores words
one per line. Your output should include all misspelled or unrecognized words (words
not contained in the dictionary file).
Exercise 9.5. A standard word search consists of an n × n grid in which there are a
number of words hidden, some intersecting, with dummy letters filling in the blanks. An
example is provided in Figure 9.3.
Figure 9.3.: A Word Search
Write a program to solve a word search. Your program will read in an input file with
the following format: the first line will contain a single integer n which is followed by n
lines with n characters (not including the end line character) corresponding to the word
search.
Once you read in the word search, you will iterate through all possible words running
down, right, or diagonally down-right. You will attempt to match each possibility against
a standard English dictionary. If the word matches a word in the dictionary, output it to
the standard output, otherwise ignore it. To simplify, you may restrict your attention to
words that have a length between 3 and 8 (inclusive).
189
9. File Input/Output
Exercise 9.6. Write a crossword puzzle cheater. The program will take, as input, a
“partial” word in a crossword puzzle. That is, some of the letters are known (from other
solved clues) while some of the letters are not known. For the purposes of this exercise,
we’ll use a hyphen as a placeholder for missing letters.
Your program will match the partial word against words in a standard English dictionary
and list all possible matches. For example, if the user provided foo- as input it might
match food , fool , and foot .
Exercise 9.7. Bridge is a four player (2 team) game played with a standard 52-card
deck. Prior to play, a round of bidding is performed to determine which team is playing
for or against the contract, the trump suit, and at what level. Understanding the rules of
the game or the bidding conventions involved are not necessary for this exercise. Instead,
write a program to assist players in how they should bid based on the following point
system.
A standard 52-card deck is dealt evenly to 4 different hands (Players 1 thru 4, 13 cards
each). Each player’s hand is worth a number of points based on the following rules:
• Each Ace in the hand is worth 4 points
• Each King is worth 3
• Each Queen is worth 2
• Each Jack is worth 1
• For each suit (Diamond, Spade, Club, Heart) such that the hand has only 2 cards
(a “doubleton”) an additional point is added
• For each suit that the hand has only 1 card in (a “singleton”) two additional points
are added
• For each suit that the hand has no cards (a “void”) 3 additional points are added.
Write a program that reads in a text file containing a deal. The formatting is as
follows: the input file will have 4 lines, one for each player. Each line contains the cards
dealt to that player delimited by a single space. The cards are indicated by the rank
(A, K, Q, J, 10, 9, . . . , 2) and the suit (D, S, C, H). An example:
3C 3D 7S QD KC AS 6S AC JS 4S JD 7H 6D
5D 8C 7D AH 3H QC 8D JH 5H 9D 7C 9C 4D
2H 10D 8H KS QH 4C 10S 9S 6H 8S KD AD QS
2D 10C 6C 2C 10H 4H 2S 3S 5C 9H KH JC 5S
190
9.2. Exercises
Your program should process the file and output the total number of points each hand
represents. You should not make any assumptions about the ordering of the input.
Hand 1 Points: 17
Hand 2 Points: 10
Hand 3 Points: 16
Hand 4 Points: 6
Exercise 9.8. The game of Sudoku is played on a 9 × 9 grid in which entries consist of
the numbers 1 thru 9. Initially, the board is presented with some values filled in and
others blank. The player has to fill in the remaining values until all grid boxes are filled
and the following constraints are satisfied.
• In each of the 9 rows, each number, 1–9 must appear exactly once
• In each of the 9 columns, each number 1–9 must appear exactly once
• In each of the 3 × 3 sub-grids, each number 1–9 must appear exactly once
A full example is presented in Figure 9.4.
Figure 9.4.: A solved Sudoku puzzle
Write a program that processes a text file containing a possible sudoku solution and
determine if it is a valid or invalid solution. The file will have the following format: it
will contain 9 lines with 9 numbers on each line delimited by a single space. If the input
represents a valid solution, output ”Valid Solution”, otherwise output at least one reason
why the input is not a valid solution.
Exercise 9.9. Write a program that parses and processes a data file containing Comma
Separated Values (CSV) and produce an equivalent JSON (JavaScript Object Notation)
output file containing the same data.
191
9. File Input/Output
The input file will have the following format. The first line is a CSV list of column names.
Each subsequent line is an individual record with values for each column. The number
of columns and rows may vary from file to file. The following is an example containing
data about students, which has four columns and 3 records.
lastName,firstName,NUID,GPA
Castro,Starlin,11223344,3.48
Rizzo,Anthony,55667788,3.95
Bryant,Chris,01234567,2.7
The output file will be formatted in JSON where each “object” (record) is denoted with
opening and closing curly brackets, each record is separated by a comma, and all records
are enclosed in square brackets (putting them in an array). For each record, each value is
denoted with a key (the column name) and a value. For this exercise, treat all values as
strings even if they are numbers. For example, the input file above would be formatted
as follows.
1 [
2 {
3 "lastName": "Castro",
4 "firstName": "Starlin",
5 "NUID": "11223344",
6 "GPA": "3.48"
7 },
8 {
9 "lastName": "Rizzo",
10 "firstName": "Anthony",
11 "NUID": "55667788",
12 "GPA": "3.95"
13 },
14 {
15 "lastName": "Bryant",
16 "firstName": "Chris",
17 "NUID": "01234567",
18 "GPA": "2.7"
19 }
20 ]
Exercise 9.10. Ranked voting elections are elections where each voter ranks each
candidate rather than just voting for a single candidate. If there are n candidates, then
192
9.2. Exercises
each voter will rank them 1 (best) through n (worst). Usually, the winner of such an
election is determined by a Condorcet method (the candidate that would win in by a
majority in all head-to-head contests). However, we’ll use an alternative method, a Borda
count.
In a Borda count, points are awarded to each candidate for each ballot. For every number
1 ranking, a candidate receives n points, for every 2 ranking, a candidate gets n − 1
points, and so on. For a rank of n, the candidate only receives 1 point. The candidates
are then ordered by their total points and the one with the highest point count wins
the election. Such a system usually leads to a “consensus” candidate rather than one
preferred by a majority.
Implement a Borda-count based ranked voting program. Your program will read in a file
in the following format. The first line will contain an ordered list of candidates delimited
by commas. Each line after that will represent a single ballot’s ranking of the candidates
and will contain comma delimited integers 1 through n. The order of the rankings will
correspond to the order of the candidates on the first line.
Your program will take an input file name as a command line argument, open the file
and process it. It will then report the results including the point total for each candidate
(in order) as well as the overall winner. It will also report the total number of ballots.
You may assume each ballot is valid and all rankings are provided.
An example input:
Alice,Bob,Charlie,Deb
2,1,4,3
3,4,2,1
4,2,3,1
3,2,1,4
3,1,4,2
An example output:
Election Results
Number of ballots: 5
Candidate Points
Bob 15
Deb 14
Charlie 11
Alice 10
193
9. File Input/Output
Winner is Bob
Exercise 9.11. A DNA sequence is a sequence of some combination of the characters
A (adenine), C (cytosine), G (guanine), and T (thymine) which correspond to the
four nucleobases that make up DNA. Given a long DNA sequence, its often useful to
compute the frequency of n-grams. An n-gram is a DNA subsequence of length n. Since
there are four bases, there are 4n possible n-grams.
Write a program that processes a DNA sequence from a plaintext file and, given n,
computes the relative frequency of each n-gram as it appears in the sequence. As an
example, consider the sequence in Figure 9.5.
GGAAGTAGCAGGCCGCATGCTTGGAGGTAAAGTTCATGGTTCCCTGGCCC
Figure 9.5.: A DNA Sequence
To compute the frequency of all n = 2 n-grams, we would consider all 16 combinations
of length-two DNA sequences. We would then go through the sequence and count up the
number of times each 2-gram appears. We then compute the relative frequency (note:
if a sequence is length L, then the total number of n-grams in it is L − (n − 1)). The
relative frequency of each such 2-gram is calculated below.
AA 6.1224%
AC 0.0000%
AG 10.2041%
AT 4.0816%
CA 6.1224%
CC 10.2041%
CG 2.0408%
CT 4.0816%
GA 4.0816%
GC 10.2041%
GG 12.2449%
GT 8.1633%
TA 4.0816%
TC 4.0816%
TG 8.1633%
TT 6.1224%
Exercise 9.12. Given a long DNA sequence, it is often useful to compute the number
of instances of a certain subsequence. As an example, if we were to search for the
194
9.2. Exercises
subsequence GT A in the DNA sequence in Figure 9.5, it appears twice. As another
example, in the sequence CCCC , the subsequence CC appears three times.
Write a program that processes a text file containing a DNA sequence and, given a
subequence s, searches the DNA sequence and counts the number of times s appears.
Exercise 9.13. Protein sequencing in an organism consists of a two step process. First
the DNA is translated into RNA by replacing each thymine (T) nucleotide with uracil
(U). Then, the RNA sequence is translated into a protein according to the following rules.
The RNA sequence is processed 3 bases at a time. Each trigram is translated into a single
amino acid according to known encoding rules. There are 20 such amino acids, each
represented by a single letter in (A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y ).
The rules for translating trigrams are presented in Figure 9.6. Each triple defines a
protein, but we’re only interested in the first letter of each protein. Moreover, the
trigrams UAA, UAG, and UGA are special markers that indicate a (premature) end to
the protein sequencing (there may be additional nucleotides left in the RNA sequence,
but they are ignored and the translation ends).
Figure 9.6.: Codon Table for RNA to Protein Translation
As an example, suppose we start with the DNA sequence AAAT T CCGCGT ACCC;
it would be encoded into RNA as AAAU U CCGCGU ACCC; and into an amino acid
sequence KF RV P .
Write a program that processes a file containing a DNA sequence and outputs the
translated proteins (only the first letter of each protein) to an output file.
195
9. File Input/Output
Exercise 9.14. Recently, researchers have successfully inserted two new artificial nucle-
ases into simple bacteria that successfully reproduced the artificial bases through several
generations. The artificial bases d5SICS and dNaM, (X and Y for short) mimic the
natural G, and C nucleobases respectively.
Write a program that takes a normal DNA sequence and replace some of its G, C pairs
with X, Y respectively. DNA is translated into RNA which is then translated into 20
different amino acids. Each amino acid produced depends on a 3 nucleobase codon. For
this exercise, we will change G, C pairs with X, Y pairs but only in codons that represent
the amino acids Threonine (an essential amino acid) and Alanine (a non-essential amino
acid). Table 9.1 contains the codons corresponding to these amino acids and the codons
you should translate each one to. All other codons should not be modified.
Your program should open and process a DNA sequence contained in a file and modify
the DNA sequence as described above and output the artificial DNA sequence to a new
output file.
Amino Acid Codon Artificial Codon
ACT AYT
ACC AYY
Threonine
ACA AYA
ACG AYX
GCT XYT
GCC XYY
Alanine
GCA XYA
GCG XYX
Table 9.1.: Amino Acid Codons
196
10. Encapsulation & Objects
One reason we prefer to write programs in high-level programming languages is that we
can use syntax that is closer to plain English. Though programming language syntax
is a far cry from “natural” language, it is far closer than lower level languages such as
assembly or binary machine code. However, from what we’ve seen so far, when writing
programs we are still forced to utilize the primitive variable types built-in to the language
we’re using, which is still quite limiting.
As a motivating example, suppose we were to write a program that involved organizing
the enrollment of students into courses. To model a particular student, we would need
a collection of variables, say a first name, last name, GPA, and a unique identification
number (likely a lot more, but let’s keep it simple). Each of these pieces of data could
be modeled by strings, a floating-point number and perhaps an integer.1 Each of these
pieces of data are stored in separate, unrelated variables even though they represent a
single entity.
Even worse, suppose that we needed to keep track of a collection of students. Each piece
of data would need to be stored in a separate array. If we wanted to rearrange the data
(say, sort it), we would need to do a lot of manual bookkeeping to make sure that the
separate pieces of data that represented a single entity were all aligned at the same index
in each of the arrays. If we wanted to pass the data around to functions, we’d be forced
to pass multiple arrays to each function. This becomes all the more complex when we
attempt to model entities with more pieces of data.
The solution is to encapsulate the pieces of data into one logical entity, sometimes referred
to as an object. More formally, encapsulation is a mechanism by which pieces of data can
be grouped together along with the functions that operate on that data. Encapsulation
may also provides a means to protect that data by controlling the visibility of that data
from code outside the object.
Contrast this with an array which is also a collection of data. However, an array usually
contains pieces of similar data (all elements are integers or all elements are floating
point numbers) while an object may collect pieces of dissimilar data that make up a
larger entity. It is like the difference between rows and columns in a table. Consider the
student data in Table 10.1. Each row represents a record while each column represents a
1
Depending on the identification number, it may be more appropriately modeled with a string. Social
Security Numbers for example are not purely numeric; they include dashes and may begin with zeros.
197
10. Encapsulation & Objects
First Name Last Name ID GPA
Tom Baker 74 3.75
Christopher Eccleston 5 3.5
David Tennant 10 4.0
Matt Smith 29 3.2
Peter Capaldi 13 2.9
Table 10.1.: Student Data
collection of data from each record. A single column is comparable to an array while
each row is comparable to an object. In this example, each object has four pieces of data
encapsulated in it, a first name, last name, an ID, and a GPA.
To represent this data in code without objects we would need at least 4 separate arrays,
more if we wanted to model more data for a student. Moreover, data in separate
arrays or collections have no real logical relationship to each other. The solution that
most programming languages provide is allowing you to define an object or structure
that collects pieces of data into one logical unit, allowing you to name the object (say
“Student”) so that you can deal with the data in a more abstract way. With objects, we
can treat each row in the table as a single, distinct entity allowing us to collect Student
objects into a single array or collection rather than many separate ones.
10.1. Objects
Though languages differ in how they support objects, they all have some commonalities.
A language needs to provide ways to define objects, create instances of objects, and to
use them in code.
10.1.1. Defining
Most object oriented programming languages such as C++ and Java are class-based
languages. Meaning that they allow you to define objects by declaring and defining a
“class.” A class is essentially a blueprint for what the object is and how it is defined.
Generally, a class declaration allows you to specify member variables and member methods
which are part of the class. Further, full encapsulation is achieved by using visibility
keywords such as public or private to either allow or restrict access to variables and
methods from code outside the object.
Non-object-oriented languages may not support full encapsulation. Instead they may
allow you to define structures which support the grouping of data, but make it difficult
198
10.1. Objects
or impossible to achieve the other two aspects of encapsulation (the grouping of methods
that act on that data and the protection of data).
In either case, a language allows you to define the member variables and to name the
class or structure so that instances can be referred to by that type. Built-in types such
as numbers or strings already have a type name defined by the language. However, an
object is a user-defined type that is not built-in to the language. Once defined, however,
the class or structure can be referred to just like any built-in variable type.
It is not unusual to create objects that are made of other objects. For example, a student
object may be defined by using two strings for its first and last name. In the language,
a string may also be an object. As a more complex example, suppose that we wanted
an additional member variable to model a student’s date of birth. A date may itself
be an object as it consists of several pieces of information (a year, month, and date
at least). When an object “owns” an instance of another object it is referred to as
composition as the object is composed of other objects. Further, an object may consist of
a collection of other objects (suppose that a student object owned an array of course
objects representing their schedule). This is a form of composition known as aggregation
(multiple objects have been aggregated by the object).
10.1.2. Creating
Once a blueprint for an object (or structure) has been declared and defined, we need a
way to create instances of the object. The concept of an “object” is general and abstract.
It is more like the idea of a student. Only once we have created an entity that exists in
memory do we have an actual instance of the class. Creating instances of an object is
usually referred to as instantiation.
Languages may be able to automatically create instances of your object with default
values. After all, your object is likely composed of built-in types. The student example
above for example could be modeled with two strings, an integer, and a floating point
number. The language/compiler/interpreter “knows” how to deal with these built-in
types, so it can extend that knowledge to create instances of your object which are
essentially just collections of types that it already knows how to deal with.
Object-oriented languages usually provide a special method for you to be able to specify
the details of how to create an instance. These are called constructor methods. Sometimes
you can define multiple constructors methods that take different number(s) of arguments
and/or have different behavior. Constructor methods typically have special syntax or
have the same name as the class.
In other languages that do not fully support object-oriented programming, you must
define utility functions that can be used to create instances of your object. Sometimes
these are referred to as factory functions as they are responsible for “manufacturing”
199
10. Encapsulation & Objects
instances of your object.
10.1.3. Using Objects
After defining and creating an object, you can usually use it like any regular variable. In
a strongly typed language you would declare a variable whose type matches the declared
class or structure. The variable type can usually be passed and returned from functions,
assigned to other variables, etc.
A language also provides ways to access the member variables or methods that are visible
to the outside world. Languages usually allow you to do this through the “dot operator”
or the “arrow operator.” Suppose we have an instance of a student object stored in
a variable s . To access the first name of this instance, we may be able to use either
s.firstName or s->firstName . We can access and invoke visible methods likewise.
The dot/arrow operators are how code outside the object interacts with the object.
Outside code is able to do this because it holds a reference, s to the object. However,
inside the object, we may not have a reference (the variable s was ostensibly declared
and used outside the object and so is not in scope inside the object). However, we
still have need to reference member variables or methods from inside the object. Many
languages use open recursion , a mechanism by which we can write code so that an
instance is able to refer to itself. Languages use keywords such as this or self or
something similar. The keyword is essentially a self-reference to the object itself so that
you can refer to “this” object from within the object.
10.2. Design Principles & Best Practices
Using objects in your code follows more of a bottom-up design rather than a top-down
design approach. In a top-down design, a program is designed by breaking a program
or problem down into smaller and smaller components. Bottom-up design approaches a
problem differently. First, real-world entities involved with the problem are modeled by
defining objects. Then objects are used as building blocks that can be combined and
made to interact to solve a problem.
Object design is usually a straightforward process. Typically an object is modeling a
real-world entity, so it is simple enough to decompose the entity into its constituent
components. We do this until the component can either be modeled by a built-in type
such as a string or number or by an existing object. In general, you want to keep things
as simple as possible. Any time you need to associate pieces of data together into one
logical unit, it is appropriate to encapsulate them into an object.
A good design principle is to utilize composition as much as possible. If you have multiple
200
10.3. Exercises
pieces of data that define a logical entity or unit, it is good design to create another
object. For example, suppose a student object needs to model a mailing address; think
about what an address is: it is a street address, city, state, zip, etc. Rather than having
these as member fields to your object, it is probably more appropriate to define an
“address” object, especially if such an object would be useful elsewhere in a program.
10.3. Exercises
Exercise 10.1. A complex number consists of two real numbers: √ a real component a
and an imaginary component bi where b is a real number and i = −1. Define an object
or structure to model a complex number. Write functions to:
• Create a complex number
• Print a complex number
• Perform basic arithmetic operations on two complex numbers including addition,
subtraction and multiplication as defined by:
c1 + c2 = (a1 + b1 i) + (a2 + b1 i) = (a1 + a2 ) + (b1 + b2 )i
c1 − c2 = (a1 + b1 i) − (a2 + b1 i) = (a1 − a2 ) + (b1 − b2 )i
c1 · c2 = (a1 + b1 i) · (a2 + b1 i) = (a1 a1 − b1 b2 ) + (a1 b2 + b1 a1 )i
Exercise 10.2. Design an object (or structure) that models an album. Include at least
the album title, artist (or band) and release year. Include any other data that you think
is relevant and write functions to support your object.
Exercise 10.3. Design an object (or structure) that models a bank savings account.
Include at least the balance, APR, an account “number” and customer information
(which may be another object or structure). Include any other data that you think is
relevant and write functions to support your object.
Exercise 10.4. Design an object (or structure) that models a sports stadium. Include at
least the stadium name, the team that plays there, its city, state, and year built. Include
both latitude and longitude data. Include any other data that you think is relevant and
write functions to support your object. Write a parser to process a flat file data of all
stadiums (in your chosen sport) and build instances of all of them.
Exercise 10.5. Design an object (or structure) that models a network-connected elec-
tronic device. Include at least a unique ID, a human-readable name for the device, a
Media Access Control (MAC) address and Internet Protocol (IP) address as well as the
device’s bandwidth in megabits per second. Include any other data that you think is
relevant and write functions to support your object.
201
10. Encapsulation & Objects
Exercise 10.6. Design an object (or structure) that models an airport. Include at least
the name, FAA designation, its city, state, and latitude/longitude data. Include any
other data that you think is relevant and write functions to support your object.
202
11. Recursion
Suppose we wanted to write a simple program that performed a countdown, printing 10,
9, 8, . . . , 2, 1 and when it reached zero it printed a “Happy New Year” message. Likely
our first instinct would be to write a very simple for loop using an increment variable.
But suppose we lived in a world without the usual loop control structures that we are
now familiar with. How might we write such a program?
After thinking about it for a while, we might think: well, we don’t have loops, but we
still have functions. In particular what if we had a function that took the “current” value
of our counter variable and decremented it, passing it to another function, which did the
same thing. For example, we could pass 10 to such a function, which would then subtract
1, passing 9 to another function and so on. A check could be made to see if the value was
zero, in which case we print our special message and no longer call any more functions.
In fact, we would not need to define 10 different functions to do so. Instead, we could
define one function that called itself. It might look something like Algorithm 11.1.
Input : An integer n ≥ 0
Output : A countdown of integers n, . . . 0
1 if n = 0 then
2 output “Happy New Year!!!”
3 else
4 output n
5 CountDown(n − 1)
6 end
Algorithm 11.1: Recursive CountDown(n) Function
The function in this case is called CountDown(). In Line 5 the function calls itself on
a decremented value. When a function calls itself, it is a recursive function. When a
language allows functions to call themselves they support recursion.1
This is not that odd of a concept. We’ve seen many examples where functions invoke (call)
other functions. Each function call simply creates a new stack frame on the program
stack. There is nothing particularly special about which functions call which other
1
For a full treatment of recursion, see Morton, 1976 [30].
203
11. Recursion
functions, so there is little difference when a function calls itself.
This was not just a toy example. There are many programming languages in which
recursion is used as a matter of course. Functional programming languages tend to avoid
control structures like loops and even (mutable) variables. Instead, control flow is defined
by evaluating a series of functions, making recursion a fundamental technique.
Recursion is extensively used in mathematics. Recurrence relations or recursive functions
are common. The Fibonacci sequence is a common, if not overused2 example. It has a
simple definition: the next value in the sequence is simply the sum of the two previous
values. The sequence starts with the initial values of 1. The first few terms in the
sequence:
1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, . . .
The more formal mathematical definition can be stated as follows.
1 if n = 0
Fn = 1 if n = 1
Fn−1 + Fn−2 otherwise
The Fibonacci sequence is the cliche example for recursion. We can define an algorithmic
function to compute the n-th Fibonacci number as follows.
Input : An integer n ≥ 0
Output : The n-th Fibonacci number, Fn
1 if n ≤ 1 then
2 output 1
3 else
4 output Fibonacci(n − 1) + Fibonacci(n − 2)
5 end
Algorithm 11.2: Recursive Fibonacci(n) Function
Though hackneyed, it does provide a good example for how recursive functions work.
We’ll also utilize it as an example of why you should avoid recursion in practice. We use
it to illustrate how the problems with recursion can be mitigated or avoided altogether.
2
The Fibonacci sequence is nothing special; its simply a second order linear homogenous recurrence
relation with coefficients of 1. The near reverence that so many people attribute to it borders on
mysticism.
204
11.1. Writing Recursive Functions
11.1. Writing Recursive Functions
When writing a recursive function, there are several key elements that we need to take
care of to ensure that it executes correctly. In particular, every recursive function requires
at least one base case or base condition which serves as a terminating condition for the
recursion. A base case is a condition which, instead of making a recursive call, processes
and returns a value. Without a base case, the recursion would continue unbounded: the
function would call itself over and over again, creating new stack frame after stack frame
until we run out of stack space. If a program makes too many function calls and runs
out of stack memory, it may lead to a stack overflow and the termination of the program.
Even if we don’t have unbounded recursion, it is still possible to run out of stack space
even with simple recursion.
The other key element that we need is to ensure that every recursive call makes progress
toward one of the terminating conditions. If no progress is made, then again we may have
an unbounded recursion. In the Fibonacci example in Algorithm 11.2, the base case can
be found in the first if-statement: when n reaches 1 or less, no recursive calls are made.
In the else-statement, we make two recursive calls, but both of them make progress
toward this base case. The first decrements n by 1 and the second by 2, eventually
reaching n = 1.
11.1.1. Tail Recursion
Making many function calls can be costly in terms of stack space. One optimization
that can be made is to use tail recursion. The last operation that a function executes
is referred to as the tail operation. If a function invokes another function as its tail
operation, its a tail call. For example, consider the following snippet of code:
1 int foo(int x) {
2 ...
3 return bar(x-1) + 1;
4 }
Here, foo() calls bar() but it is not the last operation before it returns. Instead, it
invokes bar() , takes the result and adds one then returns to the calling function. Note
that decrementing x is performed before the invocation of bar() . In contrast, consider
the following modified code:
205
11. Recursion
1 int foo(int x) {
2 ...
3 return bar(x-1);
4 }
Here, the invocation of bar() is the last operation performed by foo() . Thus, this is
a tail call.
Tail calls have the advantage that a language or compiler can generally optimize the
function call with respect to the stack frame. Since the function foo() is essentially
done with its computation, its stack frame is no longer needed. The system, therefore, can
reuse the stack frame. Tail recursion is such an important optimization, some languages
require it or “guarantee” it in other ways.
11.2. Avoiding Recursion
Recursion is not essential; some languages do not even support recursion. Some code
guidelines even restrict or forbid the use of recursion [?]. In fact, any recursive function
can be rewritten to not use recursion. Usually, you can write an equivalent loop structure
or use an in-memory stack data structure to replace the recursion. So why use it?
Proponents would argue that recursion allows you to write simple code that more closely
matches mathematical functions and expressions. Recursion is also a natural way to
think about certain problem solving techniques such as divide-and-conquer (see Chapter
12). It is also a natural way to code in functional programming languages.
These arguments, however, are subjective. One person’s “cleaner” or “more understand-
able” code is another person’s spaghetti code hack. What is “natural” for one person may
be “weird” and “odd” for another. However, there are many other arguments against
recursion, many of which are objective reasons: that recursion is more expensive and can
easily lead to inefficient, exponential algorithms.
In general, recursion requires lots of function calls which requires creating and removing
lots of stack frames. This usually results in a lot of overhead and resources being used
to perform the computation. Unless you are using a language in which recursion is
optimized and made to be more efficient (such as functional programming languages),
this is a lot more expensive than using simple loops and iteration.
Another reason to avoid recursion is that it can lead to a lot of extraneous re-computations.
The cliched example of the Fibonacci recursion is a prime example of this.3 Consider
3
Its overuse as an example of recursion is even less explicable as it solves a problem that no one cares
206
11.2. Avoiding Recursion
Fibonacci(5)
Fibonacci(4) Fibonacci(3)
Fibonacci(3) Fibonacci(2) Fibonacci(2) Fibonacci(1)
Fibonacci(2) Fibonacci(1) Fibonacci(1) Fibonacci(0) Fibonacci(1) Fibonacci(0)
Fibonacci(1) Fibonacci(0)
Figure 11.1.: Recursive Fibonacci Computation Tree
the computation of Fibonacci(5). This results in two recursive calls, each of those calls
results in 2 recursive calls and so on as depicted in Figure 11.1.
As depicted in the figure, several function calls are repeated: Fibonacci(3) is called
twice, Fibonacci(2) is called 3 times, etc. 15 total function calls are made to compute
Fibonacci(5). In general, the computation of Fibonacci(n) will result in an exponential
number of function calls. The number of function calls to compute Fn with this recursive
solution will be equal to
n−1
X
Fn−2 + Fi
i=0
That is more than the first n − 1 Fibonacci numbers combined! It should come as no
surprise that the Fibonacci sequence grows exponentially and thus so would the number
of operations with this recursive solution.
To put this in perspective, consider computing F45 = 1, 836, 311, 903 (n = 45), the
maximum representable value for a 32-bit signed two’s complement integer. Executing
a C implementation of this recursive algorithm took about 8 seconds4 and required
3,672,623,805 function calls!
What if we wanted to compute F100 = 573, 147, 844, 013, 817, 084, 101 (573 quintillion)
it would result in 1,146,295,688,027,634,168,201 (1.146 sextillion) function calls. Using
the same hardware, at 4.59 × 108 (459 million) function calls per second, it would take
about.
4
On a 2.7GHz Intel Core i7.
207
11. Recursion
2.497 × 1012 seconds to compute. That would be more than 79,191 years! Even if we
performed these (useless) calculations on hardware that was 1 million times faster than
my laptop, it would still take over 4 weeks!
11.2.1. Memoization
The inefficiency in the example above comes from the fact that we make the same function
calls on the same values over and over. One way to avoid recomputing the same values is
to store them into a table (or tableau if you prefer being fancy). Then, when you need
to compute a value, you look at the table to see if it has already been computed. If
it has, we reuse the value stored in the table, otherwise we compute it by making the
appropriate recursive calls. Once computed, we place the value into the table so that it
can be looked up on subsequent function calls. This approach is usually referred to as
memoization.
The “table” in this scenario is very general: it can be achieved using a number of different
data structures including simple arrays, or even maps (mapping input value(s) to output
values). The table is essentially serving as a cache for the previously computed values. An
illustration of how this might work can be found in Algorithm 11.3. Here, the recursion
only occurs if the value Fn is not yet defined.
Input : An integer n ≥ 0, a global map M that maps n values to Fn
Output : The n-th Fibonacci number, Fn
1 if Fn is defined in M then
2 output M (n)
3 else
4 a ← Fibonacci(n − 1)
5 b ← Fibonacci(n − 2)
6 Define M (n) = a + b
7 output (a + b)
8 end
Algorithm 11.3: Recursive Fibonacci(n) Function With Memoization
In many functional programming languages, memoization is implicit and provided by
the language itself to ensure that we do not have the same problems with recomputing
values as we observed above. In languages such as C and Java, memoization becomes
our responsibility and is not an optimization provided by the language itself.
However, if we are filling in a table of values anyway, we really don’t need to make
recursive calls at all. We simply need to figure out in what order to fill out the values
in the table. This is actually the basis of a powerful programming technique known
208
11.3. Exercises
as dynamic programming which is a “bottom-up” approach to solving problems by
combining solutions to smaller ones.
11.3. Exercises
Exercise 11.1. The binomial coefficients, C(n, k) or nk (“n choose k”), are defined as
the number of ways you can select k distinct items from a collection of n items. A direct
combinatorial definition is
n n!
=
k k!(n − k)!
An alternative is Pascal’s identity, which gives a recurrence to compute this value:
n n−1 n−1
= +
k k k−1
Where n0 = 1 for any n and for all k > n, nk = 0. Finally, n1 = n.
1. Write a recursive function using Pascal’s identity to compute nk . Benchmark its
performance.
2. Write a recursive version that uses memoization to avoid recomputing values
3. Modify your functions to utilize an arbitrary precision numeric type so that you
can compute arbitrarily large values.
Exercise 11.2. The Jacobsthal sequence is very similar to the Fibonacci sequence in
that it is defined by its two previous terms. The difference is that the second term is
multiplied by two.
0 if n = 0
Jn = 1 if n = 1
Jn−1 + 2Jn−2 otherwise
1. Write a recursive function that computes the n-th Jacobsthal number. Benchmark
its performance.
2. Write a recursive version that uses memoization to avoid recomputing values
3. Modify your functions to utilize an arbitrary precision numeric type so that you
can compute arbitrarily large values.
209
12. Searching & Sorting
Searching and sorting are two fundamental operations when dealing with collections of
data. Both operations are not only important in and of themselves, but they also form
the basis of many algorithms and other more complex operations. These operations are
so essential that a wide variety of algorithms and techniques have been developed to
solve them, each with their own advantages and disadvantages. This variety provides a
good framework from which to study the relative efficiency and complexity of algorithms
through algorithm analysis.
12.1. Searching
Searching is a very basic operation. Given a collection of data, we wish to find a particular
element or elements that match a certain criteria. More formally, we have the following.
Problem 1 (Searching).
Given: a collection of elements, A = {a1 , a2 , . . . , an } and a key element ek
Output: The element ai in A such that ai = ek
The “equality” in this problem statement is not explicitly specified. In fact, this is a
very general, abstract statement of the basic search problem. We didn’t specify that the
“collection” was an array, a list, a set, or any other particular data structure. Nor did we
specify what type of elements were in the collection. They could be numbers, they could
be strings, they could be objects.
There are many variations of this general search problem that we could consider. For
example, we could generalize it to find the “first” or “last” such element if our collection is
ordered. We could find all elements that match our criteria. Some basic operations that
we’ve already considered such as finding the minimum or maximum (extremal elements),
or median element are also variations on this search problem.
When designing a solution to any of these variations additional considerations must be
made. We may wish our search to be index-based (that is, output the index i rather
than the element ai ). We may need to think about how to handle unsuccessful searches
(return null ? A special flag value? Throw an exception?, etc.).
211
12. Searching & Sorting
index 0 1 2 3 4 5 6 7 8
contents 42 4 9 4 102 34 12 2 0
Figure 12.1.: Array of Integers
When implementing a solution in a programming language, we of course will need to be
more specific about the type of collection being searched and the type of elements in
the collection. However, we will still want to keep our solution as general as possible.
As we’ll see, most programming languages facilitate some sort of generic programming
so that we do not need to reimplement the solution for each type of collection or for
each type of variable. Instead, we can write one solution, then configure it to allow for
comparisons of any type of variable (numeric, string, object, etc.).
12.1.1. Linear Search
The first solution that we’ll look at is the linear search algorithm (also known as sequential
search). This is a basic, straightforward solution to the search problem that works by
simply iterating through each element ai , testing for equality, and outputting the first
element that matches the criteria. The pseudocode is presented as Algorithm 12.1.
Input : A collection of elements A = {a1 , . . . , an } and a key ek
Output : An element a in A such that a = ek according to some criteria; φ if no
such element exists
1 foreach ai in the collection A do
2 if ai = ek then
3 output ai
4 end
5 end
6 output φ
Algorithm 12.1: Linear Search
To illustrate, consider the following example searches. Suppose we wish to search the
0-indexed array of integers in Figure 12.1.
A search for the key ek = 102 would start at the first element. 42 6= 102 so the search
would continue; it would compare it against 4, then 9, then 5, and finally find 102 at
index i = 4, making a total of 5 comparisons (including the final comparison to the
matched element).
212
12.1. Searching
a1 ··· a n2 −1 a n2 a n2 +1 ··· an
<m m >m
Figure 12.2.: When an array is sorted, all elements in the left half are less than the
middle element m, all elements in the right half are greater than m.
A search for the key ek = 42 would get lucky. It would find it after only one comparison as
the first element is a match. A search for the element 20 would result in an unsuccessful
search with a total of 10 comparisons being made. Finally a search for ek = 4 would
only require two comparisons as we find 4 at the second index. There is a duplicate
element at index 3, but the way we’ve defined linear search is to find the “first” such
element. Again, we could design any number of variations on this solution. We give a
more detailed analysis of this algorithm below.
12.1.2. Binary Search
An alternative search algorithm is binary search. This is a clever algorithm that requires
that the array being searched is sorted in ascending order. Though it works on any type
of data, let’s again use an integer array as an example. Suppose we’re searching for the
key element ek . We start by looking at the element in the middle of the array, call it m.
Since the array is sorted, everything in the left-half of the array is < m and everything
in the right-half of the array is > m.1 We will now make one comparison between ek and
m. There are three cases to consider.
1. If ek = m, then we’ve found an element that matches our key and search criteria
and we are done. We can output m and stop the algorithm.
2. If ek < m then we know that if a matching element exists, it must lie in the left-half
of the list. This is because all elements in the right-half are > m.
3. If ek > m then we know that if a matching element exists, it must lie in the
right-half of the list. This is because all elements in the left-half are < m.
In either of the second two cases, we have essentially cut the array in half, halving the
number of elements we need to consider. Suppose that the second case applies. Then
we can consider elements indexed from 1 to n2 − 1 (we need not consider a n2 as the first
case would have applied if we found a match). We can then do the same trick: check the
middle element among the remaining elements and determine which half to cutout and
1
If duplicate elements are in the array, then elements in the left/right half could be less than or equal
to and greater than or equal to m, but this will not affect how our algorithm works.
213
12. Searching & Sorting
which half to consider. We repeat this process until we’ve either found the element we
are looking for or the range in which we are searching becomes “empty” indicating an
unsuccessful search.
This description suggests a recursive solution. Given two indices l, r, we can compute
the index of the middle element, m = l+r2
and make one of two recursive calls depending
on the cases identified above. Of course, we will need to make sure that our base case is
taken care of: if the two indices are invalid, that is if the left is greater than the right,
l > r, then we know that the search was unsuccessful.
Input : A sorted collection of elements A = {a1 , . . . , an }, bounds 1 ≤ l, r ≤ n,
and a key ek
Output : An element a in A such that a = ek according to some criteria; φ if no
such element exists
1 if l > r then
2 output φ
3 end
4 m ← b l+r
2
c
5 if am = ek then
6 output am
7 else if am < ek then
8 BinarySearch(A, m + 1, r, ek )
9 else
10 BinarySearch(A, l, m − 1, ek )
11 end
Algorithm 12.2: Recursive Binary Search Algorithm, BinarySearch(A, l, r, ek )
As discussed in Chapter 11, non-recursive solutions are generally better than recursive
ones. We can design a straightforward iterative version of binary search using a while loop.
We initialize two index variables, l, r and update them on each iteration depending on
the three cases above. The loop stops when we’ve found our element or l > r resulting in
an unsuccessful search. The iterative version is presented in Algorithm 12.3, an example
214
12.1. Searching
run of the algorithm is shown in Figure 12.3.
Input : A sorted collection of elements A = {a1 , . . . , an } and a key ek
Output : An element a ∈ A such that a = ek according to some criteria; φ if no
such element exists
1 l←1
2 r←n
3 while l ≤ r do
4 m ← b l+r
2
c
5 if am = ek then
6 output am
7 else if am < ek then
8 l ← (m + 1)
9 else
10 r ← (m − 1)
11 end
12 end
13 output φ
Algorithm 12.3: Iterative Binary Search Algorithm, BinarySearch(A, ek )
12.1.3. Analysis
When algorithms are implemented and run on a computer, they require a certain amount
of resources. In general, we could consider a lot of different resources such as computation
time and memory. Algorithm analysis involves quantifying how many resource(s) an
algorithm requires to execute with respect to the size of the input it is run on.
When analyzing algorithms, we want to keep the analysis as abstract and general as
possible, independent of any particular language, framework or hardware. We could
always update the hardware on which we run our implementation, but that does not
necessarily make the algorithm faster. The algorithm would still execute the same number
of operations. Faster machines just mean that more steps can be performed in less time.
In fact, the concept of an algorithm itself is a mathematical concept that predates modern
computers by thousands of years. One of the oldest algorithms, for example, Euler’s
GCD (greatest common divisor) algorithm dates to 300 BCE. Whether or not you’re
“running” it on a piece of papyrus 2,300 years ago or on a modern supercomputer, the
same number of divisions and subtractions are performed.
To keep things abstract, we analyze an algorithm by identifying an elementary operation.
215
12. Searching & Sorting
index 0 1 2 3 4 5 6 7 8 9 10
contents -3 2 4 4 9 12 34 42 102 157 180
(a) Initially, l = 0, r = 10 and so we examine the middle element at index m = 5
which is 12.
index 0 1 2 3 4 5 6 7 8 9 10
contents -3 2 4 4 9 12 34 42 102 157 180
(b) Since 64 > 12, we update our left index variable l to m + 1, thus l = 6 and
we’ve eliminated the left half of the list from consideration.
index 0 1 2 3 4 5 6 7 8 9 10
contents -3 2 4 4 9 12 34 42 102 157 180
l+r 6+10
(c) Our new middle index is m = 2 = 2 = 8, corresponding to the element
102.
index 0 1 2 3 4 5 6 7 8 9 10
contents -3 2 4 4 9 12 34 42 102 157 180
(d) Since 64 < 102, we update the right index variable r to m − 1 = 7, eliminating
the right half of the subarray.
index 0 1 2 3 4 5 6 7 8 9 10
contents -3 2 4 4 9 12 34 42 102 157 180
(e) Here, l = 6, r = 7, and so our new middle index is m = b 6+7
2 c = 6. Since
64 > 34, we update our left index variable l to m + 1 = 7
index 0 1 2 3 4 5 6 7 8 9 10
contents -3 2 4 4 9 12 34 42 102 157 180
(f) Since 64 > 42 we again update our left index variable l to m + 1 = 8.
index 0 1 2 3 4 5 6 7 8 9 10
contents -3 2 4 4 9 12 34 42 102 157 180
(g) Since l = 8 and r = 7, l > r and the loop terminates, resulting in an
unsuccessful search.
Figure 12.3.: The worst case scenario for binary search, resulting in an unsuccessful
search for ek = 64. This example is run on a 0-indexed array with an array
of integers of size 11.
216
12.1. Searching
This is generally the most common or most “expensive” operation that the algorithm
performs. Sometimes there may be more than one reasonable choice for an elementary
operation which may give different results in our analysis. However, we generally do not
consider basic operations that are necessary to the control flow of an algorithm. For
example, variable assignments or the iteration of index variables.
Once we have identified an elementary operation, we can quantify the complexity of
an algorithm by analyzing the number of times the elementary operation is executed
with respect to the input size. For a collection, the input size is generally the number
of elements in the collection, n. We can then characterize the number of elementary
operations and thus the complexity of the algorithm itself as a function of the input size.
We illustrate this process by analyzing and comparing the two search algorithms.
Linear Search Analysis
When considering the linear search algorithm, the input size is clearly the number of
elements in the collection, n. The best candidate for the elementary operation is the
comparison (Line 2, Algorithm 12.1). To analyze this algorithm, we need to determine
how many comparisons are made with respect to the size of the collection, n.
As we saw in the examples, the number of comparisons made by linear search can vary
depending on the element we’re searching and the configuration of the collection being
searched. Because of this variability, we can analyze the algorithm in one of three ways:
by looking at the best case scenario, worst case scenario, and average case scenario.
The best case scenario is when the number of operations is minimized. For linear search,
the best case scenario happens when we get lucky and the first element that we examine
matches our criteria, requiring only a single comparison operation. In general, it is not
reasonable to assume that the best case scenario will be commonly encountered.
The worst case scenario is when the number of operations is maximized. This happens
when we get “unlucky” and have to search the entire collection finding a match at the
last element or not finding a match at all. In either case, we make n comparisons to
search the collection.
A formal average case analysis is not difficult, but is a bit beyond the scope of the
present analysis. However, informally, we could expect to make about n2 comparisons for
successful searches if we assume that all elements have a uniform probability of being
searched for.
Both the worst-case and average-case are reasonable scenarios from which to analyze
the linear search algorithm. In the end, however, the only difference between the two
analyses is a constant factor. Both analyses result in two linear functions,
1
f1 (n) = n f2 (n) = n
2
217
12. Searching & Sorting
The only difference being the constant factor 12 . In fact, this is why the algorithm is called
linear search. The number of comparison operations performed by the algorithm grows
linearly with respect to the input size. For example, if we were to double the input size
from n to 2n, then we would expect the number of comparisons to search the collection
would also double (this applies in either the worst-case and average-case scenarios).
This is what is most important in algorithm analysis: quantifying the complexity of
an algorithm by the rate of growth of the operations (and thus resources) required to
execute the algorithm as the input size n grows.2
Binary Search Analysis
Like linear search, the input size is the size of the collection n and the elementary
operation is the comparison. As presented in the pseudocode, binary search would seem
to perform two comparisons (Lines 5 and 7 in Algorithm 12.3). However, to make the
analysis simpler, we will instead count one comparison operation per iteration of the while
loop. This is a reasonable simplification; in practice the comparison operation would
likely involve a single function call, after which distinguishing between the three cases is
a simple matter of control flow. Further, even if we were to consider both comparisons,
it would only contribute a constant factor of 2 to the final analysis.
Since we perform one comparison for each iteration of the while loop, we need to determine
how many times the while loop executes. In the worst case, the number of iterations is
maximized when we fail to find an element that does not match our criteria. However
each iteration essentially cuts the array in half each time. That is, if we start with an
array of size n, then after the first iteration, it is of size n2 . After the second iteration we
have cut it in half again, so it is of size n4 , after the third iteration it is of size n8 and so
on. More generally, after k iterations, the size of the array is
n
2k
The loop terminates one iteration after the the index variables are equal, l = r. Equiv-
alently, when l = r, the size of the subarray under consideration is 1. That is, the
algorithm stops when the array size has been cut down to 1:
n
=1
2k
Solving for k gives us the number of iterations:
k = log2 (n)
Adding one additional comparison for the final iteration gives us a total of
k = log2 (n)
2
This is the basis of Big-O analysis, something that we will not discuss in detail here, but is of prime
importance when analyzing algorithms.
218
12.1. Searching
comparisons (see Table 12.1). Thus, binary search performs a logarithmic number of
comparisons in the worst case. As we will see, this is exponentially better than linear
search.
Iteration Array Size Comparisons
n
1 2
1
n
2 4
1
n
3 8
1
n
4 16
1
.. .. ..
. . .
n
k 2k
1
.. .. ..
. . .
log2 (n) 1 1
log2 (n) + 1 0 1
Total log2 (n) + 1
Table 12.1.: Number of comparisons and array size after the iteration during the execution
of binary search.
Comparative Analysis
Binary search presents a clear advantage over linear search. There is an exponential
difference between a linear function, n2 and a logarithmic function, log2 (n). To put this
in perspective, consider searching a moderately large database of 1 trillion (1012 ) records.3
Using linear search, even the average-case scenario would require about
1012
= 5 × 1011
2
or about 500 billion comparisons. However, using binary search would only require at
most
log2 (1012 ) = 12 · log2 (10) < 40
comparisons to search. This is a huge difference in performance.
As another comparison, let’s consider how each algorithm’s complexity grows as we
increase the size of the collection being searched. As observed earlier, if we double the
3
In the era of “big data,” 1 trillion records only qualifies as moderately large.
219
12. Searching & Sorting
input size, n → 2n, we would expect the number of comparisons performed by linear
search to also double. However, if we double the input size for binary search, we get the
following.
log2 (2n) = log2 (2) + log (n) = log (n) + 1
That is, only a single additional comparison is necessary to search an array of twice the
size.
The difference between these two algorithms shows up in many different instances. Figure
12.4 contains a screen shot of the search feature in Windows 7. When searching for
particular files or content in particular files, the search can be greatly increased if the
files have been indexed, that is, sorted. As the dialog indicates, non-indexed (unsorted)
records will take far longer to search.
Figure 12.4.: Example of the benefit of ordered (indexed) elements in Windows 7
Though binary search presents a clear advantage over linear search, it only works if the
collection has been sorted.4 Thus, we now turn our attention to the problem of sorting a
collection.
12.2. Sorting
Sorting a collection of data is another fundamental data operation. It is conceptually
simple, but is ubiquitous. There are a large variety of algorithms, data structures and
applications built around the problem of sorting. As we’ve already seen, being able
to sort a collection provides a huge speed up when searching for a particular element.
Sorting provides a natural way to store and organize data.
Problem 2 (Sorting).
Given: a collection of orderable elements, A = {a1 , a2 , . . . , an }
Output: A, sorted in ascending order
The requirement that the collection be made of “orderable” elements can be a bit
technical5 , but essentially we need to be guaranteed that given two elements, a, b in the
4
Binary search also only works when searching an array with random access to its elements. The
performance of binary search cannot generally be realized with data structures such as linked lists or
unordered sets.
5
We require that A be a total order a partially ordered binary relation such that all pairs are comparable.
220
12.2. Sorting
collection, we can determine whether a < b, a = b or a > b. If such a determination
cannot be made, then sorting is impossible.
Again, we can consider variations on this problem. We may want our collection to be
sorted in descending order instead of ascending.6 We may also want the collection itself
to be permuted (that is, reordered) or we may instead want a copy of the collection to be
created and sorted so that the original is unchanged.
We will examine several standard sorting algorithms. Though there are dozens of sorting
algorithms, we will only focus on a few of the more common ones. As with searching,
we can analyze a sorting algorithm based on the number of comparisons it makes in the
worst, best, or average cases. We may also look at alternative resources or operations:
how many swaps does the algorithm make? How much extra memory is required? Etc.
Though we will examine, analyze and compare several sorting algorithms, most pro-
gramming languages provide standard functionality to sort a collection of elements.
It is generally preferable to use the functionality built into whatever language you’re
using rather that reimplementing your own. Typically, these functions are well-designed,
well-tested, optimized and more efficient than any custom alternatives.
12.2.1. Selection Sort
The first sorting algorithm we’ll examine is Selection Sort which is similar to the way
a human would sort a collection of objects. The basic idea is that you search through
the collection and find the minimal element (we say minimal and not minimum because
there could be elements with the same value). Once we’ve found a minimal element, we
can swap it with the “first” element, a1 , placing the minimal element where it belongs in
the collection.
We repeat this process for the remaining elements, a2 , . . . , an , finding the minimal element
among these and swapping with a2 . In general, if we have already sorted the first i − 1
elements, a1 , . . . , ai−1 then we only need to examine the elements ai , . . . , an for the
minimal element, swapping it with ai . We end this process after we have sorted the first
n − 1 elements, a1 , . . . , an−1 since the last element an will already be where it needs to
be. We present Selection Sort as Algorithm 12.4. We illustrate the execution of Selection
6
Technically, these are referred to as non-decreasing and non-increasing respectively. This is because the
collection could contain duplicate elements and not lead to a strictly increasing or strictly decreasing
ordering.
221
12. Searching & Sorting
Sort in Figure 12.5.
Input : A collection A = {a1 , . . . , an }
Output : An array A0 containing all elements of A in nondecreasing order
1 for i = 1, . . . , (n − 1) do
2 amin ← ai
3 for j = (i + 1), . . . , n do
4 if amin > aj then
5 min ← aj
6 end
7 end
8 swap amin and ai
9 end
Algorithm 12.4: Selection Sort
Analysis
We now analyze Selection Sort to determine how complex it is. First, the elementary
operation is the comparison on line 4. We need to determine how many times this line is
executed with respect to the size of the input, n. Observe that on the i-th iteration, the
first i − 1 elements are sorted and we need not make any comparisons among them. We
start by assuming that the ai is the minimum element and compare it to the remaining
n − i elements, requiring n − i comparisons, to find the minimal element. For example,
in the first iteration we make n − 1 comparisons, the second we make n − 2, etc. The
last iteration we make only 1 comparison. Totaling these all up gives us
(n − 1) + (n − 2) + (n − 3) + · · · + 3 + 2 + 1
Which can be rewritten as
n−1
X
i = 1 + 2 + 3 + · · · + (n − 2) + (n − 1)
i=1
We can use Gauss’s Formula to solve this summation.
Theorem 1 (Gauss’s Formula). The sum of integers 1 up to n can be written as follows.
n
X n(n + 1)
i = 1 + 2 + 3 + · · · + (n − 1) + n =
i=1
2
In Selection Sort, the number of comparisons doesn’t sum up to n, only n−1. Substituting
this in gives us
222
12.2. Sorting
42 4 9 4 102 34 12 2 0 0 4 9 4 102 34 12 2 42
swap
(a) First iteration. We find the minimal element, 0, at the last index,
swapping it with the first element. At this point, the first element is sorted.
0 4 9 4 102 34 12 2 42 0 2 9 4 102 34 12 4 42
swap
(b) Second Iteration. Now starting with the second element, the minimal
element among the remaining is found at the second to last element. 4 and
2 are swapped. At this point, the first two elements are sorted.
0 2 9 4 102 34 12 4 42
0 2 4 9 102 34 12 4 42
swap
(c) Third iteration. Since we are using the strictly-less than comparison, the
first 4 is the minimal element and swapped with 9.
0 2 4 9 102 34 12 4 42 0 2 4 4 102 34 12 9 42
swap
(d) Fourth iteration. At this point, the first 3 elements are sorted. We find
the minimal element (the other 4) and swap it with 9. At the end of this
iteration, the first 4 elements are sorted.
0 2 4 4 102 34 12 9 42 0 2 4 4 9 34 12 102 42
swap
(e) Fifth iteration. The 9 is swapped with 102, sorting the first 5 elements.
0 2 4 4 9 34 12 102 42
0 2 4 4 9 12 34 102 42
swap
(f) Sixth iteration. 12 is swapped with 34.
0 2 4 4 9 12 34 102 42 0 2 4 4 9 12 34 102 42
swap
(g) Seventh iteration. 34 ends up being the minimal element and we essen-
tially swap it with itself. Even though the “current” element was also the
minimal element, we still had to compare the current element with all other
elements; in this case we made 2 comparisons.
0 2 4 4 9 12 34 102 42 0 2 4 4 9 12 34 42 102
swap
(h) Eighth iteration. This is the final iteration, we swap 42 and 102. After
this iteration, the final element, 102 is already where it belongs.
Figure 12.5.: Example execution of Selection Sort.
223
12. Searching & Sorting
n−1
X n(n − 1)
i=
i=1
2
Another way to analyze the code is to count the number of comparisons with respect
to the for loop index variables. In particular, there is one comparison made on line 4.
Line 4 itself is executed once for each time the inner for loop on line 3 executes which
executes for j running from i + 1 up to n. Line 3 and the entire inner for loop executes
once for each time the outer for loop executes, that is for i running from 1 up to n − 1.
This gives us the following summation.
n−1 X
X n
1
i=1 j=i+1 |{z}
| {zline }4
| {zline 3 }
line 1
Solving this summation gives us:
n−1 X
X n n−1
X
1= n−i
i=1 j=i+1 i=1
n−1
X n−1
X
= n− i
i=1 i=1
n(n − 1)
= n(n − 1) −
2
n(n − 1)
=
2
This illustrates that Selection Sort is a quadratic sorting algorithm, requiring roughly n2
comparisons to sort an array of n elements. We analyze this further below.
12.2.2. Insertion Sort
Another basic sorting algorithm is Insertion Sort which works slightly differently than
Selection Sort. Rather than finding a minimal element and swapping with the “current”
element, the current element is inserted in the list where it belongs.
If we consider just the first element, the collection is sorted by definition. Now consider
the second element: either its greater than the first element and so is already sorted,
or it is less than the first element and needs to be swapped. In either case, the first
224
12.2. Sorting
two elements are now sorted. If we continue this, then on the i-th iteration, the first i
elements, a1 , . . . , ai are sorted (just as with Selection Sort). Now consider the (i + 1)-th
element: we will insert it amongst the elements a1 , . . . , ai where it needs to be.
We insert the “current” element, ai+1 by comparing it to ai : if ai > ai+1 , then we swap
them. We keep comparing the current element to the one immediately to its left, shifting
the current element down the collection until we find an element that is less than or
equal to the current element at which point we stop. Now the elements a1 , . . . , ai+1 are
now sorted. In contrast to Selection Sort, we do need to process the last element as it
might not be where it needs to be. The full pseudocode is presented in Algorithm 12.5.
An example of an execution of Insertion Sort can be found in Figure12.6.
Input : A collection A = {a1 , . . . , an }
Output : An array A0 containing all elements of A in nondecreasing order
1 for i = 2, . . . , n do
2 x ← ai
3 j←i
4 while j > 1 and aj−1 > x do
5 aj ← aj−1
6 decrement j
7 end
8 aj ← x
9 end
Algorithm 12.5: Insertion Sort
Analysis
As we can see in the example run of Insertion Sort, not every iteration needs to make
comparisons with all elements in the sorted part of the collection. For example, in
iteration 4 we only had to make one comparison and we were done. In other iterations
such as the last two, we had to make comparisons to every element in the sorted part of
the collection. This illustrates that Insertion Sort is adaptive and may have a different
complexity depending on the structure of the collection it sorts.
Let’s consider the best case in which the number of comparisons is minimized. Suppose,
for example, we ran Insertion Sort on a collection that was already sorted. Each iteration
would only need one comparison to determine that the element was already where it
needed to be. As there are only n − 1 iterations, in the best case, Insertion Sort makes
n − 1 comparisons.
In contrast, the worst case would occur if the list was already sorted, but in reverse order.
225
12. Searching & Sorting
42 4 9 4 102 34 12 2 0 4 42 9 4 102 34 12 2 0
(a) First iteration. We insert 4 in front of 42, requiring 1 comparison.
2
1
4 42 9 4 102 34 12 2 0 4 9 42 4 102 34 12 2 0
(b) Second iteration. The first two elements are sorted, we insert 9 by making
two comparisons: to find that it is less than 42, but greater than 4. At the
end of the iteration, the first three elements are sorted.
3
2
1
4 9 42 4 102 34 12 2 0 4 4 9 42 102 34 12 2 0
(c) Third iteration. The first three elements are sorted, we insert the second
four by making 3 comparisons.
1
4 4 9 42 102 34 12 2 0 4 4 9 42 102 34 12 2 0
(d) Fourth iteration. Here, only one comparison is necessary to find that 102
is already sorted.
3
2
1
4 4 9 42 102 34 12 2 0 4 4 9 34 42 102 12 2 0
(e) Fifth iteration. Here, 3 comparisons are necessary to insert 34 between 9
and 42.
4
3
2 1
4 4 9 34 42 102 12 2 0 4 4 9 12 34 42 102 2 0
(f) Sixth iteration. Here, 4 comparisons are necessary to insert 12 between 9
and 34.
7
6
5
4
3
2 1
4 4 9 12 34 42 102 2 0 2 4 4 9 12 34 42 102 0
(g) Seventh iteration. Here, the number of comparisons is maximized as we
shift 2 all the way to the front of the array.
Figure 12.6.: Example execution of Insertion Sort. Each iteration depicts the comparisons
to previous elements; the last comparison is dashed indicating a comparison
was made, but not a swap. The final iteration is omitted for space, but
would require 8 comparisons to insert 0 at the front of the collection.
226
12.2. Sorting
The i-th iteration would require i comparisons to move the current element all the way
to the front of the collection. Again, this gives us a summation:
n−1
X n(n − 1)
i=
i=1
2
matching the complexity of Selection Sort.
We could also analyze Insertion Sort with respect to average case. On average, we would
expect to make about 12 of the total possible comparisons on each iteration. That is,
n−1
X i
i=1
2
Moving the constant outside the summation and applying Gauss’s Formula would give
us an expected number of comparisons to be
n(n − 1)
4
This is still a quadratic function, but the constant involved and the fact that Insertion
Sort is more adaptive to the input make Insertion Sort a much better algorithm in
practice than Selection Sort. In fact, Insertion Sort is very efficient on “small” arrays in
practice and is used in many hybrid algorithm implementations (see Section 12.2.5).
12.2.3. Quick Sort
Selection Sort and Insertion Sort are simple algorithms, but inefficient, making a quadratic
number of comparisons in even the average case. A more sophisticated and efficient
algorithm is Quick Sort, first developed by Tony Hoare in the early 1960s [17, 18]. Quick
Sort is a divide-and-conquer style algorithm that attempts to solve the sorting problem
by splitting a collection up into two parts, then recursively sorting each part.
The basic idea is as follows. First, choose a pivot element p in the collection. We will
then partition all the elements in the collection around this pivot element by placing all
elements less than p in the “left” partition and all elements greater than p in the “right”
partition. This concept is similar to binary search. After partitioning all the elements,
we place p between them so that p is where it needs to be. We then repeat this process
on the two partitions recursively. The recursion stops when the size of the sub-collection
is trivially sorted (it is empty or consists of a single element).
Quick Sort is presented as Algorithm 12.6 with a partitioning subroutine presented in
Algorithm 12.7. The partitioning chooses the first element in the sub-collection as the
pivot element. Further, the partitioning is done in-place: we maintain two index variables,
227
12. Searching & Sorting
i, j and increment/decrement them respectively to find a pair that are both in the wrong
partitions, swapping them. The partitioning continues until the two index variables meet
each other. As a final step, the pivot element is placed between the two partitions and
the index at which it is placed is returned to the main QuickSort routine so that it
can make two recursive calls on the two partitions.
We depict a few examples of the partitioning algorithm. Figure 12.7 depicts the first
partitioning on the same example array while Figures 12.8 and 12.9 depict subsequent
228
12.2. Sorting
partitioning operations on subarrays as part of the recursion.
Input : A collection A = {a1 , . . . , an }, indices l, r
Output : A, sorted in ascending order
1 if l < r then
2 p ← Partition(A, l, r)
3 QuickSort(A, l, p − 1)
4 QuickSort(A, p + 1, r)
5 end
Algorithm 12.6: QuickSort
Input : A collection A = {a1 , . . . , an }, indices l, r
Output : An index s such that the sub-collection A from l to r has been
partitioned around s so that all elements al , . . . as−1 are less than as
and all elements as+1 , . . . , ar are greater than as
1 pivot ← al
2 i ← (l + 1)
3 j←r
4 while i < j do
5 while i < j And ai ≤ pivot do
6 i ← (i + 1)
7 end
8 while i < j And aj ≥ pivot do
9 j ← (j − 1)
10 end
11 swap ai , aj
12 end
//Swap the pivot
13 if ai ≤ pivot then
14 swap pivot, ai
15 output i
16 else
17 swap pivot, ai−1
18 output (i − 1)
19 end
Algorithm 12.7: In-Place Partition
229
12. Searching & Sorting
42 4 9 4 102 34 12 2 0 42 4 9 4 0 34 12 2 102
swap i j
j
i
(a) First iteration. 42 is chosen as the pivot element. The index variable
i moves over to 102, the first element that is greater than 42 and on the
“wrong” side of the partition. The j index variable does not move as 0 is less
than the pivot element and on the wrong side; these are swapped.
42 4 9 4 0 34 12 2 102 2 4 9 4 0 34 12 42 102
j s
i
(b) Second iteration. The index variable i moves all the way to the right
as all remaining elements are less than the pivot, 42. The index variable j
remains at 102 as i is now equal to j. The pivot, 42 is placed between the
two partitions and its resulting index, s is returned.
Figure 12.7.: Example execution of the Partition subroutine in Quick Sort. A total
of 8 comparisons are made, 9 if you count the last swap outside the while
loop. The partition returns s as the pivot position; the right-partition is
sorted as it only consists of 1 element.
2 4 9 4 0 34 12 2 0 9 4 4 34 12
swap i j
i j
(a) First iteration. In this partitioning, 2 is the pivot element.
The index variable i is not incremented as 4 is larger than
the pivot. The index variable j decrements to 0 and they are
swapped.
2 0 9 4 4 34 12 0 2 9 4 4 34 12
s
i, j
(b) Second iteration. The index variable i is incremented
once, while j is decremented to meet it. After the while loop
the second case applies as ai = 9 > 2 = pivot, and so we
swap ai−1 = 2 with the pivot.
Figure 12.8.: Example execution of the Partition subroutine in Quick Sort on the first
recursive call on the left partition. A total of 6 comparisons are made, 7 if
you count the last swap outside the while loop. The partition returns s as
the pivot position; in this case the left-partition is sorted as it only consists
of 1 element.
230
12.2. Sorting
9 4 4 34 12 4 4 9 34 12
s
i, j
(a) First (and only) iteration. In this parti-
tioning, 9 is the pivot. The index variable i
is incremented to 34 while j decrements to
match. 34 is swapped with itself. After this
iteration, the second condition applies and
the pivot is swapped with ai−1 = 4
Figure 12.9.: Example execution of the Partition subroutine in Quick Sort on the
second recursive call on the right partition. A total of 5 comparisons are
made, 6 if you count the last swap outside the while loop. The partition
returns s as the pivot position.
Analysis
We can easily analyze how many comparisons are made by the Partition subroutine.
Suppose that we are given a (sub)array of n elements. Since the pivot element must be
compared to every other element in the (sub)array, it must make n − 1 comparisons to
partition the elements around the pivot. If we count the last comparison to determine
where to place the pivot, it would be n comparisons (but the difference is trivial).
The analysis of Quick Sort itself is a bit more involved and is highly dependent on how
well the Partition subroutine splits the array. In the worst case, our pivot choice
will always partition the array into one “empty” subarray and one subarray with n − 1
elements (we do not count the pivot element). One such example of this would be if our
collection is already sorted. In this case, one of the recursive calls would result in no
comparisons and the other would result in n − 1 comparisons. This lopsided recursion
would result in the following number of comparisons:
n + (n − 1) + (n − 2) + · · · + 3 + 2 + 1
which is exactly Gauss’s Formula, meaning that Quick Sort would perform
n(n + 1)
2
in the worst case.
However, in the sorting scenario, we cannot always assume the worst case. If we are given
random data, then the likelihood that we will always have such an extremely lopsided
partitioning is extremely small. A more reasonable analysis would involve the average
case: where each partition is roughly an equal size, about n2 . This happens when our
pivot choice is the median (or close to the median) element.
231
12. Searching & Sorting
To analyze the number of comparisons in this case, we can setup a recurrence relation:
n
C(n) = 2C +n
2
Here, C(n) represents the number of comparisons made by Quick Sort on an array of size
n. The first term on the right hand side represents the fact that we make 2 recursive calls
on subarrays of size (roughly) n2 . The second term captures the number of comparisons
we make in the Partition subroutine. Solving this recurrence is a bit beyond the scope
of the current discussion. However, it can be shown that this is roughly equivalent to
n log (n)
comparisons in the best case.
The difference between the best and worst case scenarios is in our pivot choice. Though
the ideal pivot choice is the median element, to find the median the usual strategy is to
sort the collection first. This puts the cart before the horse. If the data we are sorting
is in more-or-less random order, then the choice of the first element as a pivot is good
enough as it is unlikely that we will always have a bad paritioning. However, there are
other strategies.
One strategy is to randomly choose a pivot element. A random choice would make the
worst-case scenario very unlikely over many runs of the algorithm. Another strategy
is to choose the median of three elements (either fixed or randomized), ensuring that
neither partition will ever be empty. This strategy can be taken further to find the
median-of-three amongst each third of the array and then take the median of these (or the
“ninther”). The more effort you put into finding the median the more the performance
degrades in practice.7 A more sophisticated analysis of these strategies yields a complexity
similar to the best case [9].
12.2.4. Merge Sort
Another “fast” sorting algorithm is Merge Sort, due to John von Neumann, 1945 (as
reported by Knuth [27]). The performance is similar to Quick Sort’s best/average case,
making
n log (n)
comparisons. However, Merge Sort’s performance does not depend on the structure of the
input array or a pivot choice, guaranteeing this performance in the best/average/worst
case.8
7
For example, there does exist a median-finding algorithm that runs in linear time which would
guarantee the theoretically best running time, but the algorithm is recursive and has a large overhead,
making its use slow in practice.
8
Still, Quick Sort is still more common in practice because it has less memory requirements and the
pivot choice strategies can mitigate the risk of the worst-case scenario.
232
12.2. Sorting
Merge Sort works by first dividing the list into two (roughly) equal partitions. It then
recursively sorts each partition. The recursion stops when the subarray is of size ≤ 1 just
as with Quick Sort. The difference, however, is what Merge Sort does after the recursion.
After having sorted the left partition, L and the right partition R, Merge Sort merges
the two sorted partitions into one.
The Merge subroutine works by maintaining two index variables, i, j, one for each
partition. Suppose that the index variables correspond to the elements Li and Rj in
the left/right partition. If Li ≤ Rj , we add Li to the end of a temporary array and
increment i. Otherwise we place Rj into the temporary array and increment j. We
continue until we have examined every element in one or both partitions (if one partition
still has elements in it, we can simply copy the rest over in order). This merge operation
works because each subarray is sorted.
Merge Sort is presented as Algorithm 12.8 with the Merge subroutine as Algorithm
12.9.
Input : A (sub)collection A = {al , . . . , ar }, indices l, r
Output : A collection A0 which is A sorted
1 if l < r then
2 m ← b l+r
2
c
3 L ← MergeSort(A, l, m)
4 R ← MergeSort(A, m + 1, r)
5 output Merge(L, R)
6 else
7 output A
8 end
Algorithm 12.8: MergeSort
233
12. Searching & Sorting
Input : Two sorted collections, L, R of size n, m respectively.
Output : A sorted collection A consisting of all elements of L and R
1 A ← a new, empty collection
2 i←1
3 j←1
4 k ← 1 //index variable for A
5
6 while i ≤ n And j ≤ m do
7 if Li ≤ Ri then
8 Ak ← Li
9 i ← (i + 1)
10 else
11 Ak ← Lj
12 j ← (j + 1)
13 end
14 k ← (k + 1)
15 end
//At least one collection is empty, we can blindly copy the other
16 while i ≤ n do
17 Ak ← Li
18 i ← (i + 1)
19 k ← (k + 1)
20 end
21 while j ≤ m do
22 Ak ← Rj
23 j ← (j + 1)
24 k ← (k + 1)
25 end
26 output A
Algorithm 12.9: Merge
We present an example run of Merge Sort in Figure 12.10 (here, we have made the
collection of size 8 to emphasize the even split). An example run of the Merge
subroutine on the last merge operation of this algorithm is presented in Figure 12.11.
234
12.2. Sorting
42 4 9 4 102 34 12 2
42 4 9 4 102 34 12 2
42 4 9 4 102 34 12 2
42 4 9 4 102 34 12 2
merge merge merge merge
4 42 4 9 34 102 2 12
merge merge
4 4 9 42 2 12 34 102
merge
2 4 4 9 12 34 42 102
Figure 12.10.: Illustration of Merge Sort’s recursion and merge operations.
235
12. Searching & Sorting
4 4 9 42 2 12 34 102 4 4 9 42 2 12 34 102
i j i j
2 2 4
k k
(a) Iteration One. L1 = 4 > R1 = 2, so (b) Iteration Two. Now the element in
the element in the right partition is copied the left partition is lesser and is copied,
into A1 . Both j, k are incremented. incrementing i, k
4 4 9 42 2 12 34 102 4 4 9 42 2 12 34 102
i j i j
2 4 4 2 4 4 9
k k
(c) Iteration Three. Again the element in (d) Iteration Four. And so on.
the left partition is less.
4 4 9 42 2 12 34 102 4 4 9 42 2 12 34 102
i j i j
2 4 4 9 12 2 4 4 9 12 34
k k
(e) Iteration Five (f) Iteration Six
4 4 9 42 2 12 34 102 4 4 9 42 2 12 34 102
i j j
2 4 4 9 12 34 42 2 4 4 9 12 34 42 102
k k
(g) Iteration Seven (h) Final Copy. After one sub-collection
has been exhausted the rest (in this case
only one) of the elements in the other are
blindly copied over.
Figure 12.11.: Demonstration of the merge operation in Merge Sort. Here we depict the
final Merge subroutine invocation from the previous example.
236
12.2. Sorting
Analysis
Because Merge Sort divides the list first, an even split is guaranteed. After the recursion,
the Merge subroutine requires at most n − 1 comparisons to merge the two collections.
This leads to a recurrence relation similar to Quick Sort,
n
C(n) = 2C + (n − 1)
2
A similar analysis yields a complexity of n log (n).
12.2.5. Other Sorts
There are dozens of other sorting algorithms and many more variations on sorting
algorithms, each with some unique properties and advantages. For example, Heap Sort,
due to J. W. J. Williams, 1964 [39], uses a data structure called a heap. A heap stores
elements in a tree structure and offers efficient insertion of elements and retrieval of the
minimal (or maximal for a “max-heap”) element. The sorting algorithm then simply
inserts each element into the heap, and retrieves each element out of the heap. Because
of the the heap data structure, elements come out of the heap in order.
Other sorting algorithms are variations on those we’ve already seen or hybrid sorting
algorithms. For example, we’ve already noted that Insertion Sort is efficient on “small”
arrays. One common technique is to use a fast sorting algorithm such as Quick Sort or
Merge Sort, but then switch over to Insertion Sort at some point in the recursion rather
than recursing to the point that the collection is of size 1 (or 0). This switch point is
usually tuned using empirical experiments.
A more recent sorting algorithm is Tim Sort, due to Tim Peters in 2002 [35] who
originally developed it as the default sorting algorithm for the Python language. It has
since been adopted in Java (version 7 for arrays of non-primitive types). Tim Sort is a
sort of “bottom-up” Merge Sort/Insertion Sort hybrid. Instead of recursing, it looks for
subsequences of elements that are already in order or nearly in order, then merges them.
It was designed to have many of the desirable properties of a sorting algorithm including
stability (see Section 12.3.6).
12.2.6. Comparison & Summary
To illustrate just how much more efficient an n log (n) sorting algorithm is over a naive
n2 algorithm consider the same scenarios as with searching. Suppose we want to sort a
huge collection of 1 trillion, 1012 , elements. Doing so with Selection Sort or Insertion
Sort would require about
n2 = (1012 )2 = 1024
237
12. Searching & Sorting
or 1 septillion comparisons. The same sorting operation using either Quick Sort or Merge
Sort would require only
n log (n) = 1012 log 1012 ≈ 4 × 1013
or just under 40 trillion comparisons. This is 25 billion times fewer operations.
As another example, suppose that we sort a collection with n elements and then want to
double the size of our collection to 2n. How do each of these types of algorithms perform?
For the slow, n2 algorithms we have
(2n)2 = 4n2
Doubling the input size quadruples the number of operations Selection Sort and Insertion
Sort perform. However, for Quick Sort and Merge Sort, we only have
2n log (2n) = 2n (log (2) + log (n)) = 2n log (n) + 2n
That is, only about twice as many operations (with an additive term of 2n). Table 12.2
gives a summary of the complexity and other properties of the sorting algorithms we’ve
seen.
Complexity
Algorithm Stable? Notes
Best Average Worst
Selection Sort ∼ n2 ∼ n2 ∼ n2 No
Insertion Sort ∼n ∼ n2 ∼ n2 Yes Best in practice for
small collections
Quick Sort ∼ n log n ∼ n log n ∼ n2 No Performance depends
on pivot choices
Merge Sort ∼ n log n ∼ n log n ∼ n log n Yes Requires extra space
Table 12.2.: Summary of Sorting Algorithms. See Section 12.3.6 for a discussion on
stability.
12.3. Searching & Sorting In Practice
12.3.1. Using Libraries and Comparators
In practice you do not write your own searching and sorting algorithm implementations.
Instead, you use the functionality provided by the language, a framework, or a library.
First, there is rarely a good reason to “reinvent the wheel” and write your own if the
functionality already exists. Second, the algorithms and code provided by a language
or library are typically optimized and have been well-tested. Established libraries have
238
12.3. Searching & Sorting In Practice
been developed with thousands of man-hours and have proven themselves over millions
of computing hours.
Typically, searching and sorting functions in a language are made to be generic: they
don’t just search a collection of numbers or strings. Instead, they accept collections of
any type. The basic algorithms for searching and sorting are generic themselves (after all
we presented them as pseudocode). The only real difference between an implementation
for, say, numbers versus a sorting algorithm for strings is how pairs of elements are
compared and ordered.
This genericness extends to objects. It would be extremely inefficient, development-wise,
to have to rewrite Quick Sort for a collection of student objects to sort them by name,
then another to sort them by GPA, then another for ID, and repeat them all again for a
reversed ordering. Instead, a single, generic sorting algorithm is implemented that can
be configured by passing in a comparator.
A comparator is a function or object that provides functionality to determine how to
order two elements. In general, a comparator takes two arguments, a, b which are the
elements to be compared and returns an integer value with the following “contract.” It
returns:
• something negative, < 0 if a comes before b, a < b
• zero if a and b are equivalent, a = b
• something positive, > 0 if a comes after b, a > b
We’ve previously seen this type of functionality when comparing strings in Chapter 8.
Using comparators allows us to reuse the generic search and sorting algorithms. Now for
each sorting that we want, we only need to create a comparator to define the ordering
rather than reimplementing the whole algorithm every single time. This relationship is
depicted in Figure 12.12.
12.3.2. Preventing Arithmetic Errors
Recall that in binary search, we need to compute the index of the middle element.9 Given
a left l and right r index variable, we computed the middle index as
l+r
m←
2
Though mathematically correct, when implementing an expression like this, care must
be taken. We may initially translate this pseudocode into a line that looks something
like the following.
9
Some implementations of Quick Sort will do something similar when choosing the “middle” element
as a pivot.
239
12. Searching & Sorting
array Sorting
sorted array
Input Algorithm Output
< 0 if a < b
a, b order = 0 if a = b
> 0 if a > b
Comparator
Figure 12.12.: Generalized Sorting with a Comparator. A sorting algorithm doesn’t
need to know what it is sorting or how they are ordered as long as it has
access to a comparator that does know how to order elements. By using a
comparator, the sorting function can be kept general and generic so that
one implementation can be used for any type of data.
int middle_index = (left + right) / 2;
However, this is prone to arithmetic errors in certain situations, particularly when dealing
with large arrays. If the variables left and right have a sum that exceeds the
maximum value that a signed 32-bit integer can hold (231 − 1 = 2, 147, 483, 647), then
overflow will occur before the division by 2, leading to a (potentially) negative index
value and thus an invalid out-of-bounds error or exception.
One solution would be to use a variable type that supports larger values. For example,
a 64-bit signed integer would be able to handle arrays of 9.223 quintillion elements.
However, depending on the language, you may not be able to use such variable types as
index values. Another solution is to use operations that do not introduce this potential
for overflow. For example,
l+r (r − l)
=l+
2 2
but the expression on the right hand side will not be prone to overflow. Thus the code,
int middle_index = left + (right - left) / 2;
would be safer to use. In fact, this bug is quite common [33] and was in the Java
implementation of binary search, unreported for nearly a decade [10].
240
12.3. Searching & Sorting In Practice
12.3.3. Avoiding the Difference Trick
Another issue related to arithmetic overflow is a common “trick” used in comparators
when ordering integer values. Consider the following example: we want to order integer
values in ascending order, the basic logic would look something like the following.
1 if a < b then
2 output −1
3 else if a = b then
4 output 0
5 else
6 output +1
7 end
For example, if a = 5 and b = 10 then our comparator would output −1. If the values
were a = 10, b = 5 it would output +1, and if they were equal, a = b = 10 then it would
output zero. A common “trick” is to instead compute the difference between these values,
a − b. Observe:
a b a−b
5 10 −5
10 5 5
5 5 0
The sign of the difference in each of these examples matches the logic of our if-else-if
statement. The lazy programmer may be tempted to write a one liner, “output (a − b)”
instead of the if-else-if statement. However, this would fail for certain values of a and b.
Suppose both of them are 32-bit 2s complement integers. And suppose that a = 231 − 1,
the maximum representable value, and b = −10. In the logic above, b would come before
a and so we would expect a positive result. However, our arithmetic trick would give the
following result:
(231 − 1) − (−10) = 231 + 9
which, mathematically, is positive, but exceeds the maximum representable value, leading
to overflow. In most systems, the result of this arithmetic is −2, 147, 483, 639, a negative
value. There are many other input values that could cause arithmetic overflow. Only if
you are absolutely sure that no arithmetic overflow is possible should you even consider
using this “trick.”
Another issue with this trick is when comparing floating point values. GPAs for example:
suppose that a = 4.0 and b = 3.9. Their difference would be a − b = 0.1. However, a
comparator returns an integer value. In some languages this result would be casted to
241
12. Searching & Sorting
an integer, truncating the fractional value, so that 0.1 → 0, meaning that a GPA of 3.9
is “equivalent” to the 4.0. Given the potential for errors, it is best to avoid this trick
altogether.
12.3.4. Importance of a Total Order
In many applications it is important to design your comparator to provide a total order.
For example, suppose we have students “Gary Busey” with an ID of 1234 and another
student with the same name, “Gary Busey” but with an ID of 4321. It is entirely possible
(and common) for different people to have the same names. However, a comparator that
ordered student objects based only on the name fields would interpret these as the same
person.
The distinction is especially important when using a comparator in a sorted collection
(such as a Binary Search Tree, or Ordered Hash Map data structure) that maintains
an ordering on the elements. Many of these data structures do not allow “duplicate”
elements where duplication is determined by the comparator. Attempting to insert both
of these students will likely result in only one of them being in the collection as the
second will be interpreted as a a duplicate. In such scenarios it is important to design
your comparator to break ties by using some unique data field of an object such as an ID.
12.3.5. Artificial Ordering
Many languages recognize what is called a “natural ordering” on certain elements. For
example, numbers have a natural ordering: from least to greatest. Strings also have a
natural ordering: lexicographic ordering. However, we often wish to order elements in
an artificial ordering. For example, suppose we wish to include the year of a student,
Freshman, Sophomore, Junior, or Senior. If we modeled these as strings, the natural
ordering would be alphabetical:
F reshman, Junior, Senior, Sophomore
However, if we order students by year, we would want the artificial order of Freshman,
Sophomore, Junior, or Senior.
To do this, we might have a whole series of if-else-if statements to order these elements
242
12.3. Searching & Sorting In Practice
Input : Two student objects, a, b
1 if a.year = b.year then
2 output 0
3 else if a.year = “F reshman00 then
4 output −1
5 else if b.year = “F reshman00 then
6 output 1
7 else if a.year = “Sophomore00 then
8 output −1
9 ...
However, this logic is complex and does not provide a good solution if we want to then
add support for “Pre-freshman” or “Graduate”, etc.
Another solution would be to model the year using a data type that has a natural
ordering. For example, we could define an enumerated type and associate each of the
years with 0, 1, 2, 3; giving them a natural ordering. Alternatively, we could use a data
structure, such as a map, to model the artificial ordering. For example, we could map
“Freshman” to 0, “Sophomore” to 1, etc. Then, when we wanted to order two elements,
we could look up the “natural value” via the map and use their natural ordering to order
our elements.
12.3.6. Sorting Stability
One desirable property of sorting algorithms is stability. A sorting algorithm is stable if
the relative order of “equal” elements is preserved. For example, suppose we have the
following integer values:
10, 2a , 5, 2b
The subscripts on the two 2 values are for demonstration purposes only. A stable sorting
algorithm would sort the elements as:
2a , 2b , 5, 10
preserving the relative ordering of the two 2 elements. The element 2a came before 2b
prior to sorting and remains so after sorting. However, an unstable sorting algorithm
may instead produce
2b , 2a , 5, 10
The collection is still sorted, but the two equal elements have been reversed from their
original ordering.
243
12. Searching & Sorting
Sorting stability is often desirable for data presentation. A user can typically sort table
data by clicking on a column header. Suppose we sorted a table of students first by GPA
then by year. We would expect that all Freshman would be grouped together and within
that group, would be ordered by GPA (because the first ordering would be preserved).
An unstable sorting algorithm would result in all Freshman being grouped together, but
within that grouping, the students would not necessarily be ordered by GPA.
As indicated in Table 12.2, some algorithms (as presented) are stable and others are not.
For example, Selection Sort is not stable. Consider the following input:
2a , 2b , 1, 5
In the first iteration, 1 and 2a would be swapped, resulting in a sorted collection and no
further swaps, but with 2b preceding 2a .
Insertion Sort, however, is stable: it only moves an element down the collection if it is
strictly less than its adjacent element. Likewise, Merge Sort is stable since we “prefer”
elements from the left partition when equal.
Quick Sort is not stable as the partitioning can easily place things out of their original
relative ordering. Usually, sorting algorithms can be made to be stable by doing some
extra work, but it may impact the performance.
12.4. Exercises
Exercise 12.1. Give an input example input demonstrating that the Quick Sort al-
gorithm, as presented, is unstable. Run through the algorithm to demonstrate how it
results in an unstable sort.
Exercise 12.2. Implement the sorting algorithms described in this chapter in the
programming language of your choice. Then setup experiments: run each on randomly
ordered collections many times to get an average run time. Graph these empirical results
and see if they match the theoretical results of our analysis. Be sure to also include any
built-in sorting functionality your language provides as a benchmark.
Exercise 12.3. Ternary search is similar to binary search in that it searches a sorted
array. However, instead of splitting the array in two, it splits it into three partitions
and makes two comparisons to determine which third the element lies in (if it is in
the collection). Implement ternary search and benchmark it against a binary search
implementation.
Exercise 12.4. Data has a “natural” ordering: numbers are ordered in nondecreasing
order, strings are ordered lexicographically (according to the ASCII text table). However,
in many situations, the natural ordering isn’t the expected ordering. For example, class
244
12.4. Exercises
years are usually ordered Freshman, Sophomore, Junior, Senior whereas the natural
ordering would order them Freshman, Junior, Senior, Sophomore.
Write a program to sort a collection of strings according to an arbitrary artificial ordering.
That is, instead of the A–Z alphabetic ordering, we will order them according to an
alternative ordering of the English alphabet. As an example, one possible ordering would
be:
n e d c r h a l g k m z f w j o b v x q y i p u s t
Your job will be to sort a list of English language words using this artificial ordering of
the English alphabet. Specifically, you will read in an input file in the following format.
The first line is the new ordering of English letters, each separated by a space. Each line
after that contains a single string. You will read in this file, process it and produce a
reordered list of the words sorted according to the new ordering.
An example input:
n e d c r h a l g k m z f w j o b v x q y i p u s t
vcawufotrb
laencfuesw
gvtkwekfom
vrsfqictqc
wmcvmjmtet
qetegyqelu
newaxdtjlt
nfrfrwkknj
fzqrvgblov
gkkmgwwwpa
The result ordering:
Artificial Ordering:
newaxdtjlt
nfrfrwkknj
laencfuesw
gkkmgwwwpa
gvtkwekfom
fzqrvgblov
wmcvmjmtet
vcawufotrb
vrsfqictqc
245
12. Searching & Sorting
qetegyqelu
For simplicity, you can assume that all words will be lower case and no non-alphabetic
characters are used. However, you may not assume that all words will be the same length.
Words of a shorter length that are a prefix of another word should be ordered first. For
example, “newax” should come before “newaxn” in the ordering above.
Exercise 12.5. Write comparators for all the member fields of the album object in
Exercise 10.2.
Exercise 12.6. Write comparators for all the member fields of the savings account
object in Exercise 10.3.
Exercise 12.7. Write comparators for all the member fields of the stadium object in
Exercise 10.4.
Exercise 12.8. Write comparators for all the member fields of the network device object
in Exercise 10.5.
Exercise 12.9. Write comparators for all the member fields of the airport object in
Exercise 10.6.
246
13. Graphical User Interfaces & Event
Driven Programming
This chapter may appear in a future version.
247
14. Introduction to Databases &
Database Connectivity
This chapter may appear in a future version.
249
Part I.
The C Programming Language
251
15. Basics
The C programming language is a relatively old language, but still widely used. It is
universal in that nearly every system, platform, and operating system has a C compiler
that produces machine code for that system. C is used extensively in systems programming
for operating system kernels, embedded systems, microcontrollers, and supercomputers. It
is generally an “imperative” language which is a paradigm that characterizes computation
in terms of executable statements and functions that change a program’s state (variable
values). C has been highly influential in the design and syntax of other languages
including C++, Objective-C, C#, Java, and PHP, among many others. Many languages
have adopted the basic syntactic elements and structured programming approach of the
C language.
C was originally developed by Dennis Ritchie while at AT&T Bell Labs 1969–1972. C
was born out of the need for a new language for the PDP-11 minicomputer that used
the Unix operating system (written by Ken Thompson). From its inception, C has had
a close relation to Unix; in fact the operating system was subsequently rewritten in C,
making it the first OS to be written in a language other than assembly. The language
was dubbed “C” as its predecessor was named “B,” a simplified version of BCPL (Basic
Combined Programming Language). The first formal specification was published as The
C Programming Language by Kernighan and Ritchie (1978) [26] often referred to as
“The K&R Book” which would later become the American National Standards Institute
(ANSI) C standard.
C gained in popularity and directly influenced object-oriented variations of it. Bjarne
Stroustrup developed C++ while at Bell Labs from 1979–1983. Brad Cox and Tom
Love developed Objective-C from 1981–1983 at their company Stepstone. Subsequent
standards of the C language have added and extended features. In 1990, the International
Organization for Standardization (ISO)/IEC 9899:1990 standard, referred to as C89
or C90, was adopted. About every 10 years since, a new standard has been adopted;
ISO/IEC 9899:1999 (referred to as C99) in 1999 and ISO/IEC 9899:2011 (C11) in 2011.
15.1. Getting Started: Hello World
The hallmark of an introduction to a new programming language is the Hello World!
program. It consists of a simple program whose only purpose is to print out the message
253
15. Basics
1 #include <stdlib.h>
2 #include <stdio.h>
3
4 /**
5 * Basic Hello World program in C
6 * Prints "Hello World" to the standard output and exits
7 */
8 int main(int argc, char **argv) {
9
10 printf("Hello World\n");
11
12 return 0;
13 }
Code Sample 15.1.: Hello World Program in C
“Hello World!” to the user in some manner. The simplicity of the program allows the focus
to be on the basic syntax of the language. It is also typically used to ensure that your
development environment, compiler, runtime environment, etc. are functioning properly
with a Minimum Working Example (MWE). The Hello World! program is generally
attributed to Brian Kernighan who used it as an example of programming in C in 1974
[25]. A basic Hello World! program in C can be found in Code Sample 15.1.
We will not focus on any particular development environment, code editor, or any
particular operating system, compiler, or ancillary standards in our presentation. However,
as a first step, you should be able to write, compile, and run the above program on
the environment you intend to use for the rest of this book. This may require that you
download and install a basic C compiler/development environment (such as GCC, the
GNU Compiler Collection on OSX/Unix/Linux, cygwin or MinGW for Windows) or a
full IDE (such as Xcode for OSX, or Code::Blocks, http://www.codeblocks.org/ for
Windows).
15.2. Basic Elements
Using the Hello World! program as a starting point, we will now examine the basic
elements of the C language.
254
15.2. Basic Elements
15.2.1. Basic Syntax Rules
C is a highly influential programming language. Many modern programming languages
have adopted syntactic elements that originated in C. Usually such languages are referred
to as “C-style syntax” languages. These elements include the following.
• C is a statically typed language so variables must be declared along with their
types before using them.
• Strings are delimited with double quotes. Single characters, including special
escaped characters are delimited by single quotes; "this is a string" , and
these are characters: 'A' , '4' , '$' and '\n'
• Executable statements are terminated by a semicolon, ;
• Code blocks are defined by using opening and closing curly brackets, { ... } .
Moreover, code blocks can be nested : code blocks can be defined within other code
blocks.
• Variables are scoped to the code block in which they are declared and are only
valid within that code block.
• In general, whitespace between coding elements is ignored.
Though not a syntactic requirement, the proper use of whitespace is important for good,
readable code. Code inside code blocks is indented at the same indentation level. Nested
code blocks are indented further. Think of a typical table of contents or the outline of a
formal paper or essay. Sections and subsections or points and subpoints all follow proper
indentation with elements at the same level at the same indentation. This convention is
used to organize code and make it more readable.
15.2.2. Preprocessor Directives
The lines,
1 #include <stdlib.h>
2 #include <stdio.h>
are preprocessor directives. Preprocessor directives are instructions to the compiler to
modify the source code before it starts to compile it. These particular lines are “including”
standard libraries of functions so that the program can use functionality that has already
255
15. Basics
been implemented for us.
The first, stdlib.h represents the C standard ( std ) library ( lib ). This library is so
essential that many compilers will automatically include it even if you do not explicitly
do so in your program. Still, it is best practice to include it in your code.
The second, stdio.h is the standard ( std ) input/output ( io ) library which contains
basic input/output (I/O) functions that we can use. In particular, the standard output
function printf() is part of this library.
Failure to include a library means that you will not be able to use the functions it
provides in your program. Using the functions without including the library may result in
a compiler error. The .h in the library names stands for “header”; function declarations
are typically contained in a header file while their definitions are placed in a source file
of the same name. We’ll explore this convention in detail when we look at functions in C
(Chapter 18).
There are many other important standard libraries that we’ll touch on as needed; of
immediate interest is the standard mathematics library, math.h . It includes many
useful functions to compute common mathematical functions such as the square root and
natural logarithm. Table 15.1 highlights several of these functions. To use them you’d
include the math library in your source file #include <math.h> and then “call” them
by providing input and assigning the output value to a variable. For example:
1 double x = 1.5;
2 double y, z; √ √
3 y = sqrt(x); //y now has the value x = 1.5
4 z = sin(x); //z now has the value sin (x) = sin (1.5)
In both of the function calls above, the value of the variable x is “passed” to the math
function which computes and “returns” the result which then gets assigned to another
variable.
Macros
Another preprocessor directive establishes macros using the #define keyword. A macro
is a single instruction that specifies a more complex set of instructions. The macro can
be used to define constants to be used throughout your program. To illustrate, consider
the following example.
256
15.2. Basic Elements
Function Description
abs(x) Absolute value for int variables, |x|a
fabs(x) Absolute value for double variables
ceil(x) Ceiling function, d46.3e = 47.0
floor(x) Floor function, b46.3c = 46.0
cos(x) Cosine functionb
sin(x) Sine functionb
tan(x) Tangent functionb
exp(x) Exponential function, ex , e = 2.71828 . . .
log(x) Natural logarithm, ln (x)c
log10(x) Logarithm base 10, log10 (x)c
pow(x,y) The power function, computes xy
sqrt(x) Square root functionc
Table 15.1.: Several functions defined in the C standard math library. a The absolute value
function is actually in the standard library, stdlib.h . b all trigonometric
functions assume input is in radians, not degrees. c Input is assumed to be
positive, x > 0.
257
15. Basics
1 #define MILES_PER_KM 1.609
The macro defines an “alias” for the MILES_PER_KM identifier as the value 1.609. Essen-
tially, the C preprocessor will go through the code and any instance of MILES_PER_KM
will be replaced with 1.609 . The advantage of using a macro like this is that we can use
the identifier MILES_PER_KM throughout our program instead of magic numbers whose
meaning and intent may not be immediately clear. Moreover, if we want to change the
definition (say make it more precise, using 1.60934 instead) then we only need to change
the macro instead of making the same change throughout our program.
As a stylistic note: macro constants in C are usually associated with uppercase underscore
casing as in our example. Also, the math standard library√ defines several macros for
common mathematical constants such as π, e, and 2 ( M_PI , M_E , and M_SQRT2
respectively) among others.
15.2.3. Comments
Comments can be written in a C program either as a single line using two forward
slashes, //comment or as a multiline comment using a combination of forward slash
and asterisk: /* comment */ . With a single line comment, everything on the line
after the forward slashes is ignored. With a multiline comment, everything between the
forward slash/asterisk is ignored. Comments are ultimately ignored by the compiler so
the amount of comments do not have an effect on the final executable code. Consider
the following example.
1 //this is a single line comment
2 int x; //this is also a single line comment, but after some code
3
4 /*
5 This is a comment that can
6 span multiple lines to format the comment
7 message more clearly
8 */
9 double y;
Most code editors and IDEs will present comments in a special color or font to distinguish
them from the rest of the code (just as our example above does). Failure to close a
258
15.2. Basic Elements
multiline comment will likely result in a compiler error but with color-coded comments
its easy to see the mistake visually.
15.2.4. The main() Function
Every executable program starts its execution somewhere. In C, the starting point is the
main() function. When a program is compiled to an executable and the program is
invoked, the code in the main() function starts executing. In our example, the code
between the two curly brackets defines the main() function. At the end of the function
we have a return statement. We’ll examine return statements in detail when we
examine functions. The program is “returning” a zero value to the operating system.
The convention in C is that zero indicates “no error occurred” while a non-zero value
is used to indicate that “some” error occurred (the value used is determined by system
standards such as the Portable Operating System Interface (POSIX) standard).
In addition, our main() function has two arguments: argc and argv which serve to
communicate any command line arguments provided to the program (review Section
2.4.4 for details). The first, argc is an integer that indicates the number of arguments
provided including the executable file name itself. The second, argv actually stores
the arguments as strings. We will understand the syntax later on, but for now we can
at least understand how we might convert these arguments to different types such as
integers and floating point numbers.
Recall that argv is the argument vector : it is an array (see Chapter 20) of the command
line arguments. To access them, you can index them starting at zero, the first being
argv[0] , the second argv[1] , etc. (the last one of course would be at argv[argc-1] ).
The first one is always the name of the executable file being run. The remaining are the
command line arguments provided by the user.
To convert them you can use two different functions, atoi() and atof() which are
short for alphanumeric to integer and f loafing-point number respectively. An example:
1 //prints the first command line argument:
2 printf("%s\n", argv[0]);
3 //converts the "second" command line argument to an integer
4 int x = atoi(argv[1]);
5 //converts the "third" command line argument to a double:
6 double y = atof(argv[2]);
259
15. Basics
15.3. Variables
As previewed, the three primary primitive types supported in C are int , double , and
char which support integers, floating point numbers, and single ASCII characters.
Integer ( int ) types are only guaranteed to “be at least” 16 bytes by the C standard but
are usually 32-bit signed integers on most modern systems.1 With a 32-bit signed int we
can represent integers in the range −2, 147, 483, 648 to 2,147,483,647. Doubles ( double )
types are double-precision floating point numbers as per the IEEE 754 standard and
provide about 16 digits of precision.
C provides a float (single precision floating point number) type and there are various
modifiers such as short , long , unsigned and signed that can be used, but these
are either system-dependent or rely on later versions of the C standard (such as C99).
We will restrict our focus to more portable, interoperable code and stick with the basic
int and double types in our code.
Finally, the char type is typically a single byte that represents a single ASCII character.
For all intents and purposes a char can be treated as an integer in the range 0 to 127
(or 255) as defined by the ASCII text table (see Table 2.4).
15.3.1. Declaration & Assignment
C is a statically typed language meaning that all variables must be declared before you
can use them or refer to them. In addition, when declaring a variable, you must specify
both its type and its identifier. For example:
1 int numUnits;
2 double costPerUnit;
3 char firstInitial;
Each declaration specifies the variable’s type followed by the identifier and ending with
a semicolon. The identifier rules are fairly standard: a name can consist of lower and
uppercase alphabetic characters, numbers, and underscores but may not begin with a
numeric character. We adopt the modern camelCasing naming convention for variables
in our code.
The assignment operator is a single equal sign, = and is a right-to-left assignment. The
1
You may have to deal with 16-bit int types in legacy systems/compilers or in modern embedded
systems.
260
15.3. Variables
variable that we wish to assign the value to appears on the left-hand-side while the value
(literal, variable or expression) is on the right-hand-size. Using our variables from before,
we can assign them values:
1 numUnits = 42;
2 costPerUnit = 32.79;
3 firstInitial = 'C';
An important thing to understand and to keep in mind is: if you declare a variable but
do not assign it a value, its value is undefined. If we code something like int a; , the
value of the variable a is not necessarily zero; depending on the system, it could contain
a special value that indicates “uninitialized memory” or it could contain garbage, or it
could have the value zero. The C standard does not specify default values for variables.
The default value of variables is highly system dependent–on the compiler, the libraries,
and even the operating system. You should not make any assumptions on the initial or
default values of variables. If you need such assumptions, then values must be assigned.
For brevity, C allows you to declare a variable and immediately assign it a value on the
same line. Our example could be written more compactly written as follows.
1 int numUnits = 42;
2 double costPerUnit = 32.79;
3 char firstInitial = 'C';
As another shorthand, we can declare multiple variables on the same line by delimiting
them with a comma. However, they must be of the same type. We can also use an
assignment with them.
1 int numOrders, numUnits = 42, numCustomers = 10, numItems;
2 double costPerUnit = 32.79, salesTaxRate;
Another convenient keyword is const , short for “constant.” We can apply it to any
variable to indicate that it is a read-only variable. Of course, we must assign it a value
at declaration. For example:
261
15. Basics
1 const int secret = 42;
2 const double salesTaxRate = 0.075;
Any attempt to reassign the values of const variables will result in a compiler error.
15.4. Operators
C supports the standard arithmetic operators for addition, subtraction, multiplication,
and division using + , - , * , and / respectively. Each of these operators is a binary
operator that acts on two operands which can be literals, variables or expressions and
follow the usual rules of arithmetic when it comes to order of precedence (multiplication
and division before addition and subtraction).
1 int a = 10, b = 20, c = 30, d;
2 d = a + 5;
3 d = a + b;
4 d = a - b;
5 d = a + b * c;
6 d = a * b;
7 d = a / b; //integer division and truncation! See below
8
9 double x = 1.5, y = 3.4, z = 10.5, w;
10 w = x + 5.0;
11 w = x + y;
12 w = x - y;
13 w = x + y * z;
14 w = x * y;
15 w = x / y;
16
17 //you can do arithmetic with both types:
18 w = a + x;
19 d = b + y; //truncation also occurs here!
Special care must be taken when dealing with int types. For all four operators, if
both operands are integers, the result will be an integer. For addition, subtraction, and
multiplication this isn’t a big deal, but for division it means that when we divide, say
262
15.5. Basic I/O
10 / 20 , the result is not 0.5 as expected. The number 0.5 is a floating point number.
As such, the fractional part gets truncated (cut off and thrown out) leaving only zero. In
the code above, d = a / b; the variable d ends up getting the value zero because of
this.
Similarly, attempting to assign a floating point number to an integer also results in
truncation because an int type cannot handle the fractional part. In the line d = b + y
above, b + y correctly evaluates as 20 + 3.4 = 23.4, but when assigned to the int
variable d the .4 gets truncated and d is assigned the value 23. Assigning an int
value to a double variable is not a problem as the integer 2 implicitly becomes the
floating point number 2.0.
A solution to this problem is to use explicit type casting to force at least one of the
operands in an integer division to become a double type. For example:
1 int a = 10, b = 20;
2 double x;
3
4 x = (double) a / b;
results in x getting the “correct” value of 0.5. This works because the (double) code
forces the int variable a to temporarily be treated as a double variable (in this case
10.0) for the purposes of division (so that truncation does not occur).
C also supports the integer remainder operator using the % symbol. This operator gives
the remainder of the result of dividing two integers. Examples:
1 int x;
2
3 x = 10 % 5; //x is 0
4 x = 10 % 3; //x is 1
5 x = 29 % 5; //x is 4
15.5. Basic I/O
The standard I/O library ( stdio.h ) contains many functions that facilitate input and
output including printf() for standard output and scanf() (scan f ormatted input)
263
15. Basics
for standard input.
The printf() function works exactly as discussed in Section 2.4.3. The scanf()
function works using similar placeholders as printf() . To illustrate how it works,
consider the following lines of code:
1 int a;
2 printf("Please enter a number: ");
3 scanf("%d", &a);
The printf() statement prompts the user for an input. The scanf() then executes
and the program waits for the user to enter input. The user is free to start typing. When
the user is done, they hit the enter key at which point the program resumes and reads
the input from the standard input buffer, converts the value entered by the user into
an integer and places the result in the variable a where it can now be used by the
remainder of the program.
A few points of interest. First, the same placeholder as printf() was used, %d for
int values. However, when we “passed” the variable a to scanf() we placed an
ampersand, & in front of it. This is passing the variable by reference and we’ll explore
that concept further in Chapter 18, but for now just know that when using variables
with scanf() , an ampersand is required. Failure to place an ampersand in front of
a variable with scanf() will likely result in a segmentation fault (an illegal memory
access).
You can use the same placeholder, %c with scanf() to read in a single character as
well. However, for floating point numbers, in particular double types, the placeholder
%lf must be used (which stands for long float, a double precision number). Failure to
use the correct placeholder may result in garbage results as the input will be interpreted
incorrectly. Another example:
1 double x;
2 printf("Please enter a fractional number: ");
3 scanf("%lf", &x);
Another potential problem is that scanf() expects a certain format (thus its name).
If we prompt the user for a number but they just start mashing the keyboard giving
non-numerical input, we may get incorrect results. scanf() will interpret the input as
zero. It may be very difficult to distinguish between the case of a user actually entering
264
15.6. Examples
in zero as a legitimate input versus bad input. In general, scanf() is not a good
mechanism for reading input (and in fact can be very dangerous), but it does provide a
good starting point.
15.6. Examples
15.6.1. Converting Units
Let’s write a program that will prompt the user to enter a temperature in degrees
Fahrenheit and convert it to degrees Celsius using the formula
5
C = (F − 32) ·
9
We begin with the basic program outline which will include preprocessor directives to
bring in the standard library and the standard input/output library (we’ll need to prompt
for input and print the result as output to the user). Further, we want our program
to be executable, so we need to put our code into the main() function. Finally, we’ll
document our program to indicate its purpose.
1 #include <stdlib.h>
2 #include <stdio.h>
3
4 /**
5 * This program converts Fahrenheit temperatures to
6 * Celsius
7 */
8 int main(int argc, char **argv) {
9
10 //TODO: implement this
11
12 return 0;
13 }
It is common for programmers to use a comment along with a TODO note to themselves
as a reminder of things that they still need to implement in a program.
Let’s first outline the basic steps that our program will go through:
1. We’ll first prompt the user for input, asking them for a temperature in Fahrenheit
265
15. Basics
2. Next we’ll read the user’s input, likely into a floating point number as degrees can
be fractional
3. Once we have the input, we can calculate the degrees Celsius by using the formula
above
4. Lastly, we will want to print the result to the user to inform them of the value
Sometimes its helpful to write an outline of such a program directly in the code using
comments to provide a step-by-step process. For example:
1 #include <stdlib.h>
2 #include <stdio.h>
3
4 /**
5 * This program converts Fahrenheit temperatures to
6 * Celsius
7 */
8 int main(int argc, char **argv) {
9
10 //TODO: implement this
11 //1. Prompt the user for input in Fahrenheit
12 //2. Read the Fahrenheit value from the standard input
13 //3. Compute the degrees Celsius
14 //4. Print the result to the user
15
16 return 0;
17 }
As we read each step it becomes apparent that we’ll need a couple of variables: one to
hold the Fahrenheit (input) value and one for the Celsius (output) value. It also makes
sense that each of these should be double variables as we want to support fractional
values. So at the top of our main() function, we’ll add the variable declarations:
double fahrenheit, celsius;
Each of the steps is now straightforward; we’ll use a printf() statement in the first
step to prompt the user for input:
printf("Please enter degrees in Fahrenheit: ");
In the second step, we’ll use the standard input to read the fahrenheit variable value
from the user. Recall that we use the placeholder %lf for reading double values and
266
15.6. Examples
use an ampersand when using scanf() :
scanf("%lf", &fahrenheit);
We can now compute celsius using the formula provided:
celsius = (fahrenheit - 32) * (5 / 9);
Finally, we use printf() again to output the result to the user:
printf("%f Fahrenheit is %f Celsius\n", fahrenheit, celsius);
Try typing and running the program as defined above and you’ll find that you don’t
get correct answers. In fact, you’ll find that no matter what values you enter, you get
zero. This is because of the calculation using 5 / 9 : recall what happens with integer
division: truncation! This will always end up being zero.
One way we could fix it would be to pull out our calculators and find that 59 = 0.55555 . . .
and replace 5/9 with 0.555555 . But, how many fives? It may be difficult to tell how
accurate we can make this floating point number by hardcoding it ourselves. A much
better approach would be to let the compiler take care of the optimal computation for us
by making at least one of the numbers a double to prevent integer truncation. That is,
we should instead use 5.0 / 9 . The full program can be found in Code Sample 15.2.
15.6.2. Computing Quadratic Roots
Some programs require the user to enter multiple inputs. The prompt-input process can
be repeated. In this example, consider asking the user for the coefficients, a, b, c to a
quadratic polynomial,
ax2 + bx + c
and computing its roots using the quadratic formula,
√
−b ± b2 − 4ac
x=
2a
As before, we can create a basic program with a main() function and start filling in
the details. In particular, we’ll need to prompt for the input a, then read it in; then
prompt for b, read it in and repeat for c. We’ll also need several variables: three for the
coefficients a, b, c and two more; one for each root. Thus, we have
1 double a, b, c, root1, root2;
2
3 printf("Please enter a: ");
4 scanf("%lf", &a);
267
15. Basics
1 #include <stdlib.h>
2 #include <stdio.h>
3
4 /**
5 * This program converts Fahrenheit temperatures to
6 * Celsius
7 */
8 int main(int argc, char **argv) {
9
10 double fahrenheit, celsius;
11
12 //1. Prompt the user for input in Fahrenheit
13 printf("Please enter degrees in Fahrenheit: ");
14
15 //2. Read the Fahrenheit value from the standard input
16 scanf("%lf", &fahrenheit);
17
18 //3. Compute the degrees Celsius
19 celsius = (fahrenheit - 32) * 5.0/9;
20
21 //4. Print the result to the user
22 printf("%f Fahrenheit is %f Celsius\n", fahrenheit, celsius);
23
24 return 0;
25 }
Code Sample 15.2.: Fahrenheit-to-Celsius Conversion Program in C
5 printf("Please enter b: ");
6 scanf("%lf", &b);
7 printf("Please enter c: ");
8 scanf("%lf", &c);
Now to compute the roots: we need to take care that we correctly adapt the formula so
it accurately reflects the order of operations. We also need to use the standard math
library’s square root function (unless you want to write your own!2 Carefully adapting
2
We will write several square root methods as exercises later!
268
15.6. Examples
the formula leads to
1 root1 = (-b + sqrt(b*b - 4*a*c) ) / (2*a);
2 root2 = (-b - sqrt(b*b - 4*a*c) ) / (2*a);
Finally, we print the output using printf() . The full program can be found in Code
Sample 15.3.
1 #include <stdlib.h>
2 #include <stdio.h>
3 #include <math.h>
4
5 /**
6 * This program computes the roots to a quadratic equation
7 * using the quadratic formula.
8 */
9 int main(int argc, char **argv) {
10
11 double a, b, c, root1, root2;
12
13 printf("Please enter a: ");
14 scanf("%lf", &a);
15 printf("Please enter b: ");
16 scanf("%lf", &b);
17 printf("Please enter c: ");
18 scanf("%lf", &c);
19
20 root1 = (-b + sqrt(b*b - 4*a*c) ) / (2*a);
21 root2 = (-b - sqrt(b*b - 4*a*c) ) / (2*a);
22
23 printf("The roots of %fx^2 + %fx + %f are: \n", a, b, c);
24 printf(" root1 = %f\n", root1);
25 printf(" root2 = %f\n", root2);
26 return 0;
27 }
Code Sample 15.3.: Quadratic Roots Program in C
This program was interactive. As an alternative, we could have read all three of the
269
15. Basics
inputs as command line arguments, converting them to floating point numbers. Lines
12–17 in the program could have been changed to
1 a = atof(argv[1]);
2 b = atof(argv[2]);
3 c = atof(argv[3]);
Finally, think about the possible inputs a user could provide that may cause problems
for this program. For example:
• What if the user entered zero for a?
• What if the user entered some combination such that b2 < 4ac?
• What if the user entered non-numeric values?
• For the command line argument version, what if the user provided less than three
arguments? Or more?
How might we prevent the consequences of such bad inputs? How might we handle the
event that a user enters bad input and how do we communicate these errors to the user?
To begin to resolve these issues, we’ll need conditionals.
270
16. Conditionals
C supports the basic if, if-else, and if-else-if conditional structures as well as switch
statements. Logical statements are built using the standard logical operators for numeric
comparisons as well as logical operators such as negation, And, and Or. However, there
are a few idiosyncrasies that need to be understood.
16.1. Logical Operators
C has no built-in Boolean type, nor does it have any keywords associated with true and
false. Instead, C uses numeric types as implicit Boolean types with the convention that
zero is associated with false and any non-zero value is associated with true. So the values
1, 2.5, and even negatives, −1, −123.2421, etc. are all interpreted as true when used in
logical statements.
The standard numeric comparison operators are also supported. Consider the following
code snippet:
1 int a = 10;
2 int b = 20;
3 int c = 10;
4 int d = 0;
The six standard comparison operators are presented in Table 16.1 using these variables
as examples. The comparison operators are the same when used with double types as
well and int types can be compared with each other without type casting. The three
basic logical operators are also supported as described in Table 16.2 using the same code
snippet variable values as examples.
271
16. Conditionals
Name Operator Syntax Examples Value
Equals == a == 10 true
b == 10 false
a == b false
a == c true
Not Equals != a != 10 false
b != 10 true
a != b true
a != c false
Strictly Less Than < a < 15 true
a < 5 false
a < b true
a < c false
Less Than Or Equal To <= a <= 15 true
a <= 5 false
a <= b true
a <= c true
Strictly Greater Than > a > 15 false
a > 5 true
a > b false
a > c false
Greater Than Or Equal To >= a >= 15 false
a >= 5 true
a >= b false
a >= c true
Table 16.1.: Comparison Operators in C
Operator Operator Syntax Examples Values
Negation ! !a false
!d true
And && a && b true
a && d false
Or || a || b true
!a || d false
Table 16.2.: Logical Operators in C
272
16.1. Logical Operators
Operator(s) Associativity Notes
Highest ++ , -- left-to-right increment operators
-, ! right-to-left unary negation operator, logical
not
*, /, % left-to-right
+, - left-to-right addition, subtraction
< , <= , > , >= left-to-right comparison
== , != left-to-right equality, inequality
&& left-to-right logical And
|| left-to-right logical Or
Lowest = , += , -= , *= , /= right-to-left assignment and compound assign-
ment operators
Table 16.3.: Operator Order of Precedence in C. Operators on the same level have
equivalent order and are performed in the associative order specified.
16.1.1. Order of Precedence
At this point it is worth summarizing the order of precedence of all the operators that
we’ve seen so far including assignment, arithmetic, comparison, and logical. Since all of
these operators could be used in one statement, for example,
(b*b < 4*a*c || a == 0 || argc != 4)
it is important to understand the order in which each one gets evaluated. Table 16.3
summarizes the order of precedence for the operators seen so far. This is not an exhaustive
list of C operators.
16.1.2. Comparing Strings and Characters
The comparison operators in Table 16.1 can also be used for single characters because
of the nature of the ASCII text table (see Table 2.4). Each alphanumeric character,
including the various symbols and whitespace characters, is associated with an integer 0–
127. We can therefore write statements like ('A' < 'a') , which is true since uppercase
letters are ordered before lowercase letters in the ASCII table ( 'A' is 65 and 'a' is 97
and so 65 < 97 is true). Several more examples can be found in Table 16.4.
Numeric comparison operators cannot be used to compare strings in C. For example,
we could write ("aardvark" < "zebra") which would be valid C, and it would even
have a result. However, that result wouldn’t necessarily be true or false. The reason for
this is that strings in C are actually represented as arrays, which in turn are represented
as memory locations. We’ll explore these issues in greater depth later on, but for now
273
16. Conditionals
Comparison Example Result
('A' < 'a') true
('A' == 'a') false
('A' < 'Z') true
('0' < '9') true
('\n' < 'A') true
(' ' < '\n') false
Table 16.4.: Character comparisons in C
understand that you can write this code, it will compile, and it will even run. However,
the results will not be as expected.
16.2. If, If-Else, If-Else-If Statements
Conditional statements in C utilize the keywords if , else , and else if . Condi-
tions are placed inside parentheses immediately after the if and else if keywords.
Examples of all three can be found in Code Sample 16.1.
Some observations about the syntax: the statement, if(x < 10) does not have a
semicolon at the end. This is because it is a conditional statement that determines
the flow of control and not an executable statement. Therefore, no semicolon is used.
Suppose we made a mistake and did include a semicolon:
1 int x = 15;
2 if(x < 10); {
3 printf("x is less than 10\n");
4 }
Some compilers may give a warning, but this is valid C; it will compile and it will run.
However, it will end up printing x is less than 10 , even though x = 15! Recall that
a conditional statement binds to the executable statement or code block immediately
following it. In this case, we’ve provided an empty executable statement ended by the
semicolon. The code is essentially equivalent to
1 int x = 15;
2 if(x < 10) {
3 }
274
16.2. If, If-Else, If-Else-If Statements
1 //example of an if statement:
2 if(x < 10) {
3 printf("x is less than 10\n");
4 }
5
6 //example of an if-else statement:
7 if(x < 10) {
8 printf("x is less than 10\n");
9 } else {
10 printf("x is 10 or more \n");
11 }
12
13 //example of an if-else-if statement:
14 if(x < 10) {
15 printf("x is less than 10\n");
16 } else if(x == 10) {
17 printf("x is equal to ten\n");
18 } else {
19 printf("x is greater than 10\n");
20 }
Code Sample 16.1.: Examples of Conditional Statements in C
275
16. Conditionals
4 printf("x is less than 10\n");
This is obviously not what we wanted. The semicolon ended up binding to the empty
executable statement. The code block containing the print statement immediately
followed, but it was not bound to the conditional statement which is why the print
statement executed regardless of the value of x.
Another convention that we’ve used in our code is where we have placed the curly brackets.
First, if a conditional statement is bound to only one statement, the curly brackets are
not necessary. However, it is best practice to include them even if they are not necessary
and we’ll follow this convention. Second, the opening curly bracket is on the same line as
the conditional statement while the closing curly bracket is indented to the same level
as the start of the conditional statement. Moreover, the code inside the code block is
indented. If there were more statements in the block, they would have all been at the
same indentation level.
16.3. Examples
16.3.1. Computing a Logarithm
The logarithm of x is the exponent that some base must be raised to get x. The most
common logarithm is the natural logarithm, ln (x) which is base e = 2.71828 . . .. But
logarithms can be in any base b > 1.1 What if we wanted to compute log2 (x)? Or
logπ (x)? Let’s write a program that will prompt the user for a number x and a base b
and computes logb (x).
Arbitrary bases can be computed using the change of base formula:
loga (x)
logb (x) =
loga (b)
If we can compute some base a, then we can compute any base b. Fortunately we have
such a solution. Recall that the standard library provides a function to compute the
natural logarithm, log() ). This is one of the fundamentals of problems solving: if a
solution already exists, use it. In this case, a solution exists for a different, but similar
problem (computing the natural logarithm), but we can adapt the solution using the
change of base formula. In particular, if we have variables b (base) and x , we can
compute logb (x) using
1
Bases can also be 0 < b < 1, but we’ll restrict our attention to increasing functions only.
276
16.3. Examples
log(x) / log(b)
But wait: we have a problem similar to the examples in the previous section. The user
could enter invalid values such as b = −10 or x = −2.54 (logarithms are undefined
for non-positive values in any base). We want to ensure that b > 1 and x > 0. With
conditionals, we can now do this. Once we have read in the input from the user we can
make a check for good input using an if statement.
1 if(x <= 0 || b <= 1) {
2 printf("Error: bad input!\n");
3 exit(1);
4 }
This code has something new: exit(1) . The exit() function immediately terminates
the program regardless of the rest of the code that it may remain. The argument passed
to exit is an integer that represents an error code. The convention is that zero indicates
“no error” while non-zero values indicate some error. This is a simple way of performing
error handling: if the user provides bad input, we inform them and quit the program,
forcing them to run it again and provide good input. By prematurely terminating the
program we avoid any illegal operation that would give a bad result.
Alternatively, we could have split the conditions into two statements and given more
descriptive error messages. We use this design in the full program which can be found in
Code Sample 16.2. The program also takes the input as command line arguments. Now
that we have conditionals, we can actually check that the correct number of arguments
was provided by the user and quit in the event that they don’t provide the correct
number.
16.3.2. Life & Taxes
Let’s adapt the conditional statements we developed in Section 3.6.4 into a full C program.
The first thing we need to do is establish the variables we’ll need and read them in from
the user. At the same time we can check for bad input (negative values) for both the
inputs.
1 double income, baseTax, numChildren, credit, totalTax;
2
3 printf("Please enter your Adjusted Gross Income: ");
4 scanf("%lf", &income);
5
277
16. Conditionals
6 printf("How many children do you have?");
7 scanf("%d", &numChildren);
8
9 if(income < 0 || numChildren < 0) {
10 printf("Invalid inputs");
11 exit(1);
12 }
Next, we can code a series of if-else-if statements for the income range. By placing the
ranges in increasing order, we only need to check the upper bounds just as in the original
example.
1 if(income <= 18150) {
2 baseTax = income * .10;
3 } else if(income <= 73800) {
4 baseTax = 1815 + (income - 18150) * .15;
5 } else if(income <= 148850) {
6 ...
7 } else {
8 baseTax = 127962.50 + (income - 457600) * .396;
9 }
Next we compute the child tax credit, taking care that it does not exceed $3,000. A
conditional based on the number of children suffices as at this point in the program we
already know it is zero or greater.
1 if(numChildren <= 3) {
2 credit = numChildren * 1000;
3 } else {
4 credit = 3000;
5 }
Finally, we need to ensure that the credit does not exceed the total tax liability (the
credit is non-refundable, so if the credit is greater, the tax should only be zero, not
negative).
278
16.3. Examples
1 if(baseTax - credit >= 0) {
2 totalTax = baseTax - credit;
3 } else {
4 totalTax = 0;
5 }
The full program is presented in Code Sample 16.3.
16.3.3. Quadratic Roots Revisited
Let’s return to the quadratic roots program we previously designed that uses the quadratic
equation to compute the roots of a quadratic polynomial by reading coefficients a, b, c
in from the user. One of the problems we had previously identified is if the user enters
“bad” input: if a = 0, we would end up dividing by zero; if b2 − 4ac < 0 then we would
have complex roots. With conditionals, we can now check for these issues and exit with
an error message.
Another potential case we might want to handle differently is when there is only one
distinct root (b2 − 4ac = 0). In that case, the quadratic formula simplifies to −b
2a
and we
can print a different, more specific message to the user. The full program can be found
in Code Sample 16.4.
279
16. Conditionals
1 #include <stdlib.h>
2 #include <stdio.h>
3 #include <math.h>
4
5 /**
6 * This program computes the logarithm base b (b > 1)
7 * of a given number x > 0
8 */
9 int main(int argc, char **argv) {
10
11 double b, x, result;
12 if(argc != 3) {
13 printf("Usage: %s b x \n", argv[0]);
14 exit(1);
15 }
16
17 b = atof(argv[1]);
18 x = atof(argv[2]);
19
20 if(x <= 0) {
21 printf("Error: x must be greater than zero\n");
22 exit(1);
23 }
24 if(b <= 1) {
25 printf("Error: base must be greater than one\n");
26 exit(1);
27 }
28
29 result = log(x) / log(b);
30 printf("log_(%f)(%f) = %f\n", b, x, result);
31 return 0;
32 }
Code Sample 16.2.: Logarithm Calculator Program in C
280
16.3. Examples
1 #include <stdlib.h>
2 #include <stdio.h>
3
4 int main(int argc, char **argv) {
5
6 double income, baseTax, credit, totalTax;
7 int numChildren;
8
9 //prompt for income from the user
10 printf("Please enter your Adjusted Gross Income: ");
11 scanf("%lf", &income);
12
13 //prompt for children
14 printf("How many children do you have?");
15 scanf("%d", &numChildren);
16
17 if(income < 0 || numChildren < 0) {
18 printf("Invalid inputs");
19 exit(1);
20 }
21
22 if(income <= 18150) {
23 baseTax = income * .10;
24 } else if(income <= 73800) {
25 baseTax = 1815 + (income -18150) * .15;
26 } else if(income <= 148850) {
27 baseTax = 10162.50 + (income - 73800) * .25;
28 } else if(income <= 225850) {
29 baseTax = 28925.00 + (income - 148850) * .28;
30 } else if(income <= 405100) {
31 baseTax = 50765.00 + (income - 225850) * .33;
32 } else if(income <= 457600) {
33 baseTax = 109587.50 + (income - 405100) * .35;
34 } else {
35 baseTax = 127962.50 + (income - 457600) * .396;
36 }
37
38 if(numChildren <= 3) {
39 credit = numChildren * 1000;
40 } else {
41 credit = 3000;
42 }
43
44 if(baseTax - credit >= 0) {
45 totalTax = baseTax - credit;
46 } else {
47 totalTax = 0;
48 }
49
50 printf("AGI: $%10.2f\n", income);
51 printf("Tax: $%10.2f\n", baseTax);
52 printf("Credit: $%10.2f\n", credit);
53 printf("Tax Liability: $%10.2f\n", totalTax);
54
55 return 0;
56 }
Code Sample 16.3.: Tax Program in C
281
16. Conditionals
1 #include <stdlib.h>
2 #include <stdio.h>
3 #include <math.h>
4
5 /**
6 * This program computes the roots to a quadratic equation
7 * using the quadratic formula.
8 */
9 int main(int argc, char **argv) {
10
11 double a, b, c, root1, root2;
12
13 if(argc !=4) {
14 printf("Usage: %s a b c\n", argv[0]);
15 exit(1);
16 }
17
18 a = atof(argv[1]);
19 b = atof(argv[2]);
20 c = atof(argv[3]);
21
22 if(a == 0) {
23 printf("Error: a cannot be zero\n");
24 exit(1);
25 } else if(b*b < 4*a*c) {
26 printf("Error: cannot handle complex roots\n");
27 exit(1);
28 } else if(b*b == 4*a*c) {
29 root1 = -b / (2*a);
30 printf("Only one distinct root: %f\n", root1);
31 } else {
32 root1 = (-b + sqrt(b*b - 4*a*c) ) / (2*a);
33 root2 = (-b - sqrt(b*b - 4*a*c) ) / (2*a);
34
35 printf("The roots of %fx^2 + %fx + %f are: \n", a, b, c);
36 printf(" root1 = %f\n", root1);
37 printf(" root2 = %f\n", root2);
38 }
39 return 0;
40 }
Code Sample 16.4.: Quadratic Roots Program in C With Error Checking
282
17. Loops
C supports while loops, for loops, and do-while loops using the keywords while , for ,
and do (along with another while ). Continuation conditions for loops are enclosed
in parentheses, (...) and the blocks of code associated with the loop are enclosed in
curly brackets.
17.1. While Loops
Code Sample 17.1 contains an example of a basic while loop in C. Just as with conditional
statements, our code styling places the opening curly bracket on the same line as the
while keyword and continuation condition. The inner block of code is also indented
and all lines in the block are indented to the same level.
In addition, the continuation condition does not contain a semicolon since it is not an
executable statement. Just as with an if-statement, if we had placed a semicolon it would
have led to unintended results. Consider the following:
1 while(i <= 10); {
2 //perform some action
3 i++; //iteration
4 }
1 int i = 1; //Initialization
2 while(i <= 10) { //continuation condition
3 //perform some action
4 i++; //iteration
5 }
Code Sample 17.1.: While Loop in C
283
17. Loops
1 int i = 1;
2 int flag = 1;
3 while(flag) {
4 //perform some action
5 i++; //iteration
6 if(i>10) {
7 flag = 0;
8 }
9 }
Code Sample 17.2.: Flag-controlled While Loop in C
A similar problem occurs: the while keyword and continuation condition bind to
the next executable statement or code block. As a consequence of the semicolon, the
executable statement that gets bound to the while loop is empty. What happens is
even worse: the program will enter an infinite loop. To see this, the code is essentially
equivalent to the following:
1 while(i <= 10) {
2 }
3 {
4 //perform some action
5 i++; //iteration
6 }
In the while loop, we never increment the counter variable i , the loop does nothing,
and so the computation will continue on forever! Some compilers may warn you about
this, others will not. It is valid C and it will compile and run, but obviously won’t work
as intended. Avoid this problem by using proper syntax and good style.
Another common use case for a while loop is a flag-controlled loop in which we use a
Boolean flag rather than an expression to determine if a loop should continue or not.
Recall that in C, zero is treated as false and any non-zero numeric value is treated as
true. We can thus create an implicit Boolean flag by using an integer variable and setting
it to 1 for true and 0 for false (when we want the loop to terminate). An example can
be found in Code Sample 17.2.
284
17.2. For Loops
17.2. For Loops
For loops in C use the familiar syntax of placing the initialization, continuation condition,
and iteration on the same line as the keyword for . An example can be found in Code
Sample 17.3.
1 int i;
2 for(i=1; i<=10; i++) {
3 //perform some action
4 }
Code Sample 17.3.: For Loop in C
Semicolons are placed at the end of the initialization and continuation condition, but not
the iteration statement. Just as with while loops, the opening curly bracket is placed on
the same line as the for keyword. Code within the loop body is indented, all at the
same indentation level.
Another observation is that we declared the index variable i prior to the for loop.
Some languages allow you to declare the index variable in the initialization statement,
for example for(int i=1; i<=10; i++) . Doing so scopes the index variable to the
loop and so i would be out-of-scope before and after the loop body. This is a nice
convenience and is generally good practice. However, C89 and prior standards do not
allow you to do this; the variable must be declared prior to the loop structure. C99 and
newer standards do allow you to do this and some compilers will be somewhat forgiving
when you use the newer syntax (by supporting their own non-standard extensions to C).
For maximum portability, we’ll follow the older convention.
17.3. Do-While Loops
C supports do-while loops. Recall that the difference between a while loop and a do-while
loop is when the continuation condition is checked. For a while loop it is prior to the
beginning of the loop body and in a do-while loop it is at the end of the loop. This
means that a do-while always executes at least once. An example can be found in Code
Sample 17.4.
Note the syntax and style: the opening curly bracket is again on the same line as the
keyword do . The while keyword and continuation condition are on the same line
as the closing curly bracket. In a slight departure from prior syntax, a semicolon does
285
17. Loops
1 int i;
2 do {
3 //perform some action
4 i++;
5 } while(i<=10);
Code Sample 17.4.: Do-While Loop in C
appear at the end of the continuation condition even though it is not an executable
statement.
17.4. Other Issues
C does not support a traditional foreach loop. When iterating over a collection like an
array, you iterate an index variable, typically with a for loop. However, there are some
syntactic tricks that you can use to get the same effect. Some of this will be a preview of
Chapter 20 where we discuss arrays in C, but in short, you can assign a variable to an
element in an array in iteration statement:
1 double arr[] = {1.41, 2.71, 3.14};
2 int n = 3;
3 int i = 0;
4 double x;
5 for(x=arr[0]; i<n; x=arr[++i]) {
6 //x now holds the i-th element in arr
7 }
The initialization sets the variable x to the first element in the array, arr[0] . The
loop continues for as many elements as there are in the array, n . The iteration does two
things: it assigns x to the next element in the array while at the same time incrementing
the index variable using the prefix increment operator (see Section 2.3.6).
286
17.5. Examples
17.5. Examples
17.5.1. Normalizing a Number
Let’s revisit the example from Section 4.1.1 in which we normalize a number by continually
dividing it by 10 until it is in the range [1, 10). The code in Code Sample 17.5 specifically
refers to the value 32145.234 but would work equally well with any non-negative value of
x.
1 double x = 32145.234;
2 int k = 0;
3 while(x > 10) {
4 x = x / 10; //or: x /= 10;
5 k++;
6 }
Code Sample 17.5.: Normalizing a Number with a While Loop in C
17.5.2. Summation
Let’s revisit the example from Section 4.2.1 in which we computed the sum of integers
1 + 2 + · · · + 10. The code is presented in Code Sample 17.6
1 int i;
2 int sum = 0;
3 for(i=1; i<=10; i++) {
4 sum += i;
5 }
Code Sample 17.6.: Summation of Numbers using a For Loop in C
Of course we could easily have generalized the code somewhat. Instead of computing a
sum up to a particular number, we could have written it to sum up to another variable
n , in which case the for loop would instead look like the following.
287
17. Loops
1 for(i=1; i<=n; i++) {
2 sum += i;
3 }
17.5.3. Nested Loops
Recall that you can write loops within loops. The inner loop will execute fully for each
iteration of the outer loop. An example of two nested of loops in C can be found in Code
Sample 17.7.
1 int i, j;
2 int n = 10;
3 int m = 20;
4 for(i=0; i<n; i++) {
5 for(j=0; j<m; j++) {
6 printf("(i, j) = (%d, %d)\n", i, j);
7 }
8 }
Code Sample 17.7.: Nested For Loops in C
The inner loop executes for j = 0, 1, 2, . . . , 19 < m = 20 for a total of 20 itera-
tions. However, it executes 20 times for each iteration of the outer loop. Since
the outer loop executes for i = 0, 1, 2, . . . , 9 < n = 10, the total number of times
the printf() statement execute is 10 × 20 = 200. In this example, the sequence
(0, 0), (0, 1), (0, 2), . . . , (0, 19), (1, 0), . . . , (9, 19) will be printed.
17.5.4. Paying the Piper
Let’s adapt the solution for the loan amortization schedule we developed in Section 4.7.3.
First, we’ll read the principle, terms, and interest as command line inputs. Adapting the
formula for the monthly payment and using the standard math library’s pow() function,
we get
288
17.5. Examples
1 double monthlyPayment = (monthlyInterestRate * principle) /
2 (1 - pow( (1 + monthlyInterestRate), -n));
However, recall that we may have problems due to accuracy. The monthly payment
could come out to be a fraction of a cent, say $43.871. For accuracy, we need to ensure
that all of the figures for currency are rounded to the nearest cent. The standard math
library does have a round() function, but it only rounds to the nearest whole number,
not the nearest 100th.
However, we can adapt the “off-the-shelf” solution to fit our needs. If we take the number,
multiply it by 100, we get (say) 4387.1 which we can now round to the nearest whole
number, giving us 4387. We can then divide by 100 to get a number that has been
rounded to the nearest 100th! In C, we could simply do the following.
monthlyPayment = round(monthlyPayment * 100.0) / 100.0;
We can use the same trick to round the monthly interest payment and any other number
expected to be whole cents. To output our numbers, we use printf() and take care
to align our columns to make it look nice. To finish our adaptation, we handle the
final month separately to account for an over/under payment due to rounding. The full
solution can be found in Code Sample 17.8.
289
17. Loops
1 #include <stdio.h>
2 #include <stdlib.h>
3 #include <math.h>
4
5 int main(int argc, char **argv) {
6
7 if(argc != 4) {
8 printf("Usage: %s principle apr terms\n", argv[0]);
9 exit(1);
10 }
11
12 double principle = atof(argv[1]);
13 double apr = atof(argv[2]);
14 int n = atoi(argv[3]);
15
16 double balance = principle;
17 double monthlyInterestRate = apr / 12.0;
18 int i;
19
20 //monthly payment
21 double monthlyPayment = (monthlyInterestRate * principle) /
22 (1 - pow( (1 + monthlyInterestRate), -n));
23 //round to the nearest cent
24 monthlyPayment = round(monthlyPayment * 100.0) / 100.0;
25
26 printf("Principle: $%.2f\n", principle);
27 printf("APR: %.4f%%\n", apr*100.0);
28 printf("Months: %d\n", n);
29 printf("Monthly Payment: $%.2f\n", monthlyPayment);
30
31 //for the first n-1 payments in a loop:
32 for(i=1; i<n; i++) {
33 // compute the monthly interest, rounded:
34 double monthlyInterest =
35 round( (balance * monthlyInterestRate) * 100.0) / 100.0;
36 // compute the monthly principle payment
37 double monthlyPrinciplePayment = monthlyPayment - monthlyInterest;
38 // update the balance
39 balance = balance - monthlyPrinciplePayment;
40 // print i, monthly interest, monthly principle, new balance
41 printf("%d\t$%10.2f $%10.2f $%10.2f\n", i, monthlyInterest,
42 monthlyPrinciplePayment, balance);
43 }
44
45 //handle the last month and last payment separately
46 double lastInterest = round( (balance * monthlyInterestRate) * 100.0) / 100.0;
47 double lastPayment = balance + lastInterest;
48
49 printf("Last payment = $%.2f\n", lastPayment);
50
51 return 0;
52 }
290 Code Sample 17.8.: Loan Amortization Program in C
18. Functions
As a procedural-style language, functions are essential in C programming. As we’ve already
seen, C provides a large library of standard functions to perform basic input/output,
math, and many other functions. C also provides the ability to define and use your own
functions.
When you define functions in C, careful thought must be made as to the naming of your
functions. This is because C does not support function overloading. When you name a
function, that is the only function that can have that name. Consequently, you cannot,
in general, use the same function names as defined in the standard libraries or any other
3rd party library that you would like to use in your programs.
C supports both call by value and call by reference using pointers (see Section 18.2). C
also supports vararg functions ( printf() being a prime example) and allows you to
define vararg functions, but we will not cover them in depth here. Finally, parameters
are not, in general, optional. For modern versions of C the omission of parameters is a
syntax error. For older versions, complex rules dictate what happens when arguments
are omitted, but doing so usually results in garbage.
18.1. Defining & Using Functions
For modern C, defining functions is a two step process. First, you declare a function and
its signature using a prototype. Then you define the function by providing a function
body that defines what the function does.
18.1.1. Declaration: Prototypes
Just as with variables, functions in C must be declared before they can be used. The
modern way to declare a function in C is to use a prototype declaration which specifies
the function’s signature including its return type, identifier, and parameters. However, a
prototype does not include the actual body of function. Instead, the function’s definition,
which includes the function body is included later in the program. Consequently, a
prototype always ends with a semicolon.
291
18. Functions
Typically, the documentation for functions is included with the prototype but is not
repeated with the function definition. This is a principle known as Don’t Repeat Yourself
(DRY). Consider the following examples. In these examples we use a commenting style
known as “doc comments.” This style was originally developed for Java but has since
been adopted by many other languages.
1 /**
2 * Computes the sum of the two arguments.
3 */
4 int sum(int a, int b);
5
6 /**
7 * Computes the Euclidean distance between the 2-D points,
8 * (x1,y1) and (x2,y2).
9 */
10 double getDistance(double x1, double y1, double x2, double y2);
11
12 /**
13 * Computes a monthly payment for a loan with the given
14 * principle at the given APR (annual percentage rate) which
15 * is to be repaid over the given number of terms (usually
16 * months).
17 */
18 double getMonthlyPayment(double principle, double apr, int terms);
In each of these, the return type is the first thing specified. The function identifier (name)
is then specified. Function names must follow the same naming rules as variables: they
must begin with an alphabetic character and may contain alphanumeric characters as
well as underscores. Using modern coding conventions we usually name functions using
lower camel casing.
Each prototype ends with a semicolon. Further, prototypes do not specify what the
function does, they only specify its signature. Later in the program, we can provide
the actual definition of each function by using the following syntax. We repeat the
signature, but instead of using a semicolon, we provide a code block, enclosed using
opening/closing curly brackets, that specifies the function body. Here are the definitions
from the prototype examples above:
1 int sum(int a, int b) {
2 return (a + b);
3 }
292
18.1. Defining & Using Functions
4
5 double getDistance(double x1, double y1, double x2, double y2) {
6 double xDiff = (x1-x2);
7 double yDiff = (y1-y2);
8 return sqrt( xDiff * xDiff + yDiff * yDiff);
9 }
10
11 double getMonthlyPayment(double principle, double apr, int terms) {
12 double rate = (apr / 12.0);
13 double payment = (principle * rate) / (1-pow(1+rate, -terms));
14 return payment;
15 }
The keyword return is used to specify the value that is returned to the calling function.
18.1.2. Void Functions
The keyword void can be used in C to indicate a function does not return a value,
in which case it is called a “void function.” Though it is not necessary, it is still good
practice to include a return statement.
1 //prototype:
2 void printCopyright();
3
4 //definition:
5 void printCopyright() {
6 printf("(c) Bourke 2015\n");
7 return;
8 }
In the example above, we’ve also illustrated how to define a function that has no inputs.
Some sources may include an explicit void keyword as a parameter to indicate the
function takes no parameters as in void printCopyright(void); .
293
18. Functions
18.1.3. Organizing Functions
The separation of a function declaration (prototype) and a function definition provides a
natural way to organize functions in C. We place prototypes into a header file which has
a file extension .h and then place the corresponding function definitions into a source
file with the file extension, .c .
We’ve seen this before with the standard libraries: we use #include <math.h> to
“include” the math library’s header file in our code. This essentially brings in the math
library function prototypes so that we can write calls to functions like sqrt() or sin() .
Only when we compile do we actually need to link our code to the function definitions.
When we separate prototypes into header files and definitions into source files we also
need to “include” the prototypes in our source file just as we would need to include them
in any other file in which we use one of the functions. Suppose our functions above have
their prototypes in a file named utils.h and their definitions in a file named utils.c .
In the utils.c source file we would typically use the following syntax to include the
header file:
#include "utils.h"
We use the double quote syntax with user-defined libraries while the usual less-than/greater-
than syntax is used with standard libraries. With the less-than/greater-than syntax, the
compiler will attempt to look for the header file(s) in a specified system directory which
it will fail to find if it is a user-defined library. Furthermore, other elements are usually
included in header files such as preprocessor directives and other declarations (such as
enumerated types and structures which we introduce later).
18.1.4. Calling Functions
Once a function has been defined, or at least a prototype has been brought into scope
via an #include statement, you can write code to call your function(s). The syntax
for doing so is to simply provide the function name followed by parentheses containing
values or variables to pass to the function. Some examples:
1 int a = 10, b = 20;
2 int c = sum(a, b); //c contains the value 30
3
4 //invoke a function with literal values:
5 double dist = getDistance(0.0, 0.0, 10.0, 20.0);
6
7 //invoke a function with a combination:
8 double p = 1500.0;
294
18.2. Pointers
9 double r = 0.05;
10 double monthlyPayment = getMonthlyPayment(p, r, 60);
By default, all primitive types including int , double , and char are passed by value.
To be able to pass arguments by reference, we need to use pointers.
18.2. Pointers
Consider the following line of C code.
int a = 10;
This line creates an integer variable and sets it equal to 10. In more detail, this line
creates a spot in memory (typically 32 bits) and stores a binary representation of the
value 10 at that location. In many instances, we don’t care where the variable is stored
in memory. However, we may have need to communicate that memory location to other
functions. To do so, we can use pointers.
A pointer in C is a reference to a memory location. Because different types ( int ,
double , char ) take a different amount of memory, it is necessary to have a pointer for
each type. That is, a pointer that points to a memory location that stores an int or a
pointer that points to a memory location that stores a double , etc.
The syntax for declaring a pointer is to use an asterisk.
1 //regular variable declarations
2 int a;
3 double b;
4
5 //pointer variable declarations
6 int *ptrA;
7 double *ptrB;
If ptrA represents a memory location, what values can it take on? A memory location
is just a number, so you could do something like the following.
ptrA = 10;
295
18. Functions
Though syntactically this makes sense (and generally the compiler will let you do this with
at most a warning), it is not really what you want. This assigns to the pointer variable
ptrA the value 10, which will be interpreted as the memory address 10. This memory
address may not belong to your program, or it may not even exist as a valid memory
address. Attempts to access the value stored at an arbitrary memory location may be
illegal and may result in the operating system killing the program with a segmentation
fault or similar error.
There are many reasons why a program should not be allowed access to arbitrary memory
locations, but one of the prime reasons is security. Imagine if the operating system
allowed a program access to any part of memory; in particular memory that contained
sensitive information such as passwords or secret Secure Sockets Layer (SSL) keys. To
prevent this, operating systems generally only allow a program to access its own memory.
Referencing Operator
So how do we assign a valid value to a pointer? We do so using a referencing operator.
Given a normal variable as above, we place an ampersand in front of it to get the memory
address of the variable. For example:
1 ptrA = &a;
2 ptrB = &b;
The operation &a results in the memory address of the variable a and we can assign it
to a pointer value. The pointer type and variable type should match; an integer pointer
should point to an int , a double pointer should point to a double . Making a double
pointer point to an int variable type such as
ptrB = &a;
is valid syntax, but since the two types use different amounts of memory you may get
garbage results.
There is a special value used in C called NULL which is a (case-sensitive) keyword used
for an uninitialized, undefined, empty or otherwise invalid or meaningless value. In the
context of memory locations, NULL “points” to nothing. As with regular variables, its
best practice to initialize pointer values to NULL . For example,
int *ptrA = NULL;
Without an initialization, the pointer may point to a random memory address which may
be dangerous to attempt to access. You can also test whether or not a pointer points to
296
18.2. Pointers
NULL using the usual equality operator.
1 int *ptrA = NULL;
2 ...
3 if(ptrA == NULL) {
4 printf("Error: invalid memory location\n");
5 }
Dereferencing Operator
Once we have a valid pointer to a memory location, we may want to manipulate the
contents of the memory it references. To do this we use the inverse operation, the
dereferencing operator which again uses an asterisk. Given a pointer variable ptrA , we
apply an asterisk in front of it to turn it into a regular variable. Consider the following
example.
1 //declare a normal integer variable
2 int a = 10;
3 //declare a pointer and initialize it to NULL
4 int *ptrA = NULL;
5
6 //point ptrA to a's memory location
7 ptrA = &a;
8
9 //change the value of the variable a using its pointer
10 *ptrA = 20;
11
12 //now the variable a has a value of 20:
13 printf("a = %d\n", a); //prints "a = 20"
Figure 18.1 depicts how these lines of code operate in memory.
18.2.1. Passing By Reference
Now that we have the ability to reference a memory location using pointers, we can write
functions that pass variables by reference. To do so, we use the same asterisk syntax
297
18. Functions
Address Contents Address Contents
0xc260ec88 0xc260ec88
ptrA 0xf289fb18 NULL ptrA 0xf289fb18 0xc260ec84
0xf289fb14 0xf289fb14
.. ..
. . ptrA = &a;
0xc260ec88 0xc260ec88
a 0xc260ec84 10 a 0xc260ec84 10
0xc260ec80 0xc260ec80
(a) After the first two lines memory (b) Making ptrA point to the variable a ’s
has been dedicated for the variable a memory location. The value stored in the vari-
and the pointer variable ptrA and able ptrA is a memory address.
their values have been initialized.
Address Contents
0xc260ec88
ptrA 0xf289fb18 0xc260ec84
0xf289fb14
..
. *ptrA = 20;
0xc260ec88
a 0xc260ec84 20
0xc260ec80
(c) Dereferencing ptrA and assigning a value
changes the value stored at what it points to.
Figure 18.1.: Pointer Operations. Pointers can be made to point to other variable’s
memory locations. You can manipulate/access values of variables via their
pointers using dereferencing.
298
18.2. Pointers
used with pointer variables.
1 //prototypes
2 /**
3 * This function sums the first two variables (passed by
4 * value) and places the result into the third variable
5 * (passed by reference).
6 */
7 void sum(int a, int b, int *c);
8
9 /**
10 * This function swaps the values stored in the
11 * two variables passed by reference.
12 */
13 void swap(int *a, int *b);
In the function definitions, we can use the dereferencing operator to access or modify the
value stored in the variable pointed to by the pointer.
1 void sum(int a, int b, int *c) {
2 int x = a + b;
3 *c = x;
4 return;
5 }
6
7 void swap(int *a, int *b) {
8 int temp = *a;
9 *a = *b;
10 *b = temp;
11 return;
12 }
To invoke these functions, we need to pass pointers to the functions appropriately. We
could do this by creating pointer variables or using the referencing operator directly.
1 int x = 10;
2 int y = 20;
3 int c;
299
18. Functions
4 int *ptrC = &c;
5 sum(x, y, ptrC);
6 //at this point c contains the value 30
7
8 swap(&x, &y);
9 //at this point, the values in x and y have been swapped
10 // x contains 20 and y contains 10
This should look familiar. We saw this same syntax when we used scanf() to read input
from the standard input. We needed to place an ampersand in front of each variable in
order to pass the variable by reference so that scanf() could place the results into the
respective memory locations. If the variables had been passed by value, then scanf()
would not have been able to manipulate their values.
You can also specify functions to return pointers which we discuss in detail in Chapter
20.
18.2.2. Function Pointers
Functions are just pieces of code that reside somewhere in memory just as variables do.
Since we can create pointers that point to variables, it makes sense to be able to create
variables that point to functions too! These are referred to as function pointers.
The syntax for declaring function pointers is similar to variable pointers. However, since
a function’s signature involves a return type and parameter list, these need to be specified.
For example, suppose we wanted to create a function pointer that could point to the
math library’s sqrt() function which takes a single double parameter and returns a
double value.
double (*ptrToSqrt)(double) = NULL;
The above line creates a function pointer that can point to any function that takes
a single double parameter and returns a double value. As is good practice, we’ve
initialized it to point to NULL . The function pointer itself is named ptrToSqrt . To
make it point to the sqrt() function we can use the following syntax.
ptrToSqrt = sqrt;
This is because a function’s identifier acts as a pointer as well! Once we have a pointer
to a function, we can invoke the function via its pointer as we would any other function
call.
300
18.3. Examples
double x = ptrToSqrt(2.0);
Some more examples:
1 //this pointer can point any function that takes
2 //three arguments: an int, double, and a char
3 //and returns an int value
4 int (*ptrToFunc)(int, double, char)= NULL;
5
6 double x;
7 double (*ptr)(double) = NULL;
8 //we can make it point to sqrt:
9 ptr = sqrt;
10 x = ptr(2.0); //x contains 1.4142...
11 //or we can make it point to fabs
12 ptr = fabs;
13 x = ptr(-10.5); //x contains 10.5
You generally want to create and use function pointers when passing and returning
functions as arguments to other functions as callbacks. We discuss this in further detail
in Chapter 25.
18.3. Examples
18.3.1. Generalized Rounding
Recall that the standard math library provides a round() function that rounds a number
to the nearest whole number. We’ve had need to round to cents as well. We now have
the ability to write a function to do this for us. Before we do, however, let’s think more
generally. What if we wanted to round to the nearest tenth? Or what if we wanted to
round to the nearest 10s or 100s place? Let’s write a general purpose rounding function
that allows us to specify which decimal place to round to.
The most natural input values would be to specify the place using an integer exponent.
That is, if we wanted to round to the nearest tenth, then we would pass it −1 as
0.1 = 10−1 , −2 if we wanted to round to the nearest 100th, etc. In the other direction,
passing in 0 would correspond to the usual round function, 1 to the nearest 10s spot,
and so on. Moreover, we could demonstrate good code reuse (as well as procedural
abstraction) by scaling the input value and reusing the functionality already provided
301
18. Functions
in the math library’s round() function. We could further define a roundToCents()
function that used our generalized round function.
Let’s also think about organization. We could place the prototypes into a round.h
header file and the corresponding definitions in a round.c source file. The contents of
these two files are presented here:
1 /**
2 * Rounds to the nearest digit specified by the place
3 * argument. In particular to the (10^place)-th digit
4 */
5 double roundToPlace(double x, int place);
6
7 /**
8 * Rounds to the nearest cent
9 */
10 double roundToCents(double x);
1 #include <math.h>
2 #include "round.h"
3
4 double roundToPlace(double x, int place) {
5 double scale = pow(10, -place);
6 double rounded = round(x * scale) / scale;
7 return rounded;
8 }
9
10 double roundToCents(double x) {
11 return roundToPlace(x, -2);
12 }
Observe that neither of these files contains a main() function. By themselves they
would not be able to be compiled into an executable program. We’ve essentially built a
small library of rounding functions. We could compile them though into a binary object
file using gcc (something like gcc -c round.c ). We could then link into the object file
when compiling an executable program that uses these functions.
302
18.3. Examples
18.3.2. Quadratic Roots
Another advantage of passing variables by reference is that we can “return” multiple
values with one function call. Functions are limited in that they can only return at most
one value. But if we pass multiple parameters by reference, the function can manipulate
the contents of them, thereby communicating (though not strictly returning) multiple
values.
Consider again the problem of computing the roots of a quadratic equation,
ax2 + bx + c = 0
using the quadratic formula, √
−b ± b2 − 4ac
2a
Since there are two roots, we may have to write two functions, one for the “plus” root
and one for the “minus” root both of which take the coefficients, a, b, c as arguments.
However, if we wrote a single function that took the coefficients as parameters by value
as well as two other parameters by reference, we could compute both root values and
place each one in two pass by reference variables.
1 void quadraticRoots(double a, double b, double c,
2 double *root1, double *root2) {
3 double discriminant = sqrt(b*b - 4*a*c);
4 *root1 = (-b + discriminant) / (2*a);
5 *root2 = (-b - discriminant) / (2*a);
6 return;
7 }
By using pass by reference variables, we avoid multiple functions. We also note that the
return value in this case is unused since we are “returning” the root values in the two
pass by reference variables. This frees up the return value to be used to communicate
errors to the calling function. Recall that there could be several “bad” inputs to this
function. The roots could be complex values, the coefficient a could be zero, etc. And
now that we are dealing with pointers, the pointers could be invalid (point to NULL ). In
the next chapter, we examine how we can use the return value to communicate different
errors to the calling function, letting it handle those errors.
303
19. Error Handling
The C language does not support exceptions or exception handling. Instead, the usual
method of error handling is done through defensive programming. As a user, it is your
responsibility to write code that checks for invalid or unsafe operations before executing
them and handle the error appropriately.
One way that we’ve already seen to handle errors in C is to use the exit() function in
the standard library. This function immediately terminates the execution of our program
and “returns” an integer valued “exit code.” This exit code can be used to communicate
errors between different processes. The process that executed the program can use it to
determine if the program exited with or without an error. By convention, 0 indicates an
error while a non-zero value indicates an error. Using the exit() function should only
be done when an error should be considered fatal or severe enough that the program
should immediately terminate.
19.1. Language Supported Error Codes
In the standard libraries, some functions are designed to indicate an error by returning
a special “flag” value such as −1 or NULL . In general, though, the standard library
functions communicate an error code represented as an integer value. As previously
mentioned, C uses the convention that 0 indicates “no error” while a non-zero value
indicates an error.
Error codes are communicated through a special global variable called errno which is
defined in the errno.h standard header file. This header file also defines several macros
that are identified with various error codes. The C standard actually only requires the
following three error codes to be supported.
• EDOM indicates an error in the domain of a function; that is, an error with respect
to the function’s input value(s). For example, calling the math library’s sqrt(-1)
on a negative value results in an EDOM error as C does not support complex
numbers.
• ERANGE indicates an error in the range of a function; that is, an error with respect
to the function’s output value(s). For example, calling the math library’s log(0)
305
19. Error Handling
with a zero value results in an ERANGE error as C does not support −∞ as an
actual number.
• EILSEQ indicates an illegal byte sequences in characters on systems that use
UTF-8.
All three of these are defined in the errno.h header file. Depending on the system,
additional error codes may also be defined and supported (see POSIX Error Codes
below).
When an error occurs, a function will set the global variable errno to one of these error
code values. Upon returning from a function, you can check for these error codes. Since
these error codes are represented as integers, you simply use the numerical comparison
operator, == . You can check for no error by making a comparison to zero.
In addition, the standard string library, defined in the header file, string.h provides a
function, char * strerror(errno) that can be used to map the value in errno to a
human-readable error message. We discuss strings in detail later on, but we can see how
to use this function in Code Sample 19.1. The output of this program is as follows.
result: 1.4142, error: 0
result: -nan, error: 33
it was an EDOM error
Error Message: Numerical argument out of domain
result: -inf, error: 34
it was an ERANGE error
Error Message: Numerical result out of range
For this particular system, the EDOM and ERANGE error codes were associated with the
integer values 33 and 34 respectively. These numbers are not necessarily the same on all
systems so comparisons must be made against the macro names for portability.
19.1.1. POSIX Error Codes
POSIX is an IEEE set of standards for maintaining compatibility between various
operating systems. It defines several rules and expectations that operating systems must
adhere to in order to be POSIX compliant. Such standards allow developers to develop
code that should be interoperable among a collection of different operating systems,
reducing the need for rewrites and reimplementations for different systems.
In particular, POSIX compliant systems define many other error codes (see [3]) that
306
19.1. Language Supported Error Codes
1 #include <stdio.h>
2 #include <stdlib.h>
3 #include <math.h>
4 #include <string.h>
5 #include <errno.h>
6
7 int main(int argc, char **argv) {
8
9 double a = -1, b = 2, c = 0.0;
10 double x;
11
12 //okay
13 x = sqrt(b);
14 printf("result: %.4f, error: %d\n", x, errno);
15
16 //NaN and EDOM error...
17 x = sqrt(a);
18 printf("result: %.4f, error: %d\n", x, errno);
19
20 //make a comparison
21 if(errno == EDOM) {
22 printf("it was an EDOM error\n");
23 }
24
25 //error messages can be accessed via:
26 char *errMsg = strerror(errno);
27 printf("Error Message: %s\n", errMsg);
28
29 //ERANGE error
30 x = log(c);
31 printf("result: %.4f, error: %d\n", x, errno);
32
33 if (errno == ERANGE) {
34 printf("it was an ERANGE error\n");
35 }
36
37 //error messages can be accessed via:
38 errMsg = strerror(errno);
39 printf("Error Message: %s\n", errMsg);
40
41 return 0;
42
43 }
Code Sample 19.1.: Using the errno.h library
307
19. Error Handling
can be used beyond the three mentioned above. For example, the ENOENT error code
corresponds to “No such file or directory” and EACCES corresponds to a “Permission
denied” error.
19.2. Error Handling By Design
In our own code we could communicate errors to calling functions by setting the errno
variable, however, we may run into compatibility issues with the standard error codes
or POSIX error codes. Instead, it may be more appropriate to do error handling by
utilizing the return value of a function to communicate an error code. We could design
our functions to always return an int value to indicate an error: 0 for no error and some
non-zero value to indicate various different types of errors. Of course, as a consequence
any value that needs to be “returned” to the calling function would need to be done so
via a pass by reference variable.
As an example, let’s revisit the quadratic roots example in Section 18.3.2. By returning
the two output values via pass by reference variables, we freed up the return value. We can
now modify our function to return an integer indicating an error code instead. Previously
we had identified several different types of errors: division by zero (if a = 0), complex
roots (if b2 − 4ac < 0) and a NULL pointer error if the variables passed by reference
were NULL . We can now modify our function to check for these errors and return an
appropriate error code. We return zero in the event that no error was encountered.
1 int quadraticRoots(double a, double b, double c,
2 double *root1, double *root2) {
3 if(a == 0) {
4 return 1;
5 } else if( b*b - 4*a*c < 0 ) {
6 return 2;
7 } else if(root1 == NULL || root2 == NULL) {
8 return 3;
9 }
10 double discriminant = sqrt(b*b - 4*a*c);
11 *root1 = (-b + discriminant) / (2*a);
12 *root2 = (-b - discriminant) / (2*a);
13 return 0;
14 }
Now when a function invokes our quadraticRoots() it can check to see what kind of
308
19.3. Enumerated Types
error code it returned and handle the error in whatever way it wants.
There is still an issue, however. The usage of the integers 1, 2, 3 to indicate the various
errors was arbitrary. These are essentially magic numbers that the calling function
would have to deal with by making comparisons with various integers. The numbers
themselves are meaningless and someone using them would need to constantly refer to
documentation to understand which integer corresponded to which error condition.
It would be much better if we could follow the strategy of the errno and define human-
readable identifiers for each error code. We could accomplish this by defining macros,
but another solution is to use an enumerated type.
19.3. Enumerated Types
C allows you to define enumerated types which allow you to define a fixed list of possible
values. For example, the days of the week or months of the year are possible values used
in a date. However, they are more-or-less fixed (no one will be adding a new day of the
week or month any time soon). An enumerated type allows us to define these values
using human-readable keywords (much like the #define macro).
To declare an enumerated type we use the keywords typedef enum (short for type
definition and enumeration). We then provide a comma delimited list of keywords inside
a code block. At the end of the code block we provide the type’s identifier. That is, the
name of the type itself. For example, the names of integer and floating-point types in C
are int and double respectively. This identifier gives our type a name that we can
later use to declare variables of that type. Consider the following example.
1 typedef enum {
2 SUNDAY,
3 MONDAY,
4 TUESDAY,
5 WEDNESDAY,
6 THURSDAY,
7 FRIDAY,
8 SATURDAY
9 } DayOfWeek;
In this example we’ve defined an enumeration of the days of the week. The name of the
type itself is DayOfWeek and we can now declare variables of this type. The possible
309
19. Error Handling
values it can take are SUNDAY , MONDAY , etc. and we can use these keywords in our
program. For example,
1 DayOfWeek today = MONDAY;
2
3 if(today == SUNDAY || today == SATURDAY) {
4 printf("It is the weekend!\n");
5 }
Note the modern naming conventions: the type identifier uses upper camel casing while
the enumerated values follow an uppercase underscore convention. Though our example
does not contain a value with multiple words, if it had, we would have used an underscore
to separate them. Furthermore, enumerated type declarations are usually placed in
separate header files along with function prototype declarations.
Care must be taken when using enumerated types, however. Internally, C simply associates
integers with the values. Thus, in our example, SUNDAY is actually 0 , MONDAY is 1 ,
and SATURDAY is 6 . When we do assignments or equality comparisons, we’re actually
just comparing integers. Consequently, a DayOfWeek variable may be assigned values
that do not correspond to our enumeration. For example,
DayOfWeek today = 1000;
is valid code and will not (in general) result in any compiler errors or warnings, even
though it is assigning an invalid value to the variable. You should only assign valid values
to an enumerated type variable. Proper error checking should also be done.
Despite this limitation, using enumerated types in C provides an obvious advantage.
Without an enumerated type we’d be forced to use a collection of magic numbers to
indicate values. Even for something as simple as the days of the week we’d be constantly
trying to remember: which day is Wednesday again? I forget, does our week start with
Monday or Sunday? Etc. By using an enumerated type these questions are mostly moot
as we can use the more human-readable keywords and eliminate the guess work.
19.4. Using Enumerated Types for Error Codes
Let’s apply enumerated types to our quadraticRoots() function example from before.
First, we define our enumerated type which includes all types of errors including a
NO_ERROR type. Note that we start with NO_ERROR as its value will be zero following
our convention.
310
19.4. Using Enumerated Types for Error Codes
1 typedef enum {
2 NO_ERROR,
3 DIV_BY_ZERO_ERROR,
4 COMPLEX_ROOT_ERROR,
5 NULL_POINTER_ERROR
6 } ErrorCode;
Now in the quadraticRoots() function, we can return the appropriate error code as
an enumerated type value.
1 ErrorCode quadraticRoots(double a, double b, double c,
2 double *root1, double *root2) {
3 if(a == 0) {
4 return DIV_BY_ZERO_ERROR;
5 } else if( b*b - 4*a*c < 0 ) {
6 return COMPLEX_ROOT_ERROR;
7 } else if(root1 == NULL || root2 == NULL) {
8 return NULL_POINTER_ERROR;
9 }
10 double discriminant = sqrt(b*b - 4*a*c);
11 *root1 = (-b + discriminant) / (2*a);
12 *root2 = (-b - discriminant) / (2*a);
13 return NO_ERROR;
14 }
311
20. Arrays
C allows you to declare and use arrays. Since C is statically typed, arrays must also
be typed when they are declared and may only hold that particular type of element. C
supports the use of both static arrays and dynamic arrays through standard library calls.
20.1. Basic Usage
To declare a static array, you use syntax similar to declaring a regular variable, but you
use square brackets to designate the variable as an array. Within the square brackets
you indicate the size (number of elements) in the array. For example,
1 int arr[5];
2 double values[10];
The two declarations above create arrays of size 5 and 10 respectively. The array types
are also defined using the usual keywords. In this case, arr can only hold int values
and values can only hold double values. Arrays follow the same naming rules and
conventions as regular variables. Many times, identifiers are made plural as an array
naturally holds more than one value.
Another way to declare an array is to use the compound declaration and assignment
syntax whereby you can initialize an array to hold a certain list of values.
1 int a[] = { 2, 3, 5, 7, 11 };
Using this syntax we do not need to specify the size of the array as the compiler is smart
enough to count the number of elements we’ve provided. The elements themselves are
denoted inside curly brackets and delimited with commas.
313
20. Arrays
Variable Length Arrays
C99 introduced Variable Length Arrays (VLAs, which are also supported in GNU C89)
which allow you to declare a static array whose size is determined by a variable. For
example,
1 int n = 5;
2 int arr[n];
or within a function,
1 void foo(int n) {
2 int arr[n];
3 ...
4 }
In either case, care must be taken as static arrays are allocated on the stack. The stack
is generally small and allocating even a moderately large array on the stack may lead to
a stack overflow. In addition, VLAs are not supported in any C++ standard and should
be avoided if portable code is desired.
Indexing
Once an array has been created, its elements can be accessed using indexing. C uses the
standard 0-indexing scheme so the first element is at index 0, the second at index 1, etc.
Indexing an element involves using the square bracket notation and providing an index.
Once indexed, an array element can be treated as a normal variable and can be used
with other operators such as the assignment operator or comparison operators.
1 arr[0] = 42;
2 if(arr[4] < 0) {
3 printf("negative!\n");
4 }
5 printf("arr[1] = %d\n", arr[1]);
314
20.1. Basic Usage
Recall that an index is actually an offset. The compiler and system know exactly how
many bytes each int element takes and so an index i calculates exactly how many
bytes from the first element the i-th element is located at. Consequently it is possible
to index elements that are beyond the range of the array. For example, arr[-1] or
arr[5] would attempt to access an element immediately before the first element and
immediately after the last element. Obviously, these elements are not part of the array.
If these out-of-bound elements represent a memory space that does not belong to our
program, then it is likely that a segmentation fault will occur and terminate our program.
However, it is also likely that the memory space surrounding our array does belongs to
our program. Still, accessing those blocks of memory may not give us meaningful values
and modifying them could corrupt other variable values or generally lead to undefined
behavior. It is our responsibility as programmers to write code that does not go beyond
the bounds of an array.
How can we keep track of the size of the array so that we do not access elements after the
last element? With C the responsibility again falls to us. We must always have secondary
variables that store the size of an array. If we pass an array to a function (see below), we
must also pass a “size” parameter so that the function knows how big the array is.
Iteration
C provides no foreach loop to iterate over an array. Instead, the most natural way to
iterate over the elements is a normal for loop that increments an index variable.
1 int i, n = 10;
2 int arr[n];
3 for(i=0; i<n; i++) {
4 arr[i] = 5 * i;
5 }
The for loop above initializes the variable i to zero, corresponding to the first element
in the array. The continuation condition is specifies that the loop continues while i is
strictly less than the size of the array. This iteration for loop is idiomatic when dealing
with arrays. An alternative was presented in Section 17.4.
315
20. Arrays
20.2. Dynamic Memory
Recall that static arrays have many shortcomings (see Section 7.2). In general they
should be avoided since stack space is limited and they cannot be returned from functions.
Fortunately, C provides several standard library functions that facilitate the creation
and management of dynamically allocated arrays.
The primary function to allocate memory is the memory allocation function, malloc() :
void * malloc(size_t size);
which takes a single parameter, the number of bytes that you wish to allocate. The type,
size_t is an alias for an unsigned integer type, so you can think of it as an integer.
Thus, malloc(200) would allocate 200 bytes and return a pointer to the memory space.
In some instances, the allocation may fail. For example, if the program or system has
run out of available memory or you simply request too much. In the event of a failure,
malloc() returns a NULL pointer. The returned value can thus be checked to see if
the allocation was successful or not.
We don’t have to manually calculate how many bytes we need for an array of a particular
size. The macro sizeof() can be used to determine the number of bytes any type of
variable requires on a system. For example, sizeof(int) gives the number of bytes an
int takes while sizeof(double) gives the number of bytes for a double , etc. Thus,
if we want to allocate an array of 100 integers, we could call malloc() as
malloc(100 * sizeof(int));
Using sizeof() is actually preferable as some systems may use a different number of
bytes for various types.
Finally, note the return type of malloc() : it is a void pointer. The malloc() function
simply allocates chunks of memory. It doesn’t care that you intend to use the memory to
store integers or floating-point numbers. Thus, malloc() returns a “generic” pointer,
simply an address in memory. Once we have that pointer we can treat it as an integer
pointer, int * or a floating-point pointer, double * depending on what we want to
store.
One way of doing this is to explicitly cast the void pointer as the pointer that we want.
Some examples:
1 int *arr = NULL;
2 double *values = NULL;
3
4 arr = (int *) malloc(sizeof(int) * 10);
316
20.2. Dynamic Memory
5 values = (double *) malloc(sizeof(double) * 100);
The pointer cast is just like when we casted int types as double types so that we
could perform division without truncation. In this case, we convert the returned generic
void pointer into a int pointer and double pointer respectively.1
Once created, a dynamic array can be used just like a static array. You use the array’s
identifier as well as an index to access or modify each element. The same rules and
pitfalls apply, so care must be taken to not access elements outside the bounds of the
array. Finally, when using malloc() it is important to understand that the memory
that is allocated is uninitialized. Just as with variables you cannot make any assumptions
as to the contents of the memory space that is allocated. It may contain garbage values,
it may contain the contents that occupied the memory last time it was used, etc. A full
example:
1 int n = 100;
2 int *arr = NULL;
3 arr = (int *) malloc(sizeof(int) * n);
4 if(arr == NULL) {
5 fprintf(stderr, "unable to allocate memory!\n");
6 exit(1);
7 }
8 for(i=0; i<n; i++) {
9 arr[i] = (i+1) * 10;
10 printf("a[%d] = %d\n", i, arr[i]);
11 }
There are other functions that can be used to allocate memory in C. For example,
calloc() is similar to malloc() but initializes the contents to zero (null bytes).
realloc() can be used to resize an existing memory space (though it may fail if it
cannot be expanded).
1
Performing an explicit pointer cast is actually not necessary in C as the type system will do an implicit
cast for us. Whether explicit or implicit types casts are “better” can evoke debates akin to nerd
holy wars. Though there are advantages and disadvantages to both [15], we perform explicit pointer
casts in this book as clarity and intent is more important than brevity. Even more important is that
explicit pointer casts are necessary in C++ so doing so in our C code makes our code more portable.
317
20. Arrays
Deallocation
Once dynamically allocated memory is no longer needed, we should release it so that
it can be reused by the program or the operating system. The free() function in the
standard library does this for us. All we need to do is provide the pointer to free()
and it deallocates the memory block.
1 free(arr);
Once freed, accessing old memory pointed to by the arr pointer is undefined behavior
and may lead to unexpected or fatal results.
20.3. Using Arrays with Functions
Since arrays are represented using pointers, we can pass and return arrays to and from
functions simply by passing in a pointer. When passing an array to a function, we also
need to make sure that we communicate to the function the size of the array as there is
no reliable way for the function to determine this. By passing both a pointer and an
integer representing the size, we are implicitly indicating that we are passing an array
and not just a single value.
As an example, the following function takes an array of integers and computes their sum.
1 /**
2 * This function computes the sum of elements in the
3 * given array which contains n elements
4 */
5 int computeSum(int *arr, int n) {
6 int i;
7 int sum = 0;
8 for(i=0; i<size; i++) {
9 sum += arr[i];
10 }
11 return sum;
12 }
318
20.4. Multidimensional Arrays
In this example we had no need to make changes to any of the elements in the array.
However, the array was still passed by reference, meaning we could have. When passing
arrays, we can use the keyword const (short for constant) to explicitly indicate that no
changes will be made to the array elements. For example,
int computeSum(const int *arr, int n)
This is enforced by the compiler: if we do attempt to make changes to a const array, it
will be a compiler error.
We can also create an array in a function and return it as a value. As previously discussed,
we will need to do so by creating a dynamically allocated array. For example, the following
function creates a deep copy of the given integer array. That is, a completely new array
that is a distinct copy of the old array. In contrast, a shallow copy would be if we simply
made one reference point to another reference.
1 /**
2 * This function creates a new copy of the given integer
3 * array which contains n elements and returns a pointer
4 * to the new copy.
5 */
6 int * makeCopy(const int *a, int n) {
7 int *copy = (int *)malloc(sizeof(int) * n);
8 int i;
9 for(i=0; i<n; i++) {
10 copy[i] = a[i];
11 }
12 return copy;
13 }
The function returns an integer pointer. Here we have a similar problem with respect to
the size of the array. We only have one return value, which must be the pointer. In this
particular example the calling function knows how big the array is because it specified
the size by passing in n . In general we could have communicated the size of the returned
array through another pass by reference integer variable.
20.4. Multidimensional Arrays
C supports multidimensional arrays both static and dynamically allocated; though we’ll
only focus on dynamically allocated 2-dimensional arrays. Conceptually, a 2-dimensional
319
20. Arrays
array of, say, integers can be modeled as an array of pointers that point to an array of
integers. That is, a pointer to pointers, for example, int ** . The initial pointer points
to an array of integer pointers, int * and each integer pointer points to an array of
int variables.
To understand this better, let’s look at the details of allocation. Consider the following
code.
1 int i;
2 int **myMatrix = NULL;
3 myMatrix = (int **)malloc(n * sizeof(int*));
4 for(i=0; i<n; i++) {
5 myMatrix[i] = (int *)malloc(n * sizeof(int));
6 }
Line 3 invokes malloc() to create an array of n integer pointers, that is int * types.
We then go into a loop to iterate over each of these pointers and invoke malloc()
again to setup each array. This process is visualized in Figure 20.1. Note the syntax:
when we invoke malloc() to create an array of pointers, we use sizeof(int*) to
determine how many bytes each integer pointer takes. We also do an explicit type cast
of (int **) to match our pointer-to-pointer(s) variable myMatrix .
Once the allocation has completed, we can treat myMatrix as a normal 2-dimensional
array and index each element with two index variables.
1 int i, j;
2 for(i=0; i<n; i++) {
3 for(j=0; j<n; j++) {
4 myMatrix[i][j] = 0;
5 }
6 }
To deallocate and free multidimensional arrays, we need to work backwards. If we imme-
diately freed the pointer-to-pointers, free(myMatrix); , we would lose all references to
the individual array “rows” and would not be able to free them, resulting in a memory
leak. We need to free up each row first, then we can free the pointer-to-pointers.
320
20.4. Multidimensional Arrays
**myMatrix
*myMatrix[0] ?
*myMatrix[1] ?
*myMatrix[2] ?
..
.
*myMatrix[n-1] ?
(a) Initialization of the pointer-to-pointers. The first invocation of malloc() sets up an
array of integer pointers, int * that are uninitialized (where they point to is undefined).
**myMatrix
*myMatrix[0] myMatrix[0][0] myMatrix[0][1] myMatrix[0][2] ··· myMatrix[0][n-1]
*myMatrix[1] ?
*myMatrix[2] ?
..
.
*myMatrix[n-1] ?
(b) Initialization of the first pointer. On the first iteration of the for loop when i = 0, the
first “row” is initialized when malloc() is invoked.
**myMatrix
*myMatrix[0] myMatrix[0][0] myMatrix[0][1] myMatrix[0][2] ··· myMatrix[0][n-1]
*myMatrix[1] myMatrix[1][0] myMatrix[1][1] myMatrix[1][2] ··· myMatrix[1][n-1]
*myMatrix[2] ?
..
.
*myMatrix[n-1] ?
(c) Initialization of the second pointer. On the second iteration of the for loop when i = 1,
the second “row” is initialized.
**myMatrix
*myMatrix[0] myMatrix[0][0] myMatrix[0][1] myMatrix[0][2] ··· myMatrix[0][n-1]
*myMatrix[1] myMatrix[1][0] myMatrix[1][1] myMatrix[1][2] ··· myMatrix[1][n-1]
*myMatrix[2] myMatrix[2][0] myMatrix[2][1] myMatrix[2][2] ··· myMatrix[2][n-1]
..
.
*myMatrix[n-1] myMatrix[n-1][0] myMatrix[n-1][1] myMatrix[n-1][2] · · · myMatrix[n-1][n-1]
(d) After the termination of the for loop, each row has been initialized and the pointer-to-
pointers can be treated like a 2-dimensional array.
Figure 20.1.: The process of dynamically allocating a 2-dimensional array of integers
using malloc() in a for-loop.
321
20. Arrays
1 for(i=0; i<n; i++) {
2 free(myMatrix[i]);
3 }
4 free(myMatrix);
20.4.1. Contiguous 2-D Arrays
The example depicted in Figure 20.1 constructs a two dimensional array. However, each
“row” of the array was created using an independent call to malloc() which may result
in non-contiguous memory blocks (each row may not be located in the memory address
immediately following the previous row). In general, this is not a problem for most
situations (we can expect most implementations of malloc() to be efficient). However,
it might be better in some scenarios if the two dimensional array were all one big block
of contiguous memory.
We can achieve this by a single call to malloc() and some clever pointer manipulation.
We do this very similar to the previous example. Our first call to malloc() to set up
the pointer-to-pointers is the same. However, instead of calling malloc() over and over
in a for loop, we make one single call asking for a number of bytes to accommodate the
entire n × m array. We then store the result at the “beginning” of the array (at index
zero). In the following example, we will create a 4 × 3 sized matrix.
1 int **m = (int **) malloc(sizeof(int *) * 4);
2 m[0] = (int *) malloc(sizeof(int) * (4 * 3));
We’re not done yet, however. We still need to initialize all of the other pointers. To do
so, we dereference the array (once) to get the address of the start of the memory block
and then compute an offset from this beginning on where the next “row” should be.
Since each row has 3 elements, this arithmetic is simple.
1 for(i=1; i<4; i++) {
2 arr[i] = (*arr + (3 * i));
3 }
322
20.4. Multidimensional Arrays
Now we can treat the array like we would any other two dimensional array by specifying
two indices.
1 for(i=0; i<4; i++) {
2 for(j=0; j<3; j++) {
3 arr[i][j] = 10 * i + j;
4 }
5 }
Which would result in an array that, conceptually, looks something like the following.
[ 0 1 2 ]
[ 10 11 12 ]
[ 20 21 22 ]
[ 30 31 32 ]
Which are all stored in one large chunk of memory. To see this, we can print out the
memory address of each “row” during a particular run of the program:
arr[0] = 0x7fe51b403270
arr[1] = 0x7fe51b40327c
arr[2] = 0x7fe51b403288
arr[3] = 0x7fe51b403294
Note that each hexadecimal value differs by 0x0c (that is, 12 bytes):
0x...70 + 0x0c = 0x...7c
0x...7c + 0x0c = 0x...88
0x...88 + 0x0c = 0x...94
This is exactly how many bytes the 3 integers (4 bytes each) take in memory in each
“row.” The pointer setup is depicted in Figure 20.2.
323
20. Arrays
**m
m[0] m[1] m[2] m[3]
m[0][0] m[0][1] m[0][2] m[1][0] m[1][1] m[1][2] m[2][0] m[2][1] m[2][2] m[3][0] m[3][1] m[3][2]
Figure 20.2.: Contiguous Two Dimensional Array. The initial pointer-to-pointers m is
initialized to an array of pointers, m[0]..m[3] . A 4 × 3 contiguous array
is created and each of the pointers is initialized to the proper location so it
can be treated as a two-dimensional array.
20.5. Dynamic Data Structures
The C standard library does not provide a variety of advanced, dynamic data structures
such as linked lists or sets. As of C89 and POSIX.1 the C standard library does provide
hash tables and binary search trees, but does not require implementations of other dynamic
data structures. Instead, you must either implement your own or utilize a third-party
library such as glibc, the GNU C library (http://www.gnu.org/software/libc/).
324
21. Strings
C has no built-in string type. Instead, strings are represented as arrays of char elements.
They differ from, say arrays of int or double types, however, in that they are null
terminated arrays. The end of the string must always be denoted with a null-terminating
character, '\0' (the 0 valued character in the ASCII table). Failure to properly
null-terminate a string may lead to undefined behavior or fatal errors.
C provides a good variety of functions in its standard string library (included in the
string.h header). All of these functions operate under the assumption that the strings
passed to it are null-terminated. It is your responsibility to ensure that they are. Moreover,
some of the functions that operate on strings will inset the null-terminating character for
us, but others will not. It is important to understand the expectations and guarantees of
each function.
21.1. Character Arrays
We’ve previously used string literals when using the standard input and output functions,
printf() and scanf() . You can also create static strings (as static arrays) using the
standard assignment operator. Some examples:
1 char firstName[] = "Tom";
2 char lastName[] = "Waits";
index 0 1 2 3 4 5 6 7 8 9
char *s H e l l o \0 ? ? ? ?
Figure 21.1.: A string in C is achieved by using a char array. However, the string is
terminated by a null-terminating character, \0 . Though an array may have
space for additional characters, they are irrelevant if the null terminator
precedes them.
325
21. Strings
This syntax can only be used when creating static strings (they are allocated on the
stack and locally scoped). The compiler is able to scan the string literal and determine
how many characters are needed and even inserts the null-terminating character for us.
Thus, the length of the two strings in the example are 3 and 5 respectively, but the array
size created for them will be 4 and 6 respectively to accommodate the null-terminating
character.
Static strings have the same limitations as static arrays. Since they are allocated on the
stack, they cannot be returned from a function. Just as with int and double types,
however, we can dynamically allocate memory to hold char types using malloc() . The
important difference being that we need to always allocate at least one more character
to accommodate the null-terminating character.
1 char *fullName = NULL;
2 fullName = (char *) malloc(sizeof(char) * 10);
This example creates a dynamically allocated char array that is able to hold 9 characters
(since one will be needed for the null-terminating character). However, once we have
created the array, we cannot simply assign an entire string to it using the usual assignment
operator.
1 //THIS IS *WRONG*:
2 fullName = "Tom Waits";
This will compile, but doesn’t give us what we want. Recall that fullName is a character
pointer. Using the assignment operator simply makes it point to the static, literal string
"Tom Waits" . In fact, we lose our reference to the dynamically allocated array that
was created with malloc() , resulting in a memory leak.
Instead, we need to use a function in the standard library to copy a string. The function
in the standard library that allows you to copy strings is as follows.
char *strcpy(char *dest, const char *src);
The name, strcpy is short for “string copy.”1 Both arguments are character pointers.
In keeping with the use of the assignment operator, the second argument (“source”)
is copied into the first, “destination” (just as with an assignment operator, the value
1
The abbreviations are mostly historic: in the 70s and 80s when memory was measured in kilobytes,
saving a few characters made a significant difference.
326
21.2. String Library
on the right-hand-side is copied into the variable on the left-hand-side). Moreover, the
second argument has been marked as const indicating that it will not be changed.
The contents of the first argument will be changed since we are copying a string into
it, erasing whatever contents it had prior. Finally, the function returns a pointer to the
dest argument, mostly so that it can be used in nested function calls (though we’ll
avoid such confusingly terse “tricks”). From our example:
1 //"assign" (copy) "Tom Waits" into the string fullName:
2 strcpy(fullName, "Tom Waits");
In addition, we can access and modify individual characters in a string using the usual
indexing and assignment operator with char literals.
1 //access individual characters:
2 char firstInitial = fullName[0]; //'T'
3 char lastInitial = fullName[4]; //'W'
4
5 //printing:
6 printf("First Initial: %c\n", fullName[0]);
7
8 //modifying:
9 firstInitial[0] = 't';
10 firstInitial[4] = 'w';
11 //fullName is now "tom waits"
21.2. String Library
The standard string library provides many other convenient functions that allow you to
process and modify strings. We highlight a few of the more common ones here. A full
list of supported functions can be found in standard documentation.
Length
As with regular arrays, we are responsible for ensuring that we do not access characters
outside the character array of a string. Since a string is null-terminated, there is a nice
327
21. Strings
function provided by the string library to determine its length,
size_t strlen(const char *s);
Recall that size_t can essentially be treated as an integer, indicating the number of
bytes in the passed string. Since a character is a single byte, this function tells us how
many character are in the given string not including the null-terminating string. This
function is an abbreviation for “string length.” Using this function we can easily iterate
over each character in a string.
1 int i;
2 for(i=0; i<strlen(fullName); i++) {
3 printf("fullName[%d] = %c\n", i, fullName[i]);
4 }
Concatenation
A concatenation function is provided that allows you to append one string to the end of
another.
char *strcat(char *dest, const char *src);
Similar to the strcpy() function, strcat() appends the “source” ( src ) string to
the end of the “destination” ( dest ) string. It is your responsibility to ensure that the
destination string is large enough to accommodate the source string. If it is not, then it
could lead to undefined behavior as strcat() overwrites memory after the end of the
destination string. Further, strcat() will copy the null-terminating character for you
so that the resulting string (now stored in dest ) is a valid null-terminated string.
1 char *formattedName = (char *)malloc(11 * sizeof(char));
2 //copy "Waits" into formattedName
3 strcpy(formattedName, lastName);
4 //append a ", " to formattedName
5 strcat(formattedName, ", ");
6 //append the firstName to the formattedName
7 strcat(formattedName, firstName);
8 //formattedName now contains "Waits, Tom"
328
21.2. String Library
Byte-Limited Versions
C also provides several byte-limited versions of the copy and concatenation functions:
char *strncpy(char *dest, const char *src, size_t n);
char *strncat(char *dest, const char *src, size_t n);
They work similarly in that they copy/concatenate the source, src string into the
destination, dest string. However, there is a third parameter, n which specifies at
most how many bytes to copy/concatenate. The parameter, n allows you to limit the
number of characters that the operation uses. If either of these functions encounters the
null-terminating character before n bytes have been copied/concatenated, they stop and
copy the null-terminating character for us.
However, these functions do not always handle the null-terminating character for us. If
the null-terminating character appears in the first n bytes, it will be copied for us, but
if it is not, we need to be sure to handle it ourselves. For example,
1 char email[] = "twaits@cse.unl.edu";
2 char *login = (char *) malloc(7 * sizeof(char));
3
4 //only copy the first 6 characters:
5 strncpy(login, email, 6);
6 //at this point, login contains "twaits" but is
7 //not null-terminated, so we manually terminate it
8 login[6] = '\0';
Computing a Substring
The byte-limited versions of the copy function can be used to compute a substring of
another string. The parameter n can be used to limit the length of the string, but how
might we specify where the substring should start?
For example, in the string "Thomas Alan Waits" we may want to get the substring
representing his middle name, "Alan" . The length is 4 and we can specify that the
copying should start by using an index. In this case, we want the copying to start at
index 7 , the 8th character. If the string is stored in an array named name , this would
be name[7] . However, indexing an array like this results in a single character and
strncpy() expects a string (a character pointer ). Fortunately, we know how to do this:
329
21. Strings
using the referencing operator, we can turn the 8th character into a character pointer,
&name[7] . A full example:
1 char name[] = "Thomas Alan Waits";
2 char *middleName = (char *) malloc(sizeof(char) * 5);
3 strncpy(middleName, &name[7], 5);
4 middleName[4] = '\0';
5 //middleName now holds "Alan"
In the call to malloc() , we included space for a null-terminating character. Furthermore,
strncpy() does not insert the null-terminating character for us in this case. In line 4
we manually insert it.
21.3. Arrays of Strings
We often need to deal with collections of strings. An array of strings can be viewed as a
2-dimensional character array. Indeed, we’ve seen this before. In the typical C program’s
main() function, command line arguments are passed as the second parameter:
int main(int argc, char **argv)
which is represented as a double character pointer, char ** . Conceptually, each row
is a string, char * . The first parameter, argc indicates how many rows there are.
The main() function doesn’t need to be told how big each “row” is since strings are
null-terminated.
We can create our own arrays of strings similar to how we created 2-dimensional arrays
of int and double types.
1 //create an array that can hold 5 strings
2 char **names = (char **) malloc(5 * sizeof(char*));
3 int i;
4 for(i=0; i<5; i++) {
5 //each string can hold at most 19 characters
6 names[i] = (char *) malloc(sizeof(char) * 20);
7 }
8 strcpy(names[0], "Margaret Hamilton");
9 strcpy(names[1], "Ada Lovelace");
10 strcpy(names[2], "Grace Hopper");
330
21.4. Comparisons
11 strcpy(names[3], "Marie Curie");
12 strcpy(names[4], "Hedy Lamarr");
21.4. Comparisons
When comparing strings in C, we cannot use the numerical comparison operators such
as == , or < . Because strings are represented as arrays, using these operators actually
compares the variable’s memory addresses.
1 char *a = (char *) malloc(sizeof(char) * 13);
2 char *b = (char *) malloc(sizeof(char) * 13);
3 strcpy(a, "Hello World!");
4 strcpy(b, "Hello World!");
5
6 if(a == b) {
7 printf("strings match!\n");
8 }
The code above will not print anything even though the strings a and b have the
same content. This is because a == b is comparing the memory address of the two
variables. Since they point to different memory addresses (created by two separate calls
to malloc() ) they are not equal.
The C string library provides a standard comparator function to compare strings based
on their content:
int strcmp(const char *a, const char *b);
The function takes two strings and returns an integer based on the lexicographic ordering
of a and b . If a precedes b , strcmp() returns something negative. It returns zero if
a and b have the same content. Otherwise it returns something positive if b precedes
a . Some examples:
1 int x;
2 x = strcmp("apple", "banana"); //x is negative
3 x = strcmp("zelda", "mario"); //x is positive
331
21. Strings
4 x = strcmp("Hello", "Hello"); //x is zero
5
6 //shorter strings precede longer strings:
7 x = strcmp("apple", "apples"); //x is negative
8 //uppercase precede lowercase:
9 x = strcmp("Apple", "apple"); //x is negative
In the last example, "Apple" precedes "apple" since uppercase letters are ordered
before lowercase letters according to the ASCII table. We can also make comparisons
ignoring case if we need to using the alternative:
int strcasecmp(const char *s1, const char *s2);
which is a case-insensitive version. Here, strcasecmp("Apple", "apple") will return
zero as the two strings are the same ignoring the cases.
The comparison functions also have byte-limited versions,
int strncmp(const char *s1, const char *s2, size_t n);
and
int strncasecmp(const char *s1, const char *s2, size_t n);
Both will only make comparisons in the first n bytes of the strings. Thus, the comparison,
strncmp("apple", "apples", 5) will result in zero as the two strings are equal in
the first 5 bytes.
21.5. Conversions
We’ve previously examined the functions atoi() and atof() that allow you to convert
strings that hold numeric values to int and double values respectively. Another way to
convert strings to numbers is to use a function similar to the familiar scanf() function
which reads its string from the standard input. The sscanf() function reads its “input”
from a string instead of the standard input.
1 char s[] = "103212.3214";
2 double x;
3 sscanf(s, "%lf", &x);
4 //x now has the value 103212.3214
332
21.6. Tokenizing
The sscanf() function differs in its first argument: the string that contains the value
you want to parse. Otherwise, the second two arguments are as in scanf() : the format
(as a string) and the variable(s) that the results should be stored in (passed by reference).
Likewise, there is a companion sprintf() which is similar to the printf() function,
but instead of printing to the standard output, it “prints” to the string. That is, the
result is placed in a string.
1 int x = 10;
2 double y = 3.14;
3 char *s = (char *) malloc(sizeof(char) * 50);
4 sprintf(s, "The value of x is %d, y = %f.", x, y);
5 //s now contains "The value of x is 10, y = 3.140000."
21.6. Tokenizing
Recall that tokenizing is the process of splitting up a string along some delimiter. For
example, the comma delimited string, "Smith,Joe,12345678,1985-09-08" contains
four pieces of data delimited by a comma. Our aim is to split this string up into four
separate strings so that we can process each one. The C string library provides a
tokenizing function:
char *strtok(char *str, const char *delim);
which works as follows. The first argument is the string that you want to tokenize and
the second contains the delimiter that you want to split along. The second argument is
actually a string and allows you to specify more than one delimiter, but we’ll restrict our
attention to single character delimiters. The function returns a pointer to the first token
in the string. To get the second and all subsequent tokens, we call strtok() again, but
we pass it NULL as the first argument to continue parsing the same string.
If we pass a new string as the first argument to strtok() the tokenization process
will start over on the new string. Note that the first argument does not have the
const keyword. This is because strtok() will make changes to the string during
the tokenization process. If the string needs to be preserved, tokenization should be
performed on a deep copy of the string.
When there are no more tokens in the string, strtok() returns NULL to indicate no
333
21. Strings
more tokens are in the string. This logic can be used to write a while loop to iterate over
each token. Consider the following example.
1 char data[] = "Smith,Joe,12345678,1985-09-08";
2 char *token = NULL;
3 //make the initial call to strtok:
4 token = strtok(data, ",");
5 while(token != NULL) {
6 printf("token: %s\n", token);
7 //get the next token:
8 token = strtok(NULL, ",");
9 }
This outputs the following:
token: Smith
token: Joe
token: 12345678
token: 1985-09-08
It should be noted that strtok() is not reentrant. It can only work on one string at a
time. In a multithreaded application, two threads cannot both use strtok() or they
would end up processing each other’s strings. Even in a non-threaded application, we
need to be careful. For example, we cannot process a string using strtok() in one
function and then call another function that does the same. C does provide a reentrant
version, strtok_r() that can be used.
334
22. File I/O
C provides several functions to manipulate and process files. Like other I/O functions,
these are all defined in the standard input/output library, stdio.h . Writing binary
or plaintext data is determined by which functions you use. Whether or not a file
input/output stream is buffered or unbuffered is determined by the system configuration.
There are some ways in which this can be changed, but we will not cover them in detail.
22.1. Opening Files
Files are represented in C by a FILE * pointer type defined in the standard input/output
library. As a pointer, it essentially points to the file stored in memory. To open a file,
you use the fopen() function (short for f ile open) which takes two arguments and
returns a FILE * pointer:
FILE *fopen(const char *path, const char *mode);
The first argument is the file path/name that you want to open for processing. The
second argument is a string representing the “mode” that you want to open the file in.
There are several supported modes, but the two we will be interested in are reading, in
which case you pass it "r" and writing in which case you pass it "w" . The path can
be an absolute path, relative path, or may be omitted if the file is in the current working
directory.
1 //open a file for reading (input):
2 FILE *input = fopen("/user/apps/data.txt", "r");
3 //open a file for writing (output):
4 FILE *output = fopen("./results.txt", "w");
5
6 if(input == NULL) {
7 fprintf(stderr, "Unable to open input file");
8 exit(1);
9 }
10
11 if(output == NULL) {
335
22. File I/O
12 fprintf(stderr, "Unable to open output file");
13 exit(1);
14 }
The two checks above check that the file opened successfully. If the file opening failed,
fopen() returns NULL . Opening a file can fail for a number of reasons. On POSIX
systems for example, additional information can be obtained by accessing the standard
error number, errno (see Section 19.1). Some errors that can result:
• ENOENT – No such file or directory
• EACCES – Permission denied
• ENOMEM – Insufficient storage space is available
among many other possibilities. These error codes can be used to implement more specific
error handling code if desired.
22.2. Reading & Writing
When a file is opened, the file pointer returned by fopen() initially points to the
beginning of the file. As you read from it or write to it, the pointer advances through
the file content.
22.2.1. Plaintext Files
To process a plaintext file we use two functions, fprintf() for output and fscanf()
for input. These two functions should look familiar. They work almost exactly the same
as printf() and scanf() that work with the standard output and standard input
respectively. In fact, the standard in/out are both files so it makes sense that they can
be read from/written to. The f prefixed versions are simply generalizations that can be
used for any file. The only difference is that the first argument for these two functions is
the file you want to output to or read from.
1 int x = 10;
2 double y = 3.14;
3
4 //write to a plaintext file
336
22.2. Reading & Writing
5 fprintf(output, "Hello World!\n");
6 fprintf(output, "x = %d, y = %f\n", x, y);
7
8 //read from a plaintext file
9 fscanf(input, "%d", &x);
10 fscanf(input, "%lf", &y);
11
12 //these are equivalent to printf, scanf:
13 fprintf(stdout, "Please enter an integer:");
14 fscanf(stdin, "%d", &x);
Using fscanf() for arbitrary string input is potentially dangerous as there is limited
bounds checking. We must store the input value from the file into a string (character
array), but if the file or line contains more characters than the array can accommodate
we may have a buffer overflow.
A better way to read input is to use fgets() which allows us to limit the number of
bytes that are read.
char *fgets(char *s, int size, FILE *stream);
The first argument is the string that the input data will be read into. The second
parameter is how we limit the number of characters that will be read. It actually reads
in one fewer character, size-1 to account for the null-terminating character which
fgets() automatically inserts for us. The last argument is the file pointer that we wish
to read from.
The behavior of fgets() is that it reads up to size-1 characters from the input
file and places the results into s . If fgets() encounters either an EOF symbol or
an endline character, '\n' it stops reading. In the case of an endline character, it is
included in the result and may need to be chomped out (that is, removed).
The fgets() function can be used to process a file line by line until the end of the
file is reached. Each line can be processed (perhaps tokenized) individually to extract
particular pieces of data. This is typically how a CSV or similar file may be processed.
To determine if the end of the file has been reached, you can use the return value of the
function: it returns NULL when no more characters have been read.
1 FILE *input = fopen("data.txt", "r");
2 //this assumes that no line is more than 999 characters
3 char line[1000];
337
22. File I/O
4 //read the first line
5 char *s = fgets(line, 1000, input);
6 while(s != NULL) {
7
8 //chomp the endline character from line:
9 line[strlen(line)-1] = '\0';
10
11 //process the current buffer
12 //for demonstration, we simply print it:
13 printf("line = %s\n", line);
14
15 //read the next line
16 s = fgets(line, 1000, input);
17 }
A similar function, int fgetc(FILE *stream) allows us to get a single character from
the input file (returned as an int ) if we prefer to read character by character.
22.2.2. Binary Files
To read and write binary data to files we use two different functions:
size_t fread(void *ptr, size_t size, size_t nmemb, FILE *stream);
for reading from a file and
size_t fwrite(const void *ptr, size_t size, size_t nmemb, FILE *stream);
to write to a file. Both functions have the exact same arguments:
1. ptr is a pointer to the item that is being read/written (possibly an array of
elements)
2. size is the number of bytes that each element stored at ptr take, usually
determined by using sizeof()
3. nmemb is the number of elements to be written/read
4. stream is the file stream to be read from/written to
These functions allow you to read/write an arbitrary amount of binary data. When
reading, it is your responsibility, as usual, to ensure that the ptr is large enough to
338
22.3. Closing Files
accommodate the data you are reading into it.
1 int x = 10;
2
3 FILE *binaryOutputFile = fopen("demo.bin", "w");
4
5 //write a single int to a file:
6 fwrite(&x, sizeof(int), 1, binaryOutputFile);
7
8 FILE *binaryInputFile = fopen("input.bin", "r");
9
10 //read a single int from the file:
11 fread(&x, sizeof(int), 1, binaryInputFile);
12
13 //read an entire array from the file:
14 int *a = (int *) malloc(10 * sizeof(int));
15 fread(a, sizeof(int), 10, binaryInputFile);
22.3. Closing Files
Once you are done processing a file, you should close it using the fclose() function:
int fclose(FILE *fp);
which takes a single argument, the FILE pointer of the file you wish to close. Closing
an invalid file may result in an error or segmentation fault. In any case, after a file has
been closed, it cannot be read from or written to, doing so is undefined behavior. Failure
to close a file may result in a corrupted file.
339
23. Structures
Strictly speaking, C is not an object-oriented programming language, it is an imperative
(or, relatedly a structured or procedural ) programming language. This means that C can
be characterized as a language that changes a program’s state through statements and
the use of function calls. Though C does not have objects, it does support a “weak” form
of encapsulation through the use of structures. Structures are a user-defined type that
collects multiple pieces of data together into one logical unit. Once defined, structures
can be used in a program just like any other variable type; structure variables can be
declared, passed and returned from functions, pointers to structures can be used, etc.
Structures form a “weak” form of encapsulation in that they only provide the grouping of
data. The protection of data through visibility keywords is not supported. The grouping
of functions that act on that data is also not readily supported.1 However, even this
weak form provides a very useful and convenient way to collect related pieces of ?ata.
23.1. Defining Structures
To define a structure, we use the keyword struct along with the previously introduced
keyword typedef . To motivate an example, let’s reconsider a student entity, which has
an ID (integer), first and last name (strings), and a GPA (a floating point number). Each
of these pieces of data can be encapsulated into a structure as follows.
1 typedef struct {
2 int id;
3 char *firstName;
4 char *lastName;
5 double gpa;
6 } Student;
Note the syntax and naming conventions:
1
You can define a structure with function pointers as elements, so structures could technically include
“methods” but this is not really what most people think of when considering object-oriented paradigms.
341
23. Structures
• The elements of the structure (also referred to as components or members) are
included inside curly brackets, delimited using semicolons (in contrast to an enu-
merated type which is a list, these elements do not constitute a list).
• A structure may contain any number of elements of any type.
• The name (identifier) of the structure is provided at the end, ended with a semicolon.
• We use a modern naming convention: each element is named using lower camel
casing while the name of the structure itself uses upper camel casing.
In addition, structure declarations are generally placed in a header file along with any
any function prototypes that use the structure as a parameter or a return type. Once
you have defined a structure you can use it as you would a built-in variable type. For
example,
Student s;
declares a Student structure with the variable name s .
23.1.1. Alternative Declarations
In some examples and code bases you may find an alternative way of declaring a structure
that looks like the following.
1 struct Student {
2 ...
3 };
This syntax omits the keyword typedef and places the structure name at the beginning.
The difference is a bit technical (the original syntax creates an anonymous structure with
the Student identifier placed in the global namespace, while this declaration places the
Student identifier in the structure namespace), but one of the consequences of using
this type of declaration is that the Student identifier is not in the global scope, so to
declare a variable of the type Student you need to further specify that it is a structure
using the following syntax.
struct Student s;
Further, you may also see another style,
342
23.1. Defining Structures
1 typedef struct Student {
2 ...
3 } Student;
Which places the Student identifier in both the global space and in the “structure”
space. Which style of declaration you use depends on several factors, but for simplicity
we’ll stick with the first style.
In addition, you may see some older naming conventions use lowercase underscore
naming for structure names. In particular, POSIX systems use names that end with
_t (indicating a structure type). You should avoid such naming conventions to avoid
conflicts.
Finally, though C does not provide a mechanism for the protection of data, many
libraries and code bases will begin certain member variables with underscore(s) to
indicate that they are “internal” variables used by the library and should not be accessed
or modified. For example, _someVariable or __anotherVariable would indicate
“private” variables that should not be tampered with. The C language itself would still
allow you access and modify the variables, but doing so may violate assumptions and
expectations of the library code, leading to undefined behavior.
23.1.2. Nested Structures
Consider adding another member variable to the Student structure to model a student’s
date of birth. How might we model a date? Unix systems model time as a single
integer value that represents the number of milliseconds that have passed since the
Unix epoch, January 1st, 1970 (also known as Coordinated Universal Time (UTC)).
For example, the New Horizons space probe was launched on January 19th, 2006 at
19:00:00 UTC. This corresponds to 1,137,697,200, roughly 1.137 billion milliseconds since
the epoch. Another way to model time is as a string. There are several standards for
time representations, but the most common is ISO standard 8601 [22] which specifies
time using a format that includes a date, time and an offset from Greenwich Mean
Time (GMT). For example, the New Horizons launch date/time would be represented as
"2006-01-19T19:00:00+00:00" .
To keep things simple, we’ll model our date using three numbers: a year, a month and
a date. But how should we implement this? Conceptually, a date is a single entity,
separating these three numbers doesn’t make much sense. This is a perfect opportunity
to define another structure.
343
23. Structures
1 typedef struct {
2 int id;
3 char *firstName;
4 char *lastName;
5 double gpa;
6 Date dateOfBirth;
7 } Student;
Code Sample 23.1.: A Student structure declaration
1 typedef struct {
2 int month;
3 int day;
4 int year;
5 } Date;
Once we have defined a structure we can use it as we would a normal variable, so it
makes sense that we could include it in another structure.
This is a good illustration of a form of composition where one structure may be composed
of other structures. Since the Student structure “owns” an instance of the Date
structure, it is necessary to ensure that the Date structure is declared before the
Student structure (just as we need to declare variables before we use them.
23.2. Usage
23.2.1. Declaration & Initialization
Once we have defined a structure (and included the header file it has been defined in),
we can create instances using the usual syntax.
1 Student s;
2 Student t;
344
23.2. Usage
These static declarations will allocate enough space on the stack to hold all of the data
associated with the structures (the two char * pointers, int , and double and the
three int variables in the Date structure). However, the values stored in each of the
structure’s member variables are undefined. With this style of declaration, C does not
define default values.
Another way to declare instances of our structures is to use the following syntax.
1 Student s = {};
2 Student t = {
3 12345678,
4 "Grace",
5 "Hopper",
6 4.0,
7 {
8 12,
9 9,
10 1906
11 }
12 };
The first declaration creates a Student structure with default values (zero for any
numeric types, null for any pointers). The second creates a Student structure
initialized with the values provided in the curly brackets. The order matters here and
will match the ordering of the original structure declaration. Since the dateOfBirth
is a structure itself, a nested set of values within curly brackets is necessary. One draw
back to this type of declaration is that the character pointers are statically declared. The
strings "Grace" and "Hopper" are initialized in a read-only segment of memory, any
attempts to change the contents of these strings are undefined behavior. The pointers
themselves, however, can be reassigned. The resulting structure is visualized in Figure
23.1.
This static declaration allocates the structure on the stack. Since structures consist of
multiple pieces of data, their memory footprint is larger. Allocating larger and larger
structures on the stack runs the risk of running out of stack memory resulting in a stack
overflow. To solve this, we can instead use dynamically allocated structures.
To dynamically allocate a structure, we use a pointer to a structure and a call to
malloc() to allocate enough space for the structure. Even though our structure is
user-defined, we can still use the sizeof() macro to determine the number of bytes
required by the structure. The compiler and macro are “smart” enough to look at the
structure declaration and determine the size of each of its variables and add up the total
345
23. Structures
Figure 23.1.: Visualization of an initialized Student structure. Visualization generated
by http://pythontutor.com
number of bytes required.
Student *s = (Student *) malloc(sizeof(Student) * 1);
The multiplication by 1 in this example is not strictly necessary, but emphasizes the fact
that we are allocating space for one structure and not an array of structures. Initializing
a dynamically allocated structure like this does not initialize any of its variables as
there are no default values defined by C. Moreover, it does not initialize memory for any
pointer member variables. For example the firstName and lastName pointers need
to be manually initialized with additional malloc() calls.
23.2.2. Selection Operators
Once we have a declared structure, we need to access its member variables and perhaps
update them. If we have a statically declared structure, such as
Student s;
we can use the direct component selector operator, which is simply just a period followed
by the member variable we wish to access. Commonly, this is referred to simply as the
dot operator.
1 Student s;
2
3 //set values:
346
23.2. Usage
4 s.id = 87654321;
5 s.gpa = 3.9;
6
7 //access values:
8 printf("Name: %s, %s\n", s.lastName, s.firstName);
9 printf("GPA: %.2f\n", s.gpa);
When structures are nested, we can use the dot operator multiple times to access members
variables of member variables.
1 s.dateOfBirth.year = 2525;
2 s.dateOfBirth.month = 12;
3 s.dateOfBirth.date = 25;
When we have a pointer to a structure, we cannot directly use the dot operator. Instead,
we have to change the pointer into a “normal” structure by dereferencing it, then we can
use the dot operator. However, the dot operator has a higher order of precedence than
the dereferencing operator, thus parentheses are required:
1 Student *s = ...;
2 (*s).id = 87654321;
This can be a bit unwieldy, so C provides a convenience operator, the indirect component
selector operator, or more commonly, the arrow operator that allows us to select a member
variable with a single operator that resembles a right-pointing arrow.
1 Student *s = (Student *) malloc(sizeof(Student));
2
3 //set values:
4 s->id = 87654321;
5 s->gpa = 3.9;
6
7 //initialize the string variables:
8 s->firstName = (char *) malloc(sizeof(char) * 6);
9 strcpy(s->firstName, "Grace");
347
23. Structures
10 s->lastName = (char *) malloc(sizeof(char) * 7);
11 strcpy(s->lastName, "Hopper");
12
13 //access values:
14 printf("Name: %s, %s\n", s->lastName, s->firstName);
15 printf("GPA: %.2f\n", s->gpa);
16
17 s->dateOfBirth.year = 2525;
Note the last line: the dateOfBirth member variable was another structure, but not a
pointer to a structure, so we use the dot operator to access the year member variable. Al-
ternatively, we could have defined dateOfBirth to be a pointer, Date *dateOfBirth;
in the Student structure. If we had, then to access the year member variable using
two arrow operators, s->dateOfBirth->year .
23.3. Arrays of Structures
Just as we can create arrays of built-in types such as integers, we can also create arrays of
our user-defined structures. As an example, the following creates an array of 10 Student
structures. Once created, we can treat them like any other array.
1 Student *roster = (Student *) malloc(sizeof(Student) * 10);
2
3 ...
4
5 double sum = 0.0;
6 for(i=0; i<10; i++) {
7 sum += roster[i].gpa;
8 }
9 double averageGpa = sum / 10;
As in the example, we can index each element in the array, roster . Once indexed, each
element is a regular structure and so we use the dot operator to access each of its member
variables. As with any other array, each element takes up a number of bytes, equal to
sizeof(Student) . We can swap and reassign each element just like any other variable.
For example, the following code swaps the first two elements using a temporary variable.
348
23.3. Arrays of Structures
1 Student temp = roster[0];
2 roster[0] = roster[1];
3 roster[1] = temp;
Each of these operations copies over every byte that makes up the structure. For small
structures, this isn’t that big of a deal. However, for larger structures, this may become
an issue, especially if we do this often or pass structures around to functions.
As an alternative, we could instead deal indirectly with structures by creating an array
of pointers to structures. Swapping elements then involves only copying pointer values
rather than every byte that makes up the structure. To do this, we use the familiar
pointer-to-pointer syntax.
1 Student **roster = (Student **) malloc(sizeof(Student *) * 10);
2 for(i=0; i<10; i++) {
3 roster[i] = (Student *) malloc(sizeof(Student) * 1);
4 }
5
6 //access each as pointers and use the arrow operator
7 roster[0]->id = 87654321;
8 roster[0]->gpa = 4.0;
9
10 //swap the first two *pointers*:
11 Student *temp = roster[0];
12 roster[0] = roster[1];
13 roster[1] = temp;
As in the example above, if each element in the array is a pointer to a structure, then we
use the arrow operator to access each member variable.
The differences between these two approaches is illustrated in Figures 23.2 and 23.3. As
presented, each Student structure takes 40 bytes.2 With the first approach (as in Figure
23.2, each structure instance is stored contiguously in memory. Swapping two records
involves copying entire blocks of 40 bytes. In contrast, using pointers to structures as in
Figure 23.3 means that structures may be stored non-contiguously in different memory
2
This is just an estimate and may vary on different systems and compilers. Usually, compilers use
alignment and may pad structures with extra bytes in order to make it more efficient to store in
memory.
349
23. Structures
Student *roster roster[0] 40 bytes
(Student)
roster[1] 40 bytes
(Student)
roster[2] 40 bytes
(Student)
..
.
roster[n-1] 40 bytes
(Student)
Figure 23.2.: An array of structures. Each record is stored in a contiguous manner one
after the other.
locations. Swapping two structures is done indirectly by swapping pointers (only 8 bytes).
The difference in this particular example is not that great (8 vs. 40 bytes), but with
larger structures it can become an issue. Each approach has its own advantages and
disadvantages and one may be more appropriate than the other in different situations.
Hybrid Approach
It is also possible to take a “hybrid” approach to storing structures in arrays that stores
them both contiguously, but also allows you to reference them indirectly through a pointer
array. This is essentially what we did in Section 20.4.1 when we created a contiguous
2-dimensional array of integers. We made a single call to malloc and then had to setup
the pointers to each “row.” To do this with structures, we can do something similar.
First, we declare and allocate a dynamic array as before.
1 int n = 10;
2 Student *rosterData = (Student *) malloc(n * sizeof(Student));
Then, we can declare an array of Student pointers as well.
1 Student **roster = (Student **) malloc(n * sizeof(Student *));
350
23.3. Arrays of Structures
Student
(40 bytes)
roster[0]
Student **roster
(Student*)
Student
roster[1]
(40 bytes)
(Student*)
roster[2]
(Student*)
.. Student
. (40 bytes)
roster[n-1]
(Student*)
Student
(40 bytes)
Figure 23.3.: An array of structure pointers. Each record is a pointer that refers to a
structure which may be stored non-contiguously in completely different
memory locations.
But now we need to make each roster[i] pointer point to the i-th record in rosterData .
Each record, rosterData[i] is a regular structure, but we need a pointer to it. In
order to get a pointer, we use the referencing operator, &rosterData[i] and make each
pointer point to it.
1 for(i=0; i<n; i++) {
2 roster[i] = &rosterData[i];
3 }
This approach is illustrated in Figure 23.4. Now we can indirectly reference each record
in rosterData via a pointer in the roster array.
1 roster[0]->nuid = 12345678;
If we wanted to “swap” two records, we simply swap their pointers instead of their data.
351
23. Structures
Student *rosterData
roster[0] 40 bytes
roster[0] (Student)
Student **roster
(Student*)
roster[1] roster[1] 40 bytes
(Student*) (Student)
roster[2]
(Student*) roster[2] 40 bytes
(Student)
..
.
..
roster[n-1] .
8 bytes
(Student*)
roster[n-1] 40 bytes
(Student)
Figure 23.4.: Hybrid Array of Structures. The rosterData is an array of contiguous
structures. The roster array is an array of pointers that refer to each
record. Accessing elements in rosterData is done indirectly through a
pointer in roster
Indeed, care must be taken not to swap the data in rosterData otherwise the pointers
would become invalid and out-of-synch with the data array.
23.4. Using Structures With Functions
As with built-in types, we can use structures as parameters to functions as well as the
return type of functions. Consider the following examples.
1 void foo(Student s);
2 Student bar();
In the first prototype, we would pass a Student structure by value to the function. As
we’ve already seen, this would mean that every byte of the structure would be copied
onto the stack. For larger structures, we risk a stack overflow while for even smaller
structures this can be very inefficient. Likewise, the second prototype would return a
structure. When assigned to a variable, every byte is copied. A better solution is to use
dynamically allocated structures, passing them by reference to functions, and returning
352
23.4. Using Structures With Functions
pointers to dynamically allocated instances as return types. For example, the functions
above would be better implemented as follows.
1 void foo(const Student *s);
2 Student * bar();
In the first example, we’ve used the const keyword which prevents any changes to
the structure’s values (we may omit this if we need to design a function that changes
its values). We will now consider several idiomatic examples of using structure with
functions.
23.4.1. Factory Functions
Properly creating and initializing structure instances can be a complex and tedious
task. However, it is likely that we will need to repeat this operation over and over. We
can simplify our task if we write a utility function that creates a structure instance
for us. We provide the function the values we want initialized to. Such functions are
sometimes referred to as factory functions as they can be used to manufacture as many
instances as we want (in object-oriented programming languages, such methods are called
constructors).
We will need to take care that we make deep copies of any dynamically allocated elements
such as strings. Shallow copies where references are shared may lead to unexpected
behavior as changes to one string may affect multiple structures.
1 /**
2 * This function creates a new student structure with the
3 * given values.
4 */
5 Student * createStudent(const char *firstName,
6 const char *lastName,
7 int id,
8 double gpa) {
9
10 Student *s = NULL;
11 s = (Student *) malloc(sizeof(Student) * 1);
12
13 //make a deep copy of the strings
14 s->firstName = (char *)malloc(sizeof(char)*(strlen(firstName)+1));
353
23. Structures
15 strcpy(s->firstName, firstName);
16 s->lastName = (char *)malloc(sizeof(char)*(strlen(lastName)+1));
17 strcpy(s->lastName, lastName);
18
19 s->id = id;
20 s->gpa = gpa;
21
22 return s;
23 }
Another common operation is to create a copy of a given structure. We will want to
again ensure that everything is a deep copy so that the two structures are not sharing
references. We can easily do this by reusing the functionality we just wrote in the factory
function.
1 /**
2 * This function creates a new, deep copy of a Student
3 * structure .
4 */
5 Student * copyStudent(const Student *s) {
6 return createStudent(s->firstName, s->lastName, s->id, s->gpa);
7 }
23.4.2. To String Functions
Another common operation with structures is to output their data as a human-readable
string representation. We could write a function that output a structure’s member
variables to the standard output using printf() . However, it would more useful if we
created a general function that returned a string representation of the structure. That
way, we could decide what to do with the string: output it to the standard output, to a
file, etc. Not all structure instances will require the same length string. Some students
for example may have long names, while others have short. We can handle this by first
calculating the length of the string necessary for whatever formatting we’ve chosen.
1 /**
2 * Returns a string representation of the given
354
23.4. Using Structures With Functions
3 * Student structure.
4 */
5 char * studentToString(const Student *s) {
6
7 int n = strlen(s->firstName) +
8 strlen(s->lastName) +
9 8 + //id, assumed to always be at most 8 digits
10 4 + //gpa, assumed to be 0.0 - 4.0
11 19; //other formatting characters
12
13 char *str = (char *) malloc(sizeof(char) * n);
14
15 sprintf(str, "%s, %s, ID = %d (GPA = %.2f)",
16 s->lastName, s->firstName, s->id, s->gpa);
17
18 return str;
19 }
Here, we’ve utilized a variation on the familiar printf() function, sprintf() which
“prints” the result not to the standard output or a file, but to a string, specified as the
first argument. This function would end up returning a string similar to the following for
our previous example: "Hopper, Grace, ID = 87654321 (GPA = 3.90)"
23.4.3. Passing Arrays of Structures
We often also have need to pass arrays of structures to functions. As an example, consider
passing an entire roster of students to a function in order to compute the average GPA.
If we have an array of structures, we would have a function that looked something like
the following.
1 /**
2 * Computes the average GPA of the Student structures in
3 * the given roster (which is of size n).
4 */
5 double computeAverageGpa(const Student *roster, int n) {
6 double sum = 0.0;
7 int i;
8 for(i=0; i<n; i++) {
9 sum += roster[i].gpa;
355
23. Structures
10 }
11 return sum / n;
12 }
When we pass in the array of structures, it is not passed by value. That is, the total
number of bytes for each student is not copied onto the call stack. Nevertheless, as we’ve
previously seen it is sometimes preferable to maintain an array of pointers to structures.
If we had an array of pointers, we would have a function that looks something like the
following.
1 /**
2 * Computes the average GPA of the Student structures in
3 * the given roster (which is of size n).
4 */
5 double computeAverageGpa(const Student **roster, int n) {
6 double sum = 0.0;
7 int i;
8 for(i=0; i<n; i++) {
9 sum += roster[i]->gpa;
10 }
11 return sum / n;
12 }
The only difference here is in how we access the gpa member variable using the arrow
operator instead of the dot operator.
356
24. Recursion
C supports recursion with no special syntax necessary. However, as a structured,
procedural language, recursion is generally expensive and iterative or other non-recursive
solutions are generally preferred. We present a few examples to demonstrate how to
write recursive functions in C.
The first example of a recursive function we gave was the toy count down example. In C
it could be implemented as follows.
1 void countDown(int n) {
2 if(n==0) {
3 printf("Happy New Year!\n");
4 } else {
5 printf("%d\n", n);
6 countDown(n-1);
7 }
8 }
As another example that actually does something useful, consider the following recursive
summation function that takes an array, its size and an index variable. The recursion
works as follows: if the index variable has reached the size of the array, it stops and returns
zero (the base case). Otherwise, it makes a recursive call to recSum() , incrementing
the index variable by 1. When the function returns, it adds its result to the i-th element
in the array. To invoke this function we would call it with an initial value of 0 for the
index variable: recSum(arr, n, 0) .
1 int recSum(const int *arr, int size, int i) {
2 if(i == size) {
3 return 0;
4 } else {
5 return recSum(arr, size, i+1) + arr[i];
6 }
7 }
357
24. Recursion
This example was not tail-recursive as the recursive call was not the final operation (the
sum was the final operation). To make this function tail recursive, we can carry the
summation through to each function call ensuring that the summation is done prior to
the recursive function call.
1 int recSumTail(const int *arr, int size, int i, int sum) {
2 if(i == size) {
3 return sum;
4 } else {
5 return recSumTail(arr, size, i+1, sum + arr[i]);
6 }
7 }
As a final example, consider the following C implementation of the naive recursive
Fibonacci sequence. An additional condition has been included to check for “invalid”
negative values of n for which zero is returned.
1 int fibonacci(int n) {
2 if(n < 0) {
3 return 0;
4 } else if(n <= 1) {
5 return 1;
6 } else {
7 return fibonacci(n-1) + fibonacci(n-2);
8 }
9 }
C is not a language that provides implicit memoization. Instead, we need to explicitly
keep track of values using a table. In the following example, the table is passed to the
function as an argument.
1 int fibonacciMemoization(int n, int *table) {
2 if(n < 0) {
3 return 0;
4 } else if(n <= 1) {
5 return 1;
358
6 } else if(table[n] > 0) {
7 return table[n];
8 } else {
9 int a = fibonacciMemoization(n-1, table);
10 int b = fibonacciMemoization(n-2, table);
11 int result = (a + b);
12 table[n] = result;
13 return result;
14 }
15 }
It is the responsibility of the calling function to ensure that the table array is large
enough to accommodate all values. In this case should be at least of size (n + 1) to
compute the n-th Fibonacci number.
359
25. Searching & Sorting
The standard C library provides several functions to search and sort arrays of any type of
element including int , double , or even user-defined structures such as our Student
example from Chapter 23. These functions are able to operate on any type of array
because they take generic void * pointers. However, these functions still need a way to
order the generic elements. To understand how this all works we need to understand
both comparator functions and function pointers.
25.1. Comparator Functions
Let’s consider a “generic” Quick Sort algorithm as was presented in Algorithm 12.6. The
algorithm itself specifies how to sort elements, but it doesn’t specify how they are ordered.
The difference is subtle but important. Essentially, Quick Sort needs to know when two
elements, a, b are in order, out of order, or equivalent in order to decide which partition
each element goes in. However, it doesn’t “know” anything about the elements a and b
themselves. They could be numbers, they could be strings, they could be user-defined
objects.
A sorting algorithm still needs to be able to determine the proper ordering in order to sort.
In C this is achieved through a comparator function, which is a function that is responsible
for comparing two elements and determining their proper order. A comparator function
has the following signature and behavior:
int cmp(const void *a, const void *b);
• The function takes two generic void * pointers which refer to the elements being
compared.
• Moreover, the const keyword is used to indicate that no changes will be made to
the elements.
• The function returns an integer indicating the relative ordering of the two elements:
– It returns something negative, < 0 if a comes before b (that is, a < b)
– It returns zero if a and b are equal (a = b)
361
25. Searching & Sorting
– It returns something positive, > 0 if a comes after b (that is, a > b)
Note that there is no guarantee on the value’s magnitude, it does not necessarily return −1
or +1; it just returns something negative or positive. We’ve previously seen this pattern
when comparing strings. The standard string library provides a function, strcmp()
that has the same basic contract: it takes two strings and returns something negative,
zero or something positive depending on the lexicographic ordering of the two strings.
Strictly speaking, however, strcmp() is not a comparator function. It is defined to take
two const char * parameters, not const void * pointers.
The C language (and thus the compiler) “knows” how to compare built-in primitive types
like int and double using the built-in comparison operators. However, to generalize
the comparison operation, we use void * pointers so that we can write and use general
comparator functions that can be used in generic searching and sorting functions. As an
example, let’s write a comparator function that orders integers in ascending order. We’ll
call our function cmpInt() and use the signature above.
1 int cmpInt(const void *a, const void *b) {
2
3 }
But how might we implement this function? Obviously we want to compare the values
stored in the pointer variables, so we need to dereference them. However, the comparison,
(*a < *b) for example is not comparing integer values. The variables a and b are
void pointers, not int pointers. In general, you cannot dereference a void pointer.
Dereferencing an int * or double * is possible because the compiler knows how many
bytes each type takes. However, the number of bytes a void type takes is undefined.
Thus, the first step is to make them int pointers by doing an explicit type cast:
1 const int *x = (const int *) a;
2 const int *y = (const int *) b;
Now the variables x and y are int pointers which can be dereferenced and compared
(we preserve the keyword const to ensure we do not make changes to the variables).
1 int cmpInt(const void *a, const void *b) {
2 const int *x = (const int *) a;
3 const int *y = (const int *) b;
362
25.1. Comparator Functions
4 if(*x < *y) {
5 return -1;
6 } else if(*x == *y) {
7 return 0;
8 } else {
9 return 1;
10 }
11 }
What if we wanted to order integers in the opposite order? We could write another
comparator in which the comparisons or values are reversed. Even simpler, we could
reuse the comparator above and “flip” the sign by multiplying by −1 (the purpose of
writing functions is code reuse, after all). Even simpler, we could flip the arguments we
pass to cmpInt() to reverse the order.
1 int cmpIntDesc(const void *a, const void *b) {
2 return cmpInt(b, a);
3 }
The examples above illustrate the standard implementation pattern of comparator
functions:
1. Make the general const void * pointers into a const pointer to the specific
type you want to compare by making an explicit type cast.
2. Use the state of the type (one or more components if you are comparing structures)
to determine their order.
3. Return an integer that expresses the desired order of elements.
The cautious observer may be asking: what happens if I call a comparator and pass it
pointers to mismatched elements? For example, what if I pass two double pointers to
cmpInt() ? Obviously, the code will not work as intended (it will end up comparing the
upper 32 bits of the double values, which leads to unintended behavior). A comparator
function is designed with certain expectations. Namely, that a user will always pass it
valid pointers to int values. If a user violates these expectations, it is their fault, not
ours. This is no different from many other functions in the standard library. Passing
non-null terminated strings to most string functions for example is undefined behavior.
To illustrate some more examples, consider the Student structure we defined in Code
363
25. Searching & Sorting
Sample 23.1. The following code samples demonstrate various ways of ordering Student
structures based on one or more of their components.
1 /**
2 * A comparator function to order Student structures by
3 * last name/first name in alphabetic order
4 */
5 int studentByNameCmp(const void *s1, const void *s2) {
6 const Student *a = (const Student *)s1;
7 const Student *b = (const Student *)s2;
8 int result = strcmp(a->lastName, b->lastName);
9 if(result == 0) {
10 return strcmp(a->firstName, b->firstName);
11 } else {
12 return result;
13 }
14 }
1 /**
2 * A comparator function to order Student structures by
3 * last name/first name in reverse alphabetic order
4 */
5 int studentByNameCmpDesc(const void *s1, const void *s2) {
6 return studentByNameCmp(s2, s1);
7 }
1 /**
2 * A comparator function to order Student structures by
3 * id in ascending numerical order
4 */
5 int studentIdCmp(const void *s1, const void *s2) {
6 const Student *a = (const Student *)s1;
7 const Student *b = (const Student *)s2;
8 if(a->nuid < b->nuid) {
9 return -1;
10 } else if(a->nuid == b->nuid) {
11 return 0;
364
25.2. Function Pointers
12 } else {
13 return 1;
14 }
15 }
1 /**
2 * A comparator function to order Student structures by
3 * GPA in descending order
4 */
5 int studentGpaCmp(const void *s1, const void *s2) {
6 const Student *a = (const Student *)s1;
7 const Student *b = (const Student *)s2;
8 if(a->gpa > b->gpa) {
9 return -1;
10 } else if(a->gpa == b->gpa) {
11 return 0;
12 } else {
13 return 1;
14 }
15 }
25.2. Function Pointers
Now that we have comparator functions to order elements, we need a way of passing a
comparator to a generic search or sort function so that it can be used by that function.
To achieve this in C, we use function pointers.
Recall that a pointer is simply a reference to some memory location. As we’ve already
seen, pointers can point to variables of simple data types such as int or double ,
arrays of these types or even user-defined structures. We’ve also seen that pointers can
be generic using the void keyword. The malloc() function for example, returned a
generic void pointer, void * , to allow it to be used to allocate memory for any type.
Generic void pointers simply point to the start of a memory block, not necessarily to
a memory location of any particular type of variable. As we’ve also already seen, the
program code itself lives in memory (the stack). It thus makes sense that we could
365
25. Searching & Sorting
reference a memory location that, instead of containing variables, contains executable
code, in particular a function. This is what a function pointer does: it points to a memory
location where the code for the function is stored.
To declare a function pointer, we need to specify more information than a typical int *
or double * pointer. Since it points to a function, we need to specify the function’s
signature: its return type and parameter list. Consider the following example:
int (*ptrToFunc)(int, double, char) = NULL;
In this declaration, we’ve created a function pointer named ptrToFunc . This pointer
is capable of pointing to any function whose return type is int (indicated by the first
keyword) and which takes three parameters: an int , a double and a char . The
assignment operation has initialized this pointer to NULL .
Consider another example: let’s declare a function pointer that is capable of pointing to
the math library’s sqrt() function. The sqrt() function returns a double and takes
a single double parameter. Adapting the syntax above, we would create this pointer as
follows.
double (*ptrToSqrt)(double) = NULL;
Again, we have initialized it to NULL ; it does not yet reference the sqrt() function.
To make it reference this function, we need to assign it a value. Recall that to get the
memory location of a regular variable, say int x; , we use the referencing operator, &x .
Similarly, with functions we can use the referencing function, in this case &sqrt to get
the memory address of the sqrt() function, however this is not necessary. Similar to
arrays, the identifier (name) of a function serves as its memory address! The identifier
sqrt itself is the memory location of the function. Thus to assign ptrToSqrt to point
to sqrt() , we simply need to do the following:
ptrToSqrt = sqrt;
Note the difference: usually we invoke sqrt() by writing parentheses and providing an
argument. When referencing the function itself, we omit the parentheses. Additional
examples of this syntax can be found in Code Sample 25.1.
Callbacks
The main use for function pointers is so that references to functions can be passed
as parameters to other functions. The passed function is known as a callback. This
gives us the ability to write a more abstract and generic function. For example, in GUI
programming, we frequently need to associate a particular function with a particular
366
25.2. Function Pointers
event. Suppose we create a button; we need to be able to specify what happens when
that button gets clicked. We do so by providing a function as a callback to a registration
function that associates the “click” event with the provided function. Thus, whenever a
user clicks the button, the callback is invoked (“called back”).
Let’s illustrate some syntax usage with another example. Suppose we want to create a
getMax() function. We could write one function for arrays of integers, another for arrays
of double s, another for Student arrays that gets the student with the maximum GPA,
then another for the ID, then another for the name and so on. Or, we could program
a generic getMax() function that could be used for any type by taking a comparator
function as a callback. To illustrate, consider the following non-generic function for
integers.
1 int getMax(const int *arr, int n) {
2 int i, maxIndex = 0;
3 for(i=1; i<n; i++) {
4 if(arr[maxIndex} < arr[i] {
5 //we've found something larger, update the maxIndex:
6 maxIndex = i;
7 }
8 }
9 return maxIndex;
10 }
This simple function iterates through the array, keeping track of the maximum value
found “so far” and updating it when it finds something larger. Because we’ve specified
that arr is an array if int values, we can use the less-than comparison operator (line
4). Now let’s make it more generic: rather than taking an array of int values, it will
now take a generic void array. Further, we will pass a function pointer to this function
that references a generic comparator function that can be used to replace the less-than
comparison operator.
1 int getMax(const void *arr, int n,
2 int(*cmp)(const void *, const void *)) {
3 int i, maxIndex = 0;
4 for(i=1; i<n; i++) {
5 ...
6 }
7 return maxIndex;
8 }
367
25. Searching & Sorting
There are a couple of issues here that we have to deal with. When working with generic
void * pointers in C and using arrays, you cannot simply index using the usual 0, 1,
2, etc. indices. Recall that when elements are stored in an array, the index represents
an offset of a memory address. If the array is an array of integers or double or some
other built-in type, the compiler knows how large each one is and is able to compute the
appropriate offset given the usual 0, 1, 2, etc. indices.
However, when dealing with void * elements, a function must be told how many bytes
each element takes. C uses an unsigned integer type, size_t to indicate a size in bytes,
so we’ll use it as well. We modify the function signature above to pass in a size_t size
parameter.
We now need a way to access each element in the array. The array itself is generic. We
cannot simply use indices such as arr[i] to access elements. Since it is a void *
pointer, we cannot simply dereference it using an index. The compiler doesn’t know how
many bytes each element takes, so it cannot compute an offset using the index variable
i . Instead, we need to do the pointer arithmetic ourselves.
We could use the size parameter, say arr[i*size] to compute the offset of the i-th
element, but this still dereferences a void pointer, which we generally do not want to
do. Instead, we can use the pointer arr and do some simple arithmetic; arr is the
starting memory location, so if we simply add i*size to it, that gives us the memory
location of the i-th element as a void pointer !
1 void *first = arr + 0 * size; //first element
2 void *second = arr + 1 * size; //second element
3 void *third = arr + 2 * size; //third element
4 ...
5 void *x = arr + i * size; //i-th element
We can use this in our getMax() function to iterate over each element in the array
and pass it to our comparator. The comparator expects generic void pointers, and that
is what our pointer arithmetic is computing. Passing two memory addresses to the
comparator determines which is the larger of two elements in the array. To do this, we
call the comparator on the maximum element we’ve found so far and the i-th element
in the loop. If it returns something negative, then we know that the “max” element is
less than the i-th element and so update our maxIndex variable. Making these changes
results in the this final version.
368
25.2. Function Pointers
1 int getMax(const void *arr, int n, size_t size,
2 int(*cmp)(const void *, const void *)) {
3 int i, maxIndex = 0;
4 for(i=1; i<n; i++) {
5 if(cmp(arr + maxIndex * size, arr + i * size) < 0) {
6 //we've found something larger, update the max_index:
7 maxIndex = i;
8 }
9 }
10 return maxIndex;
11 }
Suppose we have an array of integers and the cmpInt() comparator function above.
We can use our getMax() function as follows.
1 int arr[] = {8, 2, 9, 10, 4, 2, 2, 5, 6, 7};
2 int maxIndex = getMax(arr, 10, sizeof(int), cmpInt);
3 printf("maximum value: %d\n", arr[maxIndex]);
In this example, the getMax() function would return the index 3 and print the maximum
value stored there, 10. The getMax() function returns the index corresponding to
the “maximum” element according to the comparator used. If instead we had used
cmpIntDesc() the “maximum” element would have been the least element, (2 in the
example above) because it would have been the element ordered “last” by the descending
comparator.
Consider another example with our Student structure.
1 int n = 10;
2 Student *roster = (Student *) malloc(sizeof(Student) * n);
3 ...
4 int maxIndex = getMax(roster, n, sizeof(Student), studentByNameCmp);
Since studentByNameCmp() orders by lexicographic ordering, a student with the last
name “Zadora” would have been “larger” than someone with a last name “Anderson.”
369
25. Searching & Sorting
Thus the code above will return an index corresponding to the last student in lexicographic
ordering of their name. Similarly, if we had used the studentGpaCmp() comparator
instead, getMax() would have returned an index for the student with the lowest GPA
as this comparator ordered highest to lowest.
Another variation on this function would be to return a pointer to the maximum element
rather than an index. The same logic would have applied, but the return type would be
a void * pointer and the return statement would return the memory address of the
maximum element instead. To avoid warnings, in the final return statement we cast arr
as a void pointer (instead of a const void pointer) to make the return value compatible
with the return type.
1 void * getMax(const void *arr, int n, size_t size,
2 int(*cmp)(const void *, const void *)) {
3 int i, maxIndex = 0;
4 for(i=1; i<n; i++) {
5 if(cmp(arr + maxIndex * size, arr + i * size) < 0) {
6 //we've found something larger, update the max_index:
7 maxIndex = i;
8 }
9 }
10 return (void *)arr + maxIndex * size;
11 }
370
25.2. Function Pointers
1 #include <stdio.h>
2 #include <stdlib.h>
3
4 int function01(int a, double b);
5 void function02(double x, char y);
6
7 void runAFunction(int (*theFunc)(int, double));
8
9 int main(int argc, char **arg) {
10
11 int i = 5;
12 double d = 3.14;
13 char c = 'Q';
14
15 //calling a function normally...
16 int j = function01(i, d);
17 function02(d, c);
18
19 //function pointer declaration
20 int (*pt2Func01)(int, double) = NULL;
21 void (*pt2Func02)(double, char) = NULL;
22
23 //assignment
24 pt2Func01 = function01;
25 //or:
26 pt2Func01 = &function01;
27 pt2Func02 = &function02;
28
29 //you can invoke a function using a pointer to it:
30 j = pt2Func01(i, d);
31 pt2Func02(d, c);
32
33 //alternatively, you can invoke a function by dereferencing it:
34 j = (*pt2Func01)(i, d);
35 (*pt2Func02)(d, c);
36
37 //With function pointers, you can now pass entire functions as arguments to another function!
38 printf("Calling runAFunction...\n");
39 runAFunction(pt2Func01);
40 //we should not pass in the second pointer as it would not match the signature:
41 //syntactically okay, compiler warning, undefined behavior
42 //runAFunction(pt2Func02);
43 }
44
45 void runAFunction(int (*theFunc)(int, double)) {
46
47 printf("calling within runAfunction...\n");
48 int result = theFunc(20, .5);
49 printf("the result was %d\n", result);
50
51 return;
52 }
53
54 int function01(int a, double b) {
55 printf("You called function01 on a = %d, b = %f\n", a, b);
56 return a + 10;
57 }
58
59 void function02(double x, char y) {
60
61 printf("You called function02 on x = %f, y = %c\n", x, y);
62
63 }
Code Sample 25.1.: C Function Pointer Syntax Examples
371
25. Searching & Sorting
25.3. Searching & Sorting
We now turn our attention to the search and sorting functions provided by the standard
library. Each function is a generic implementation that takes advantage of function
pointers and comparator functions.
25.3.1. Searching
Linear Search
The C search library, search.h provides a linear search function to search arrays, named
lfind() (linear find). This function does not require that the array be sorted and
performs a linear search algorithm, returning a pointer to the first element such that
the comparator returns 0 (indicating equality). The full signature of the function is as
follows.
1 void *lfind(const void *key,
2 const void *base,
3 size_t *nmemb,
4 size_t size,
5 int(*compar)(const void *, const void *));
Each argument represents:
• key – a “dummy” structure instance matching the element you are searching for.
For example, if you are searching for a Student with the last name "Smith"
then you can construct an instance with the same last name, ignoring the value of
all other components.
• base – a pointer to the array to be searched
• nmemb – the size of the array (number of “members”)
• size – the size, in bytes, of each element in the array (generally you use use
sizeof() to determine this)
• compar – a pointer to a comparator function to use in the search.
As with our getMax() example, lfind() returns a pointer to the element it finds. If
no such element is found, this function will return NULL .
372
25.3. Searching & Sorting
In the same library, there is another linear search function:
1 void *lsearch(const void *key,
2 void *base,
3 size_t *nmemb,
4 size_t size,
5 int(*compar)(const void *, const void *));
It differs in that if it does not find a matching element, it still returns NULL but also
attempts to insert the element being searched for at the end of the array. The function
will assume there is enough room at the end of the array to accommodate the inserted
element (if not, the behavior is undefined). This behavior is hinted at by the fact that
base is not const . Moreover, nmemb is passed by reference. If the function inserts
the element, it will also increment nmemb variable to reflect this new element. It is your
responsibility to ensure that there is enough valid memory to accommodate any inserts
when using lsearch() .
Binary Search
In the standard library ( stdlib.h ) there is an additional binary search function that
can be used to more efficiently search a sorted array. The prototype:
1 void *bsearch(const void *key,
2 const void *base,
3 size_t nmemb,
4 size_t size,
5 int (*compar)(const void *, const void *));
All parameters are exactly as with lfind() as is the behavior: it returns a pointer to
the first element that it finds (though first does not necessarily mean the first in the order
of the array) and NULL if no matching element is found. It is an essential requirement
that the array be sorted with the same comparator as was used to sort the array or NULL
may be returned erroneously.
373
25. Searching & Sorting
25.3.2. Sorting
The standard library also provides a generic sorting function, qsort() . Though the
name suggests a Quick Sort implementation, it does not necessarily have to be (it was
when the function was originally designed). Modern implementations of qsort() may
implement alternatives such as Merge Sort or non-recursive hybrid Quick Sort algorithms.
The prototype and parameters are similar to the search functions but do not include
a key. The array is also not const indicating that it will be changed (which is the
whole point of calling the function). The function will sort elements in ascending order
according to the provided comparator function.
1 void qsort(void *base,
2 size_t nmemb,
3 size_t size,
4 int(*compar)(const void *, const void *))
• base – pointer an array of elements
• nmemb – the size of the array (number of members)
• size – the size (in bytes) of each element (use sizeof() )
• compar – a comparator function used to order elements
The advantages to using qsort() (as well as lfind() and bsearch() ) should be
clear. There is no need to write a new function that reimplements the same algorithm for
every possible ordering of every possible user-defined structure. We need only to create a
comparator function and pass it to qsort() . There is less code, and less chance of bugs.
The qsort() function is well-designed, optimized, and most importantly well-tested
and proven.
These functions represent a sort of “weak” form of polymorphic behavior found in
more modern object-oriented programming languages and other languages that support
“generic programming.” Polymorphism is the characteristic that the same code can be
executed on different types, greatly reducing the need for duplicate code.
25.3.3. Examples
We illustrate the usage of these functions in Code Samples 25.2 and 25.3.
374
25.3. Searching & Sorting
1 #include <stdio.h>
2 #include <stdlib.h>
3 #include <search.h>
4
5 #include "student.h"
6
7 int main(int argc, char **argv) {
8
9 int n = 0;
10 Student *roster = loadStudents("student.data", &n);
11 int i;
12 size_t numElems = n;
13
14
15 printf("Roster: \n");
16 printStudents(roster, n);
17
18 /* Searching */
19 Student *castro = NULL;
20 Student *castroKey = NULL;
21 Student *sandberg = NULL;
22 char *str = NULL;
23
24 castro = linearSearchStudentByNuid(roster, 10, 131313);
25 str = studentToString(castro);
26 printf("castro: %s\n", str);
27 free(str);
28
29 //create a key that will match according to the NUID
30 int nuid = 23232323;
31 Student * key = createEmptyStudent();
32 key->nuid = nuid;
33
34 //use lfind to find the first such instance:
35 //sandberg =
36 sandberg = lfind(key, roster, &numElems, sizeof(Student), studentIdCmp);
37 str = studentToString(sandberg);
38 printf("sandberg: %s\n", str);
39 free(str);
40
41 //create a key with only the necessary fields
42 castroKey = createStudent("Starlin", "Castro", 0, 0.0);
43 //sort according to a comparator function
44 qsort(roster, n, sizeof(Student), studentLastNameCmp);
45
46 castro = bsearch(castroKey, roster, n, sizeof(Student), studentLastNameCmp);
47 str = studentToString(castro);
48 printf("castro (via binary search): %s\n", str);
49 free(str);
50
51 //create a key with only the necessary fields
52 castroKey = createStudent(NULL, NULL, 131313, 0.0);
53 //sort according to a comparator function
54 qsort(roster, n, sizeof(Student), studentIdCmp);
55
56 castro = bsearch(castroKey, roster, n, sizeof(Student), studentIdCmp);
57 str = studentToString(castro);
58 printf("castro (via binary search): %s\n", str);
59 free(str);
60
61 return 0;
62 }
.
Code Sample 25.2.: C Search Examples
375
25. Searching & Sorting
1 #include <stdio.h>
2 #include <stdlib.h>
3
4 #include "student.h"
5
6
7 int main(int argc, char **argv) {
8
9 int n = 0;
10 Student *roster = loadStudents("student.data", &n);
11 int i;
12 size_t numElems = n;
13
14 printf("Roster: \n");
15 printStudents(roster, n);
16
17 printf("\n\n\nSorted by last name/first name: \n");
18 qsort(roster, numElems, sizeof(Student), studentLastNameCmp);
19 printStudents(roster, n);
20
21 printf("\n\n\nSorted by ID: \n");
22 qsort(roster, numElems, sizeof(Student), studentIdCmp);
23 printStudents(roster, n);
24
25 printf("\n\n\nSorted by ID, descending: \n");
26 qsort(roster, numElems, sizeof(Student), studentIdCmpDesc);
27 printStudents(roster, n);
28
29 printf("\n\n\nSorted by GPA: \n");
30 qsort(roster, numElems, sizeof(Student), studentGPACmp);
31 printStudents(roster, n);
32
33 return 0;
34 }
.
Code Sample 25.3.: C Sort Examples
376
25.4. Other Considerations
25.4. Other Considerations
25.4.1. Sorting Pointers to Elements
Recall that it is sometimes preferable to maintain an array of pointers to structures
rather than an array of structures. Sorting is a scenario where this is particularly true.
When sorting an array of structure elements, the entire structure is copied back and forth
as elements are swapped. Depending on the number of bytes of a structure, this can be
quite expensive. It is generally more efficient to sort an array of pointers to structures
instead. A prime example of this is sorting an array of strings.
An array of strings can be thought of as a 2-dimensional array of char s. Specifically,
an array of strings is a char ** type. That is, an array of pointers to pointers of
char s. We may be tempted to use strcmp() in the standard string library, passing it
to qsort() . Unfortunately this will not work. qsort() requires two const void *
types, while strcmp() takes two const char * types. This difference is subtle but
important.1 The recommended way of doing this is to define a different comparator
function as in Code Sample 25.4.
1 /* compare strings via pointers */
2 int pstrcmp(const void *p1, const void *p2)
3 {
4 return strcmp(*(char * const *)p1, *(char * const *)p2);
5 }
Code Sample 25.4.: C Comparator Function for Strings
Observe the behavior of this function: it uses the standard strcmp() function, but
makes the proper explicit type casting before doing so. The *(char * const *) casts
the generic void pointers as pointers to strings (or pointers to pointers to characters),
then dereferences it to be compatible with strcmp() .
Another case is when we wish to sort user-defined structures. The Student structure
presented earlier is “small” in that it only has a few fields. When structures are stored
in an array and sorted, there may be many swaps of individual elements which involves
a lot of memory copying. If the structures are small this is not too bad, but for “larger”
structures this could be potentially expensive. Instead, it may be preferred to have
an array of pointers to structures. Swapping elements involves only swapping pointers
1
A full discussion can be found on the c-faq, http://c-faq.com/lib/qsort1.html.
377
25. Searching & Sorting
instead of the entire structure. This is far cheaper as a memory address is likely to be
far smaller than the actual structure it points to. This is essentially equivalent to the
string scenario: we have an array of pointers to be sorted, our comparator function then
needs to deal with pointers to pointers.2 An example appears in Code Sample 25.5.
1 /**
2 * Orders two Student pointers according to the last name/first name
3 */
4 int studentPtrLastNameCmp(const void *s1, const void *s2) {
5 //we receive a pointer to an individual element in the array
6 //but individual elements are POINTERS to students thus we cast
7 //them as (const Student **) then dereference to get a pointer
8 //to a Student!
9 const Student *a = *(const Student **)s1;
10 const Student *b = *(const Student **)s2;
11 int result = strcmp(a->lastName, b->lastName);
12 if(result == 0) {
13 return strcmp(a->firstName, b->firstName);
14 } else {
15 return result;
16 }
17 }
18
19
20
21 Student **roster = (Student **) malloc(sizeof(Student *) * n);
22 ...
23 qsort(roster, n, sizeof(Student *), studentPtrLastNameCmp);
Code Sample 25.5.: Sorting Structures via Pointers
25.4.2. Dealing With NULL Elements
Another issue when sorting arrays of pointers is that we may now have to deal with NULL
elements. When sorting arrays of elements this is not an issue as a properly initialized
array will contain non-null elements (though elements could still be uninitialized, the
memory space will be valid).
2
Again, a full discussion can be found on c-faq, http://c-faq.com/lib/qsort2.html.
378
25.4. Other Considerations
names names[0]
(char **) "Chris"
(char *)
names[1]
"Margaret"
(char *)
names[2]
"Alan"
(char *)
names[3]
"Grace"
(char *)
names[4]
"Zeppo"
(char *)
A
pass-by-reference
qsort()
&names[1] &names[3]
(char **) (char **)
B
const void * const void *
cmp(const void *a, const void *b)
(*(const char **)a) C
const void * C.1
const char ** C.2
char * C.3
strcmp()
Figure 25.1.: Sorting an Array of Strings. An array of strings is passed to qsort . When
qsort needs to order two strings, it passes it off to the provided comparator,
but does so by passing them by reference (A) meaning that pointers to the
pointers are passed to the comparator function ( char ** ). However, the
comparator receives (B) two generic void pointers because of its signature
(the pointers are automatically and safely upcasted). Inside the comparator
function, the passed pointers are casted (C). Starting off as generic void
pointers (C.1) they are casted as character pointer-pointers (C.2) which
refer to the pointers in the array ( names[1] ). However, strcmp requires
pointers to character arrays, so we dereference (C.3) which now pointers to
the actual string ( "Margaret" ). Casting of b is similar. 379
25. Searching & Sorting
How we handle NULL pointers is more of a design decision. We could ignore it and any
attempt to access a NULL structure will result in undefined behavior (or segmentation
faults, etc.). Or we could give NULL values an explicit ordering with respect to other
elements. That is, we could order all NULL pointers before non- NULL elements (and
consider all NULL pointers to be equal). An example with respect to our Student
structure is given in Code Snippet 25.6.
1 int studentPtrLastNameCmpWithNulls(const void *s1, const void *s2) {
2 const Student *a = *(const Student **)s1;
3 const Student *b = *(const Student **)s2;
4 if(a == NULL && b == NULL) {
5 return 0;
6 } else if(a == NULL && b != NULL) {
7 return -1;
8 } else if (a != NULL && b == NULL) {
9 return 1;
10 }
11 int result = strcmp(a->lastName, b->lastName);
12 if(result == 0) {
13 return strcmp(a->firstName, b->firstName);
14 } else {
15 return result;
16 }
17 }
Code Sample 25.6.: Handling Null Values
380
Part II.
The Java Programming Language
381
26. Basics
The Java programming language was developed in the early 1990s at Sun Microsystems
by James Gosling, Mike Sheridan, and Patrick Naughton. Its original intention was
to enable cable box sets to be more interactive. By the mid-90s, Java was retargeted
toward the WWW. The first public release came on May 23, 1995 with the first Java
Development Kit (JDK), Java 1.0 on January 23rd, 1996. A new, updated release has
come about every other year. As of 2014, Java 8 is the current stable version.
Today, Java is one of the most popular programming languages, consistently ranked
as one of the top 2 languages (see http://www.tiobe.com). It is now owned and
maintained by Oracle, but there are many open source tools, compilers and runtime
environments available. Java is used in everything from mobile devices (Android) and
desktop applications to enterprise application servers.
From its inception, Java was designed with 5 basic principles:
1. Simple, Object-oriented, familiar
2. Robust and secure
3. Architecture-neutral and portable
4. High performance
5. Interpreted, threaded and dynamic
Java offers many key features that have made it popular. It is unique in that it is
not entirely compiled nor interpreted. Instead, Java source code is compiled into an
intermediate form, called Java bytecode. This bytecode is not directly runnable on
a processor. Instead, a JVM, an application that was written and compiled for a
particular system, interprets the bytecode and runs the application. This added layer
of abstraction means that Java source code can be written once (and compiled once)
and then run anywhere on any device that has a JVM. The added layer of abstraction
makes development easier, but comes at a cost in performance. However, the most recent
JVMs have offered performance that is comparable to native machine code in many
applications.
Another key feature is that Java has its own automated garbage collection. Some
languages require manual memory management, meaning that requesting, managing,
383
26. Basics
1 package unl.cse; //package declaration
2
3 //imports would go here
4
5 /**
6 * A basic hello world program in Java
7 */
8 public class HelloWorld {
9
10 //static main method
11 public static void main(String args[]) {
12 System.out.println("Hello World!");
13 }
14
15 }
Code Sample 26.1.: Hello World Program in Java
and freeing memory is part of the code that you write as a developer. Failure to handle
memory management properly can lead to wasted resources (memory leaks), poor or
unstable performance, and even more serious security issues (buffer overflows). In Java,
there is no manual memory management. The JVM handles the allocation and clean up
of memory automatically.
In following with the five design principles, Java is similar in syntax to C (called “C-style
syntax”). Executable statements are terminated by semicolons, code blocks are defined
by opening/closing curly brackets, etc. Java is also fundamentally a class-based OOP
language. With the exception of a few primitive types, in Java everything is a class or
belongs to an class.
26.1. Getting Started: Hello World
The hallmark of an introduction to a new programming language is the Hello World!
program. It consists of a simple program whose only purpose is to print out the message
“Hello World!” to the user. The simplicity of the program allows the focus to be on the
basic syntax of the language. It is also typically used to ensure that your development
environment, compiler, runtime environment, etc. are functioning properly with a minimal
example. A basic Hello World! program in Java can be found in Code Sample 26.1.
384
26.2. Basic Elements
We will not focus on any particular development environment, code editor, or any
particular operating system, compiler, or ancillary standards in our presentation. However,
as a first step, you should be able to write, compile, and run the above program
on the environment you intend to use for the rest of this book. This may require
that you download and install a JDK and IDE. Eclipse (http://eclipse.org/) is the
industry standard, though IntelliJ (https://www.jetbrains.com/idea/) and NetBeans
(https://netbeans.org/) are also popular.
26.2. Basic Elements
Using the Hello World! program as a starting point, we will now examine the basic
elements of the Java language.
26.2.1. Basic Syntax Rules
Java’s syntax is adopted from C, referred to as “C-style syntax.” These elements include
the following.
• Java is a statically typed language so variables must be declared along with their
types before using them.
• Strings are delimited with double quotes. Single characters, including special
escaped characters are delimited by single quotes; "this is a string" , and
these are characters: 'A' , '4' , '$' and '\n'
• In addition, Java uses Unicode (UTF-16 encoding) to represent characters. This is
fully back-compatible with ASCII, but also allows you to specify Unicode characters
using special escape sequences and hexadecimal encodings. For example, '\u4FFA'
represents a Japanese character:
The string "\u4FFA\u306F\u6700\u9AD8\u3060\u305C\uFF01" represents the
phrase
• Executable statements are terminated by a semicolon, ;
• Code blocks are defined using opening and closing curly brackets, { ... } . More-
over, code blocks can be nested : code blocks can be defined within other code
385
26. Basics
blocks.
• Variables are scoped to the code block in which they are declared and are only
valid within that code block.
• In general, whitespace between coding elements is ignored.
Though not a syntactic requirement, the proper use of whitespace is important for good,
readable code. Code inside code blocks is indented at the same indentation. Nested
code blocks are indented further. Think of a typical table of contents or the outline of a
formal paper or essay. Sections and subsections or points and subpoints all follow proper
indentation with elements at the same level at the same indentation. This convention is
used to organize code and make it more readable.
26.2.2. Program Structure
Classes
In Java, everything is a class or belongs to a class. A class is an extensible program or
blueprint for creating objects. Objects are an integral part of OOP that we’ll explore later.
However, to start out our programs will be simple enough that they can be contained in
a single class. To declare a class, you use the following syntax.
public class HelloWorld { ... }
where the contents of the class are placed between the opening/closing curly brackets.
In addition, a class must be placed in a Java source file with the same name. In our
previous example, the class must be in a file named HelloWorld.java .
When naming classes, the most commonly accepted naming convention is to use uppercase
camel casing (also called PascalCase) in which each word in the name is capitalized
including the first, Employee , SavingsAccount , ImageFile , etc. Class names (as
well as their source file names) are case sensitive.
Packages
Java code is organized into modules called packages. Packages are essentially directories
(or folders) which follow a directory tree structure which allows subdirectories and
separate directories at the same level. It all starts at the root directory called the
“default” package.
Within a source file, we declare which package the file belongs to using the keyword
package followed by a fully qualified package declaration which is essentially just the
386
26.2. Basic Elements
names of the directories that the file is located in, separated by a period. The declaration
is terminated by a semicolon. For example, the package declaration,
package unl.cse;
would indicate that the file belongs in the directory cse which is a subdirectory of the
directory unl . The absence of a package declaration will mean that the file is associated
with the default directory.
Packages allow you to organize source files and code functionality. Mathematics related
classes can be placed in one package while image related classes can be placed in another,
etc. It also provides separate name spaces for classes. There could be 3 or 4 different
classes named List for example. They could not be located in the same directory; if
you wanted to use one which one would you be referring to? By separating them into
packages, they can all exist without conflict. When we want to use a particular one, we
import that class with its fully qualified package name.
Imports
An import statement essentially “brings in” another class so that its methods and
functionality can be used. For example, there is a class named Scanner (located in
the package java.util ) that makes it easy to read input from the standard input. To
include it in our program so that we can use its functionality, we would need1 to import
it:
import java.util.Scanner;
Classes in the package java.lang (such as String and Math ) are considered standard
and are imported by default without an explicit import statement.
You may see some code that uses a wildcard like import java.util.*; which ends
up importing every class in that package. This is generally considered bad practice. In
general, code should be intentional and specific, importing every class even if they are
not used goes against this principle.
When naming packages, you must follow the general naming rules for identifiers (see below).
Package names cannot begin with a number, no whitespace, etc. Moreover, the general con-
vention for package names is to use lowercase underscore casing, here_is_an_example .
Moreover, packages and subpackages follow the same convention as directories: the top
most directory is the most general and subdirectories are more and more specific.
In many of our examples we’ll use unl.cse (UNL, University of Nebraska–Lincoln; CSE,
1
You can still use it without importing it, but you’d need to use a fully qualified path name at
declaration/instantiation.
387
26. Basics
Function Description
Math.abs(x) Absolute value function, |x|a
Math.ceil(x) Ceiling function, d46.3e = 47.0
Math.floor(x) Floor function, b46.3c = 46.0
Math.cos(x) Cosine functionb
Math.sin(x) Sine functionb
Math.tan(x) Tangent functionb
Math.exp(x) Exponential function, ex , e = 2.71828 . . .
Math.log(x) Natural logarithm, ln (x)c
Math.log10(x) Logarithm base 10, log10 (x)c
Math.pow(x,y) The power function, computes xy
Math.sqrt(x) Square root functionc
Table 26.1.: Several methods defined in the Java Math library. a There are several versions
of the absolute value method, one for each numeric type but all with the
same name. b all trigonometric functions assume input is in radians, not
degrees. c Input is assumed to be positive, x > 0.
Department of Computer Science & Engineering) which illustrates this general-to-specific
organization.
There are many other important classes and packages provided by the standard JDK
that we’ll examine as needed. Of immediate interest is the Math class and its library
of common mathematical functions such as the square root and the natural logarithm.
Table 26.1 highlights several of these functions. To use them you’d need to invoke them
by using the class name and dot operator. For example:
1 double x = 1.5;
2 double y, z; √ √
3 y = Math.sqrt(x); //y now has the value x = 1.5
4 z = Math.sin(x); //z now has the value sin (x) = sin (1.5)
In both of the method calls above, the value of the variable x is “passed” to the math
function which computes and “returns” the result which then gets assigned to another
variable.
388
26.2. Basic Elements
26.2.3. The main() Method
Every executable program has to have a beginning: a point at which the program starts
to execute. In Java, a class may contain many variables and methods, but a class is only
executable if it contains a main() method. When a Java class is compiled and the JVM
is started, the JVM loads the class into memory and starts executing code contained in
the main() method.
In addition, our main() method takes an array of String types which serve to
communicate any command line arguments provided to the program (review Section 2.4.4
for details). The array, args stores the arguments as strings. The number of arguments
provided can be determined using the length property of the array. Specifically,
args.length is an integer indicating how many arguments were provided. This does
not include the name of the program (class) itself as that is already be known to the
programmer.
To access any one argument, it will be necessary to index the array. The index for the
first argument is zero, thus the first argument is args[0] , the second is args[1] , etc.
The last one would be at args[args.length-1] .
If a user is expected to provide numbers as input, they’ll need to be converted as the
args array are only String types. To convert the arguments you can use parsing
methods provided by the Integer and Double classes. An example:
1 //converts the "first" command line argument to an integer
2 int x = Integer.parseInt(args[0]);
3 //converts the "third" command line argument to a double:
4 double y = Double.parseDouble(args[1]);
26.2.4. Comments
Comments can be written in a Java program either as a single line using two forward
slashes, //comment or as a multiline comment using a combination of forward slash and
asterisk: /* comment */ . With a single line comment, everything on the line after the
forward slashes is ignored. With a multiline comment, everything in between the forward
slash/asterisk is ignored. Comments are ultimately ignored so the amount of comments
do not have an effect on the final executable code. Consider the following example.
389
26. Basics
1 //this is a single line comment
2 int x; //this is also a single line comment, but after some code
3
4 /*
5 This is a comment that can
6 span multiple lines to format the comment
7 message more clearly
8 */
9 double y;
Most code editors and IDEs will present comments in a special color or font to distinguish
them from the rest of the code (just as our example above does). Failure to close a
multiline comment will likely result in a compiler error but with color-coded comments
its easy to see the mistake visually.
Another common comment style convention is the Javadoc (Java Documentation) style
of comments. Javadoc style comments are multiline comments that begin with /** .
The Javadoc framework allows you to markup your comments with tags and links so that
documentation can be automatically generated and published. We will sometimes use
this style, but we will not cover the details.
26.3. Variables
Java has 8 built-in primitive types supporting numbers (integers and floating point
numbers), Booleans, and characters. Table 26.2 contains a complete description of these
types. Each of these primitive types also has a corresponding wrapper class defined in
the java.lang package. Wrapper classes provide object versions of each of these classes.
The object versions have many utility methods that can be used in relation to their type.
For example, the aforementioned Integer.parseInt() method is part of the Integer
wrapper class.
The wrapper classes, however, are different. These are objects, so when a reference is
declared for them, by default, that reference refers to null . The keyword null is used
to indicate a special memory address that represents “nothing.” In fact, the default value
for any object type is null . Care must be taken when mixing primitive types and their
wrapper classes (see below) as null references may result in a NullPointerException .
Finally, instances of the wrapper classes are immutable. Once they are created, they
cannot be changed. References can be made to refer to a different object, but the object’s
value cannot be changed.
390
26.3. Variables
Type Description Wrapper Class
byte 8-bit signed 2s complement integer Byte
short 16-bit signed 2s complement integer Short
int 32-bit signed 2s complement integer Integer
long 64-bit signed 2s complement integer Long
float 32-bit IEEE 754 floating point number Float
double 64-bit floating point number Double
boolean may be set to true or false Boolean
char 16-bit Unicode (UTF-16) character Character
Table 26.2.: Primitive types in Java
26.3.1. Declaration & Assignment
Java is a statically typed language meaning that all variables must be declared before
you can use them or refer to them. In addition, when declaring a variable, you must
specify both its type and its identifier. For example:
1 int numUnits;
2 double costPerUnit;
3 char firstInitial;
4 boolean isStudent;
Each declaration specifies the variable’s type followed by the identifier and ending with a
semicolon. The identifier rules are fairly standard: a name can consist of lowercase and
uppercase alphabetic characters, numbers, and underscores but may not begin with a
numeric character. We adopt the modern camelCasing naming convention for variables
in our code. In general, variables must be assigned a value before you can use them in
an expression. You do not have to immediately assign a value when you declare them
(though it is good practice), but some value must be assigned before they can be used or
the compiler will issue an error.2
The assignment operator is a single equal sign, = and is a right-to-left assignment. That
is, the variable that we wish to assign the value to appears on the left-hand-side while
the value (literal, variable or expression) is on the right-hand-size. Using our variables
from before, we can assign them values:
2
Instance variables, that is variables declared as part of an object do have default values. For objects,
the default is null , for all numeric types, zero is the default value. For the boolean type, false
is the default, and the default char value is \0 , the null-terminating character (zero in the ASCII
table).
391
26. Basics
1 numUnits = 42;
2 costPerUnit = 32.79;
3 firstInitial = 'C';
4 isStudent = true;
For brevity, Java allows you to declare a variable and immediately assign it a value on
the same line. So these two code blocks could have been more compactly written as:
1 int numUnits = 42;
2 double costPerUnit = 32.79;
3 char firstInitial = 'C';
4 boolean isStudent = true;
As another shorthand, we can declare multiple variables on the same line by delimiting
them with a comma. However, they must be of the same type. We can also use an
assignment with them.
1 int numOrders, numUnits = 42, numCustomers = 10, numItems;
2 double costPerUnit = 32.79, salesTaxRate;
Another useful keyword is final . Though it has several uses, when applied to a variable
declaration, it makes it a read-only variable. After a value has been assigned to a final
variable, its value cannot be changed.
1 final int secret = 42;
2 final double salesTaxRate = 0.075;
Any attempt to reassign the values of final variables will result in a compiler error.
392
26.4. Operators
26.4. Operators
Java supports the standard arithmetic operators for addition, subtraction, multiplication,
and division using + , - , * , and / respectively. Each of these operators is a binary
operator that acts on two operands which can either be literals or other variables and
follow the usual rules of arithmetic when it comes to order of precedence (multiplication
and division before addition and subtraction).
1 int a = 10, b = 20, c = 30, d;
2 d = a + 5;
3 d = a + b;
4 d = a - b;
5 d = a + b * c;
6 d = a * b;
7 d = a / b; //integer division and truncation! See below
8
9 double x = 1.5, y = 3.4, z = 10.5, w;
10 w = x + 5.0;
11 w = x + y;
12 w = x - y;
13 w = x + y * z;
14 w = x * y;
15 w = x / y;
16
17 //you can do arithmetic with both types:
18 w = a + x;
19
20 //however you CANNOT assign a double to an integer:
21 d = b + y; //compilation error
22 //but you can do so with an explicit type cast:
23 d = (int) (b + y); //though truncation occurs, d is 23
In addition, you can mix the wrapper classes with their primitive types. You must be
careful though. The wrapper classes are object references which can be null . If a null
reference is used in an arithmetic expression, it will result in a NullPointerException
which can be caught and handled (see Chapter 30). If not caught, it will end up being a
fatal error. Some examples:
1 int a = 10, c;
2 Integer b = 20;
393
26. Basics
3
4 //int and Integer can be mixed:
5 c = a + b;
6
7 double x = 3.14, z;
8 Double y = 2.71;
9 //double and Double can be mixed:
10 z = x + y;
11
12 //all types can be mixed:
13 double u = a + x + b + y;
14
15 //Be careful:
16 Integer d = null;
17 c = a + d; //NullPointerException
This works because of a mechanism called autoboxing (or autounboxing in this case). The
wrapper class is acting like a “box”: it is an object that stores the value of a primitive
type. When it gets used in an arithmetic expression, it gets “unboxed” and converted to
a primitive type so that the arithmetic operation is performed on compatible primitive
types. This is all done by the compiler and is completely transparent to us. However,
that is the reason that we may get a NullPointerExcpetion . Our code actually gets
converted from c = a + d; to c = a +d.doubleValue(); . The doubleValue()
method returns a double primitive value. However, if d is null , you can’t call a
method on it; thus the NullPointerException is thrown as a consequence.
Special care must be taken when dealing with int types. For all four operators, if
both operands are integers, the result will be an integer. For addition, subtraction, and
multiplication this isn’t an issue, but for division it means that when we divide, say
(10 / 20) , the result is not 0.5 as expected. The number 0.5 is a floating point number.
As such, the fractional part gets truncated (cut off and thrown out) leaving only zero. In
the code above, d = a / b; the variable d ends up getting the value zero because of
this.
A solution to this problem is to use explicit type casting to force at least one of the
operands in an integer division to become a double type. For example:
1 int a = 10, b = 20;
2 double x;
3
4 x = (double) a / b;
394
26.5. Basic I/O
Assigning a floating point number to an integer is not allowed in Java and attempting to
do so will be treated as a compiler error. This is because Java does not support implicit
type casts. However, you can do so if you provide an explicit type cast as in the code
above,
d = (int) (b + y);
In this code, b + y is correctly computed as 20 + 3.4 = 23.4, but the explicit type cast
(down to an integer) results in truncation. The .4 gets cutoff and d gets the value 23.
Assigning an int value to a double variable is not a problem as the integer 2 becomes
the floating point number 2.0.
Java also supports the integer remainder operator using the % symbol. This operator
gives the remainder of the result of dividing two integers. Examples:
1 int x;
2
3 x = 10 % 5; //x is 0
4 x = 10 % 3; //x is 1
5 x = 29 % 5; //x is 4
26.5. Basic I/O
Java provides several ways to perform input and output operations with the standard
input/output as part of the System class. The System class contains a standard output
stream which can be accessed using System.out . It also has a standard input stream
which can be accessed using System.in .
For output, there are several methods that can be used but we’ll focus on System.out.println()
and System.out.printf() . The first is for printing strings on a single line. The ln
at the end indicates that the method will insert an endline character, \n for you. The
second is a printf -style output method that takes placeholders like %d and %f (review
Section 2.4.3 for details).
The easiest way to read input is through the Scanner class. You can create a new
instance of the Scanner class and associate it with the standard input using the following
395
26. Basics
1 Scanner s = new Scanner(System.in);
2 int a;
3 System.out.println("Please enter a number: ");
4 a = s.nextInt();
5 System.out.printf("Great, you entered %d\n", a);
Code Sample 26.2.: Basic Input/Output in Java
code.
Scanner s = new Scanner(System.in);
The variable s is now active and can be read from. You can get specific values
from the Scanner by calling various methods such as s.nextInt() to get an int ,
s.nextDouble() to get a double , etc. When these methods are called, the program
blocks until the user enters her input and presses the enter/return key. The conversion to
the type you requested is automatic. A full example is depicted in Code Sample 26.2.
One potential problem with using Scanner is that the methods cannot force a user to
enter good input. In the example above, if the user, instead of entering a number, entered
"Hello" , the conversion to a number would fail and result in a InputMismatchException .
26.6. Examples
26.6.1. Converting Units
Let’s write a program that will prompt the user to enter a temperature in degrees
Fahrenheit and convert it to degrees Celsius using the formula
5
C = (F − 32) ·
9
We begin with the basic program outline which will include a package and class declaration.
We’ll also need to read from the standard input, so we’ll import the Scanner class.
We’ll want want our class to be executable, so we need to put a main() method in our
class. Finally, we’ll document our program to indicate its purpose.
396
26.6. Examples
1 package unl.cse;
2
3 import java.util.Scanner;
4
5 /**
6 * This program converts Fahrenheit temperatures to
7 * Celsius
8 */
9 public class TemperatureConverter {
10
11 public static void main(String args[]) {
12
13 //TODO: implement this
14
15 }
16 }
It is common for programmers to use a comment along with a TODO note to themselves
as a reminder of things that they still need to do with the program.
Let’s first outline the basic steps that our program will go through:
1. We’ll first prompt the user for input, asking them for a temperature in Fahrenheit
2. Next we’ll read the user’s input, likely into a floating point number as degrees can
be fractional
3. Once we have the input, we can calculate the degrees Celsius by using the formula
above
4. Lastly, we will want to print the result to the user to inform them of the value
Sometimes it is helpful to write an outline of such a program directly in the code using
comments to provide a step-by-step process. For example:
1 package unl.cse;
2
3 import java.util.Scanner;
4
5 /**
6 * This program converts Fahrenheit temperatures to
7 * Celsius
397
26. Basics
8 */
9 public class TemperatureConverter {
10
11 public static void main(String args[]) {
12
13 //TODO: implement this
14 //1. Prompt the user for input in Fahrenheit
15 //2. Read the Fahrenheit value from the standard input
16 //3. Compute the degrees Celsius
17 //4. Print the result to the user
18
19 }
20 }
As we read each step it becomes apparent that we’ll need a couple of variables: one to
hold the Fahrenheit (input) value and one for the Celsius (output) value. It also makes
sense that each of these should be double variables as we want to support fractional
values. At the top of our main() method, we’ll add the variable declarations:
double fahrenheit, celsius;
We’ll also need a Scanner , initialized to read from the standard input:
Scanner s = new Scanner(System.in);
Each of the steps is now straightforward; we’ll use a System.out.println() statement
in the first step to prompt the user for input:
System.out.println("Please enter degrees in Fahrenheit: ");
In the second step, we’ll use our Scanner to read in a value from the user for the
fahrenheit variable. Recall that we use the method s.nextDouble() to read a
double value from the user.
fahrenheit = s.nextDouble();
We can now compute celsius using the formula provided:
celsius = (fahrenheit - 32) * (5 / 9);
Finally, we use System.out.printf() to output the result to the user:
System.out.printf("%f Fahrenheit is %f Celsius\n", fahrenheit, celsius);
398
26.6. Examples
Try typing and running the program as defined above and you’ll find that you don’t get
correct answers. In fact, you’ll find that no matter what values you enter, you get zero.
This is because of the calculation using (5 / 9) : recall what happens with integer
division: truncation! This will always end up being zero.
One way we could fix it would be to pull out our calculators and find that 59 = 0.55555 . . .
and replace (5 / 9) with 0.555555 . But, how many fives? It may be difficult to tell
how accurate we can make this floating point number by hardcoding it ourselves. A much
better approach would be to let the compiler take care of the optimal computation for us
by making at least one of the numbers a double to prevent integer truncation. That is,
we should instead use 5.0 / 9 . The full program can be found in Code Sample 26.3.
1 package unl.cse;
2
3 import java.util.Scanner;
4
5 public class TemperatureConverter {
6
7 public static void main(String args[]) {
8
9 double fahrenheit, celsius;
10 Scanner s = new Scanner(System.in);
11
12 //1. Prompt the user for input in Fahrenheit
13 System.out.println("Please enter degrees in Fahrenheit: ");
14
15 //2. Read the Fahrenheit value from the standard input
16 fahrenheit = s.nextDouble();
17
18 //3. Compute the degrees Celsius
19 celsius = (fahrenheit - 32) * 5.0 / 9;
20
21 //4. Print the result to the user
22 System.out.printf("%f Fahrenheit is %f Celsius\n",
23 fahrenheit, celsius);
24
25 }
26 }
Code Sample 26.3.: Fahrenheit-to-Celsius Conversion Program in Java
399
26. Basics
26.6.2. Computing Quadratic Roots
Some programs require the user to enter multiple inputs. The prompt-input process can
be repeated. In this example, consider asking the user for the coefficients, a, b, c to a
quadratic polynomial,
ax2 + bx + c
and computing its roots using the quadratic formula,
√
−b ± b2 − 4ac
x=
2a
As before, we can create a basic program with a main() method and start filling in
the details. In particular, we’ll need to prompt for the input a, then read it in; then
prompt for b, read it in and repeat for c. We’ll also need several variables: three for the
coefficients a, b, c and two more; one for each root.
1 double a, b, c, root1, root2;
2 Scanner s = new Scanner(System.in);
3
4 System.out.println("Please enter a: ");
5 a = s.nextDouble();
6 System.out.println("Please enter b: ");
7 b = s.nextDouble();
8 System.out.println("Please enter c: ");
9 c = s.nextDouble();
Now to compute the roots: we need to adapt the formula so it accurately reflects the
order of operations. We also need to use the standard math library’s square root method.
1 root1 = (-b + Math.sqrt(b*b - 4*a*c) ) / (2*a);
2 root2 = (-b - Math.sqrt(b*b - 4*a*c) ) / (2*a);
Finally, we print the output using System.out.printf() . The full program can be
found in Code Sample 26.4.
This program was interactive. As an alternative, we could have read all three of the
inputs as command line arguments, taking care that we need to convert them to floating
point numbers. Lines 16–21 in the program could have been changed to
400
26.6. Examples
1 a = Double.parseDouble(args[0]);
2 b = Double.parseDouble(args[1]);
3 c = Double.parseDouble(args[2]);
Finally, think about the possible inputs a user could provide that may cause problems
for this program. For example:
• What if the user entered zero for a?
• What if the user entered some combination such that b2 < 4ac?
• What if the user entered non-numeric values?
• For the command line argument version, what if the user provided less than three
arguments? Or more?
How might we prevent the consequences of such bad input? How might we handle the
event that a user enters bad input and how do we communicate these errors to the user?
To start to resolve these issues, we’ll need conditionals.
401
26. Basics
1 package unl.cse;
2
3 import java.util.Scanner;
4
5 /**
6 * This program computes the roots to a quadratic equation
7 * using the quadratic formula.
8 */
9 public class QuadraticRoots {
10
11 public static void main(String args[]) {
12
13 double a, b, c, root1, root2;
14 Scanner s = new Scanner(System.in);
15
16 System.out.println("Please enter a: ");
17 a = s.nextDouble();
18 System.out.println("Please enter b: ");
19 b = s.nextDouble();
20 System.out.println("Please enter c: ");
21 c = s.nextDouble();
22
23 root1 = (-b + Math.sqrt(b*b - 4*a*c) ) / (2*a);
24 root2 = (-b - Math.sqrt(b*b - 4*a*c) ) / (2*a);
25
26 System.out.printf("The roots of %fx^2 + %fx + %f are: \n",
27 a, b, c);
28 System.out.printf(" root1 = %f\n", root1);
29 System.out.printf(" root2 = %f\n", root2);
30
31 }
32
33 }
Code Sample 26.4.: Quadratic Roots Program in Java
402
27. Conditionals
Java supports the basic if, if-else, and if-else-if conditional structures as well as switch
statements. Java has Boolean types and logical statements are built using the standard
logical operators for numeric comparisons as well as logical operators such as negations,
And, and Or that can be used with Boolean types.
27.1. Logical Operators
Recall that Java has Boolean types built-in to the language using either the primitive type,
boolean or its wrapper class Boolean . Moreover, the keywords true and false
can be used to assign and check values. Because Java has Boolean types, it does not
allow you to mix logical operators with numeric types. That is, code like the following is
invalid.
1 int a = 10;
2 boolean b = true;
3 boolean result = (a || b); //compilation error
The standard numeric comparison operators are also supported. Consider the following
code snippet:
1 int a = 10;
2 int b = 20;
3 int c = 10;
4 boolean x = true;
5 boolean y = false;
The six standard comparison operators are presented in Table 27.1 using these variables
as examples. The comparison operators are the same when used with double types as
403
27. Conditionals
Name Operator Syntax Examples Value
Equals == a == 10 true
b == 10 false
a == b false
a == c true
Not Equals != a != 10 false
b != 10 true
a != b true
a != c false
Strictly Less Than < a < 15 true
a < 5 false
a < b true
a < c false
Less Than Or Equal To <= a <= 15 true
a <= 5 false
a <= b true
a <= c true
Strictly Greater Than > a > 15 false
a > 5 true
a > b false
a > c false
Greater Than Or Equal To >= a >= 15 false
a >= 5 true
a >= b false
a >= c true
Table 27.1.: Comparison Operators in Java
well and int types and can be compared with each other without type casting.
Furthermore, because of autoboxing and unboxing, the wrapper classes for numeric types
can be compared using the same operators. For example:
1 int a = 10;
2 Integer b = 20;
3 Double x = 3.14;
4 boolean r;
5 r = (a < b);
6 r = (a >= b);
7 r = (x == 2.71);
404
27.1. Logical Operators
Operator Operator Syntax Examples Values
Negation ! !x false
!y true
And && x && true true
x && y false
Or || x || false true
x || y true
!x || y false
Table 27.2.: Logical Operators in Java with x = true and y = false both being
Boolean variables.
Operator(s) Associativity Notes
Highest ++ , -- left-to-right postfix increment operators
-, ! right-to-left unary negation operator, logical
not
*, /, % left-to-right
+, - left-to-right addition, subtraction
< , <= , > , >= left-to-right comparison
== , != left-to-right equality, inequality
&& left-to-right logical And
|| left-to-right logical Or
Lowest = , += , -= , *= , /= right-to-left assignment and compound assign-
ment operators
Table 27.3.: Operator Order of Precedence in Java. Operators on the same level have
equivalent order and are performed in the associative order specified.
The three basic logical operators are also supported as described in Table 27.2.
27.1.1. Order of Precedence
At this point it is worth summarizing the order of precedence of all the operators that
we’ve seen so far including assignment, arithmetic, comparison, and logical. Since all of
these operators could be used in one statement, for example,
(b*b < 4*a*c || a == 0 || args.length != 4)
It is important to understand the order in which each one gets evaluated. Table 27.3
summarizes the order of precedence for the operators seen so far. This is not an exhaustive
list of Java operators.
405
27. Conditionals
27.1.2. Comparing Strings and Characters
The comparison operators in Table 27.1 can also be used for single characters because
of the nature of the ASCII text table (see Table 2.4). Each alphanumeric character,
including the various symbols and whitespace characters, is associated with an integer 0–
127. We can therefore write statements like ('A' < 'a') , which is true since uppercase
letters are ordered before lowercase letters in the ASCII table ( 'A' is 65 and 'a' is 97
and so 65 < 97 is true). Several more examples can be found in Table 27.4.
Comparison Example Result
('A' < 'a') true
('A' == 'a') false
('A' < 'Z') true
('0' < '9') true
('\n' < 'A') true
(' ' < '\n') false
Table 27.4.: Character comparisons in Java
Numeric comparison operators cannot be used to compare strings in Java. For example,
we could not code something like ("aardvark" < "zebra") . The Java compiler would
not allow you to do this because the comparison operator is for numeric types only.
However, the following code would compile and run:
1 String s = "aardvark";
2 String t = "zebra";
3 boolean b = (s == t);
but it wouldn’t necessarily give you what you want. To understand why this is okay,
recall that a String is an object; the s and t variables are references to that object
in memory. When we use the equality comparison, == we’re asking if s and t are
the same memory address. In this case, likely they are not and so the result is false .
However, similar code,
1 String s = new String("liger");
2 String t = new String("liger");
3 boolean b = (s == t);
406
27.2. If, If-Else, If-Else-If Statements
1 //example of an if statement:
2 if(x < 10) {
3 System.out.println("x is less than 10");
4 }
5
6 //example of an if-else statement:
7 if(x < 10) {
8 System.out.println("x is less than 10");
9 } else {
10 System.out.println("x is 10 or more");
11 }
12
13 //example of an if-else-if statement:
14 if(x < 10) {
15 System.out.println("x is less than 10");
16 } else if(x == 10) {
17 System.out.println("x is equal to ten");
18 } else {
19 System.out.println("x is greater than 10");
20 }
Code Sample 27.1.: Examples of Conditional Statements in Java
would also result in false because s and t represent different strings in memory,
even though they have the same sequence of characters. We’ll explore how to properly
compare strings later. For now, avoid using the equality operators with strings.
27.2. If, If-Else, If-Else-If Statements
Conditional statements in Java utilize the keywords if , else , and else if . Condi-
tions are placed inside parentheses immediately after the if and else if keywords.
Examples of all three can be found in Code Sample 27.1.
The statement, if(x < 10) does not have a semicolon at the end. This is because it
is a conditional statement that determines the flow of control and not an executable
statement. Therefore, no semicolon is used. Suppose we made a mistake and did include
a semicolon:
407
27. Conditionals
1 int x = 15;
2 if(x < 10); {
3 System.out.println("x is less than 10");
4 }
Some compilers may give a warning, but this is valid Java; it will compile and it will run.
However, it will end up printing x is less than 10 , even though x = 15! Recall that
a conditional statement binds to the executable statement or code block immediately
following it. In this case, we’ve provided an empty executable statement ended by the
semicolon. The code is essentially equivalent to
1 int x = 15;
2 if(x < 10) {
3 }
4 System.out.println("x is less than 10");
Which is obviously not what we wanted. The semicolon ended up binding to the empty
executable statement, and the code block containing the print statement immediately
followed, but was not bound to the conditional statement which is why the print statement
executed regardless of the value of x.
Another convention that we’ve used in our code is where we have placed the curly brackets.
First, if a conditional statement is bound to only one statement, the curly brackets are
not necessary. However, it is best practice to include them even if they are not necessary
and we’ll follow this convention. Second, the opening curly bracket is on the same line as
the conditional statement while the closing curly bracket is indented to the same level
as the start of the conditional statement. Moreover, the code inside the code block is
indented. If there were more statements in the block, they would have all been at the
same indentation level.
27.3. Examples
27.3.1. Computing a Logarithm
The logarithm of x is the exponent that some base must be raised to get x. The most
common logarithm is the natural logarithm, ln (x) which is base e = 2.71828 . . .. But
408
27.3. Examples
logarithms can be in any base b > 1.1 What if we wanted to compute log2 (x)? Or
logπ (x)? Let’s write a program that will prompt the user for a number x and a base b
and computes logb (x).
Arbitrary bases can be computed using the change of base formula:
loga (x)
logb (x) =
loga (b)
If we can compute some base a, then we can compute any base b. Fortunately we have
such a solution. Recall that the standard library provides a function to compute the
natural logarithm, Math.log() . This is one of the fundamentals of problems solving: if
a solution already exists, use it. In this case, a solution exists for a different, but similar
problem (computing the natural logarithm), but we can adapt the solution using the
change of base formula. In particular, if we have variables b (base) and x , we can
compute logb (x) using
Math.log(x) / Math.log(b)
However, we have a problem similar to the examples in the previous section. The user
could enter invalid values such as b = −10 or x = −2.54 (logarithms are undefined
for non-positive values in any base). We want to ensure that b > 1 and x > 0. With
conditionals, we can now do this. Once we have read in the input from the user we can
make a check for good input using an if statement.
1 if(x <= 0 || b <= 1) {
2 System.out.println("Error: bad input!");
3 System.exit(1);
4 }
This code has something new: System.exit(1) . The exit() function immediately
terminates the program regardless of the rest of the code that it may remain. The
argument passed to exit() is an integer that represents an error code. The convention
is that zero indicates “no error” while non-zero values indicate some error. This is a
simple way of performing error handling: if the user provides bad input, we inform
them and quit the program, forcing them to run it again and provide good input. By
prematurely terminating the program we avoid any illegal operation that would give a
bad result.
Alternatively, we could have split the conditions into two statements and given a more
descriptive error message. We use this design in the full program which can be found in
1
Bases can also be 0 < b < 1, but we’ll restrict our attention to increasing functions only.
409
27. Conditionals
Code Sample 27.2. The program also takes the input as command line arguments. Now
that we have conditionals, we can actually check that the correct number of arguments
was provided by the user and quit in the event that they don’t provide the correct
number.
27.3.2. Life & Taxes
Let’s adapt the conditional statements we developed in Section 3.6.4 into a full Java
program. The first thing we need to do is establish the variables we’ll need and read
them in from the user. At the same time we can check for bad input (negative values)
for both the inputs.
1 Scanner s = new Scanner(System.in);
2 double income, baseTax, numChildren, credit, totalTax;
3
4 System.out.println("Please enter your Adjusted Gross Income: ");
5 income = s.nextDouble();
6
7 System.out.println("How many children do you have?");
8 numChildren = s.nextDouble();
9
10 if(income < 0 || numChildren < 0) {
11 System.out.println("Invalid inputs");
12 System.exit(1);
13 }
Next, we can code a series of if-else-if statements for the income range. By placing the
ranges in increasing order, we only need to check the upper bounds just as in the original
example.
1 if(income <= 18150) {
2 baseTax = income * .10;
3 } else if(income <= 73800) {
4 baseTax = 1815 + (income - 18150) * .15;
5 } else if(income <= 148850) {
6 ...
7 } else {
8 baseTax = 127962.50 + (income - 457600) * .396;
9 }
410
27.3. Examples
Next we compute the child tax credit, taking care that it does not exceed $3,000. A
conditional based on the number of children should suffice as at this point in the program
we already know it is zero or greater.
1 if(numChildren <= 3) {
2 credit = numChildren * 1000;
3 } else {
4 credit = 3000;
5 }
Finally, we need to ensure that the credit does not exceed the total tax liability (the
credit is non-refundable, so if the credit is greater, the tax should only be zero, not
negative).
1 if(baseTax - credit >= 0) {
2 totalTax = baseTax - credit;
3 } else {
4 totalTax = 0;
5 }
The full program is presented in Code Sample 27.3.
27.3.3. Quadratic Roots Revisited
Let’s return to the quadratic roots program we previously designed that uses the quadratic
equation to compute the roots of a quadratic polynomial by reading coefficients a, b, c
in from the user. One of the problems we had previously identified is if the user enters
“bad” input: if a = 0, we would end up dividing by zero; if b2 − 4ac < 0 then we would
have complex roots. With conditionals, we can now check for these issues and exit with
an error message.
Another potential case we might want to handle differently is when there is only one
distinct root (b2 − 4ac = 0). In that case, the quadratic formula simplifies to −b
2a
and we
can print a different, more specific message to the user. The full program can be found
in Code Sample 27.4.
411
27. Conditionals
1 /**
2 * This program computes the logarithm base b (b > 1)
3 * of a given number x > 0
4 */
5 public class Logarithm {
6
7 public static void main(String args[]) {
8
9 double b, x, result;
10 if(args.length != 2) {
11 System.out.println("Usage: b x");
12 System.exit(1);
13 }
14
15 b = Double.parseDouble(args[0]);
16 x = Integer.parseInt(args[1]);
17
18 if(x <= 0) {
19 System.out.println("Error: x must be greater than zero");
20 System.exit(1);
21 }
22 if(b <= 1) {
23 System.out.println("Error: base must be greater than one");
24 System.exit(1);
25 }
26
27 result = Math.log(x) / Math.log(b);
28 System.out.printf("log_(%f)(%f) = %f\n", b, x, result);
29
30 }
31
32 }
Code Sample 27.2.: Logarithm Calculator Program in Java
412
27.3. Examples
1 import java.util.Scanner;
2
3 public class Taxes {
4
5 public static void main(String args[]) {
6
7 Scanner s = new Scanner(System.in);
8 double income, baseTax, totalTax, numChildren, credit;
9
10 System.out.println("Please enter your Adjusted Gross Income: ");
11 income = s.nextDouble();
12
13 System.out.println("How many children do you have?");
14 numChildren = s.nextDouble();
15
16 if(income < 0 || numChildren < 0) {
17 System.out.println("Invalid inputs");
18 System.exit(1);
19 }
20
21 if(income <= 18150) {
22 baseTax = income * .10;
23 } else if(income <= 73800) {
24 baseTax = 1815 + (income -18150) * .15;
25 } else if(income <= 148850) {
26 baseTax = 10162.50 + (income - 73800) * .25;
27 } else if(income <= 225850) {
28 baseTax = 28925.00 + (income - 148850) * .28;
29 } else if(income <= 405100) {
30 baseTax = 50765.00 + (income - 225850) * .33;
31 } else if(income <= 457600) {
32 baseTax = 109587.50 + (income - 405100) * .35;
33 } else {
34 baseTax = 127962.50 + (income - 457600) * .396;
35 }
36
37 if(numChildren <= 3) {
38 credit = numChildren * 1000;
39 } else {
40 credit = 3000;
41 }
42
43 if(baseTax - credit >= 0) {
44 totalTax = baseTax - credit;
45 } else {
46 totalTax = 0;
47 }
48
49 System.out.printf("AGI: $%10.2f\n", income);
50 System.out.printf("Tax: $%10.2f\n", baseTax);
51 System.out.printf("Credit: $%10.2f\n", credit);
52 System.out.printf("Tax Liability: $%10.2f\n", totalTax);
53
54 }
55
56 }
Code Sample 27.3.: Tax Program in Java
413
27. Conditionals
1 /**
2 * This program computes the roots to a quadratic equation
3 * using the quadratic formula.
4 */
5 public class Roots {
6
7 public static void main(String args[]) {
8 double a, b, c, root1, root2;
9
10 if(args.length != 3) {
11 System.err.println("Usage: a b c\n");
12 System.exit(1);
13 }
14
15 a = Double.parseDouble(args[0]);
16 b = Double.parseDouble(args[1]);
17 c = Double.parseDouble(args[2]);
18
19 if(a == 0) {
20 System.err.println("Error: a cannot be zero");
21 System.exit(1);
22 } else if(b*b < 4*a*c) {
23 System.err.println("Error: cannot handle complex roots\n");
24 System.exit(1);
25 } else if(b*b == 4*a*c) {
26 root1 = -b / (2*a);
27 System.out.printf("Only one distinct root: %f\n", root1);
28 } else {
29 root1 = (-b + Math.sqrt(b*b - 4*a*c) ) / (2*a);
30 root2 = (-b - Math.sqrt(b*b - 4*a*c) ) / (2*a);
31
32 System.out.printf("The roots of %fx^2 + %fx + %f are: \n",
33 a, b, c);
34 System.out.printf(" root1 = %f\n", root1);
35 System.out.printf(" root2 = %f\n", root2);
36 }
37 }
38
39 }
Code Sample 27.4.: Quadratic Roots Program in Java With Error Checking
414
28. Loops
Java supports while loops, for loops, and do-while loops using the keywords while , for ,
and do (along with another while ). Continuation conditions for loops are enclosed
in parentheses, (...) and the blocks of code associated with the loop are enclosed in
curly brackets.
28.1. While Loops
Code Sample 28.1 contains an example of a basic while loop in C. Just as with conditional
statements, our code styling places the opening curly bracket on the same line as the
while keyword and continuation condition. The inner block of code is also indented
and all lines in the block are indented to the same level.
In addition, the continuation condition does not have a semicolon since it is not an
executable statement. Just as with an if-statement, if we had included a semicolon it
would have led to unintended results. Consider the following:
1 while(i <= 10); {
2 //perform some action
3 i++; //iteration
4 }
1 int i = 1; //Initialization
2 while(i <= 10) { //continuation condition
3 //perform some action
4 i++; //iteration
5 }
Code Sample 28.1.: While Loop in Java
415
28. Loops
1 int i = 1;
2 boolean flag = true;
3 while(flag) {
4 //perform some action
5 i++; //iteration
6 if(i>10) {
7 flag = false;
8 }
9 }
Code Sample 28.2.: Flag-controlled While Loop in Java
A similar problem occurs: the while keyword and continuation condition bind to
the next executable statement or code block. As a consequence of the semicolon, the
executable statement that gets bound to the while loop is empty. What happens is
even worse: the program will enter an infinite loop. To see this, the code is essentially
equivalent to the following:
1 while(i <= 10) {
2 }
3 {
4 //perform some action
5 i++; //iteration
6 }
In the while loop, we never increment the counter variable i , the loop does nothing,
and so the computation will continue on forever! Some compilers will warn you about
this, others will not. It is valid Java and it will compile and run, but obviously won’t
work as intended. Avoid this problem by using proper syntax.
Another common use case for a while loop is a flag-controlled loop in which we use a
Boolean flag rather than an expression to determine if a loop should continue or not. An
example can be found in Code Sample 28.2.
416
28.2. For Loops
28.2. For Loops
For loops in Java use the familiar syntax of placing the initialization, continuation
condition, and iteration on the same line as the keyword for . An example can be found
in Code Sample 28.3.
1 for(int i=1; i<=10; i++) {
2 //perform some action
3 }
Code Sample 28.3.: For Loop in Java
Semicolons are placed at the end of the initialization and continuation condition, but not
the iteration statement. Just as with while loops, the opening curly bracket is placed on
the same line as the for keyword. Code within the loop body is indented, all at the
same indentation level.
Another observation: the declaration of the counter variable i was done in the initializa-
tion statement. This scopes the variable to the loop itself. The variable i is valid inside
the loop body, but will be out-of-scope after the loop body. It is possible to declare the
variable prior to the loop, but the variable i would have a much larger scope. It is best
practice to limit the scope of variables only to where they are needed. Thus, we will
write our loops as above.
28.3. Do-While Loops
Finally, Java supports do-while loops. Recall that the difference between a while loop
and a do-while loop is when the continuation condition is checked. For a while loop it is
prior to the beginning of the loop body and in a do-while loop it is at the end of the
loop. This means that a do-while always executes at least once. An example can be
found in Code Sample 28.4.
The opening curly bracket is again on the same line as the keyword do . The while
keyword and continuation condition are on the same line as the closing curly bracket.
In a slight departure from previous syntax, a semicolon does appear at the end of the
continuation condition even though it is not an executable statement.
417
28. Loops
1 int i;
2 do {
3 //perform some action
4 i++;
5 } while(i <= 10);
Code Sample 28.4.: Do-While Loop in Java
28.4. Enhanced For Loops
Java also supports foreach loops (which were introduced in JDK 1.5.0) which Java refers
to as “Enhanced For Loops.” Foreach loops allow you to iterate over each element in a
collection without having to define an index variable or otherwise “get” each element.
We’ll revisit these concepts in detail in Chapter 31, but let’s take a look at a couple of
examples.
An enhanced for loop in Java still uses the keyword for but uses different syntax for
its control. The example in Code Sample 28.5 illustrates this syntax: (int a : arr) .
The last element of this syntax is a reference to the collection that we want to iterate
over. The first part is the type and local reference variable that the loop will use.
1 int arr[] = {10, 20, 8, 42};
2 int sum = 0;
3 for(int a : arr) {
4 sum += a;
5 }
Code Sample 28.5.: Enhanced For Loops in Java Example 1
The code (int a : arr) should be read as “for each integer element a in the collection
arr ...” Within the enhanced for loop, the variable a will be automatically updated for
you on each iteration. Outside the loop body, the variable a is out-of-scope.
Java allows you to use an enhanced for loop with any array or collection (technically,
anything that implements the Iterable interface). One example is a List , an ordered
collection of elements. Code Sample 28.6 contains an example.
418
28.5. Examples
1 List<Integer> list = Arrays.asList(10, 20, 8, 42);
2 int sum = 0;
3 for(Integer a : list) {
4 sum += a;
5 }
Code Sample 28.6.: Enhanced For Loops in Java Example 2
28.5. Examples
28.5.1. Normalizing a Number
Let’s revisit the example from Section 4.1.1 in which we normalize a number by continually
dividing it by 10 until it is less than 10. The code in Code Sample 28.7 specifically refers
to the value 32145.234 but would work equally well with any value of x .
1 double x = 32145.234;
2 int k = 0;
3 while(x > 10) {
4 x = x / 10; //or: x /= 10;
5 k++;
6 }
Code Sample 28.7.: Normalizing a Number with a While Loop in Java
28.5.2. Summation
Let’s revisit the example from Section 4.2.1 in which we computed the sum of integers
1 + 2 + · · · + 10. The code is presented in Code Sample 28.8
We could have easily generalized the code somewhat. Instead of computing a sum up to
a particular number, we could have written it to sum up to another variable n , in which
case the for loop would instead look like the following.
419
28. Loops
1 int sum = 0;
2 for(int i=1; i<=10; i++) {
3 sum += i;
4 }
Code Sample 28.8.: Summation of Numbers using a For Loop in Java
1 for(int i=1; i<=n; i++) {
2 sum += i;
3 }
28.5.3. Nested Loops
Recall that you can write loops within loops by nesting them. The inner loop will execute
fully for each iteration of the outer loop. An example of two nested of loops in Java can
be found in Code Sample 28.9.
1 int i, j;
2 int n = 10;
3 int m = 20;
4 for(i=0; i<n; i++) {
5 for(j=0; j<m; j++) {
6 System.out.printf("(i, j) = (%d, %d)\n", i, j);
7 }
8 }
Code Sample 28.9.: Nested For Loops in Java
The inner loop execute for j = 0, 1, 2, . . . , 19 < m = 20 for a total of 20 iterations. How-
ever, it executes 20 times for each iteration of the outer loop. Since the outer loop execute
for i = 0, 1, 2, . . . , 9 < n = 10, the total number of times the System.out.printf()
statement execute is 10 × 20 = 200. In this example, the sequence
(0, 0), (0, 1), (0, 2), . . . , (0, 19), (1, 0), . . . , (9, 19)
will be printed.
420
28.5. Examples
28.5.4. Paying the Piper
Let’s adapt the solution for the loan amortization schedule we developed in Section 4.7.3.
First, we’ll read the principle, terms, and interest as command line inputs. Adapting the
formula for the monthly payment and using the math library’s Math.pow() function,
we have the following.
1 double monthlyPayment = (monthlyInterestRate * principle) /
2 (1 - pow( (1 + monthlyInterestRate), -n));
However, recall that we may have problems due to accuracy. The monthly payment
could come out to be a fraction of a cent, say $43.871. For accuracy, we need to ensure
that all of the figures for currency are rounded to the nearest cent. The standard math
library does have a Math.round() function, but it only rounds to the nearest whole
number, not the nearest 100th.
However, we can adapt the “off-the-shelf” solution to fit our needs. If we take the number,
multiply it by 100, we get 4387.1 which we can now round to the nearest whole number,
giving us 4387. We can then divide by 100 to get a number that has been rounded to
the nearest 100th! In Java, we could simply do the following.
monthlyPayment = Math.round(monthlyPayment * 100.0) / 100.0;
We can use the same trick to round the monthly interest payment and any other number
expected to be whole cents. To output our numbers, we use System.out.printf() and
take care to align our columns to make make it look nice. To finish our adaptation, we
handle the final month separately to account for an over/under payment due to rounding.
The full solution can be found in Code Sample 28.10.
421
28. Loops
1 public class LoanAmortization {
2
3 public static void main(String args[]) {
4
5 if(args.length != 4) {
6 System.err.println("Usage: principle apr terms");
7 System.exit(1);
8 }
9
10 double principle = Double.parseDouble(args[0]);
11 double apr = Double.parseDouble(args[1]);
12 int n = Integer.parseInt(args[2]);
13
14 double balance = principle;
15 double monthlyInterestRate = apr / 12.0;
16
17 //monthly payment
18 double monthlyPayment = (monthlyInterestRate * principle) /
19 (1 - Math.pow( (1 + monthlyInterestRate), -n));
20 //round to the nearest cent
21 monthlyPayment = Math.round(monthlyPayment * 100.0) / 100.0;
22
23 System.out.printf("Principle: $%.2f\n", principle);
24 System.out.printf("APR: %.4f%%\n", apr*100.0);
25 System.out.printf("Months: %d\n", n);
26 System.out.printf("Monthly Payment: $%.2f\n", monthlyPayment);
27
28 //for the first n-1 payments in a loop:
29 for(int i=1; i<n; i++) {
30 // compute the monthly interest, rounded:
31 double monthlyInterest =
32 Math.round( (balance * monthlyInterestRate) * 100.0) / 100.0;
33 // compute the monthly principle payment
34 double monthlyPrinciplePayment = monthlyPayment - monthlyInterest;
35 // update the balance
36 balance = balance - monthlyPrinciplePayment;
37 // print i, monthly interest, monthly principle, new balance
38 System.out.printf("%d\t$%10.2f $%10.2f $%10.2f\n", i, monthlyInterest,
39 monthlyPrinciplePayment, balance);
40 }
41
42 //handle the last month and last payment separately
43 double lastInterest = Math.round(
44 (balance * monthlyInterestRate) * 100.0) / 100.0;
45 double lastPayment = balance + lastInterest;
46
47 System.out.printf("Last payment = $%.2f\n", lastPayment);
48
49 }
50
51 }
Code Sample 28.10.: Loan Amortization Program in Java
422
29. Methods
As an object-oriented programming language, functions in Java are usually referred to
as methods and are essential to writing programs. The distinction is that a function is
usually a standalone element while methods are functions that are members of a class.
In Java, since everything is a class or belongs to a class, standalone functions cannot be
defined.
In Java you can define your own methods, but they need to be placed within a class.
Usually methods that act on data in the class (or instances of the class, see Chapter 34)
or have common functionality are placed into one class. For example, all the basic math
methods are part of the java.lang.Math class. It is not uncommon to place similar
methods together into one “utility” class.
Java supports method overloading, so within the same class you can define multiple
methods with the same name as long as they differ in either the number (also called
arity) or type of parameters. For example, in the java.lang.Math class, there are
3 versions of the absolute value method, abs() , one that takes/returns an int , one
that takes/returns a double and one for float types. Naming conflicts can easily be
solved by ensuring that you place your methods in a class/package that is unique to your
application.
In Java, the 8 primitive types ( int , double , char , boolean , etc.) are always passed
by value. All object types, however, such as the wrapper classes Integer , Double as
well as String , etc. are passed by reference. That is, the memory address in the JVM
is passed to the method. This is done for efficiency. For objects that are “large” it would
be inefficient to copy the entire object into the call stack in order to pass it to a method.
Though object types are passed by reference, the method cannot necessarily change
them. Recall that the wrapper classes Integer , Double and the String class are all
immutable, meaning that once created they cannot be modified. Though they are passed
by reference, the method that receives them cannot change them.
There are many mutable objects in Java. The StringBuilder class for example is a
mutable object. If you pass a StringBuilder instance to a method, that method is free
to invoke mutator methods on the object such as .append() that change the object’s
state. Since it is the same object as in the calling method, the calling method can “see”
those changes.
423
29. Methods
As of Java 5, you can write and use vararg methods. The System.out.printf()
method is a prime example of this. However, we will not discuss in detail how to do this.
Instead, refer to standard Java documentation. Finally, parameters are not optional in
Java. This is because Java supports method overloading. You can write multiple versions
of the same method that each take a different number of arguments. You can even design
them so that the more specific versions (with fewer arguments) invoke the more general
versions (with more arguments), passing in sensible “defaults.”
29.1. Defining Methods
Defining methods is fairly straightforward. First you create a class to place them in.
Then you provide the method signature along with the body of the method. In addition,
there are several modifiers that you can place in the method signature to specify its
visibility and whether or not the method “belongs” to the class or to instances of the
class. This is a concept we’ll explore in Chapter 34. For now, we’ll only focus on what is
needed to get started.
Typically, the documentation for methods is included with the method definition using
“Javadoc” style comments. Consider the following examples.
1 /**
2 * Computes the sum of the two arguments.
3 * @param a
4 * @param b
5 * @return the sum, <code>a + b</code>
6 */
7 public static int sum(int a, int b) {
8 return (a + b);
9 }
10
11 /**
12 * Computes the Euclidean distance between the 2-D points,
13 * (x1,y1) and (x2,y2).
14 * @param x1
15 * @param y1
16 * @param x2
17 * @param y2
18 * @return
19 */
20 public static double getDistance(double x1, double y1,
21 double x2, double y2) {
22 double xDiff = (x1-x2);
424
29.1. Defining Methods
23 double yDiff = (y1-y2);
24 return Math.sqrt( xDiff * xDiff + yDiff * yDiff);
25 }
26
27 /**
28 * Computes a monthly payment for a loan with the given
29 * principle at the given APR (annual percentage rate) which
30 * is to be repaid over the given number of terms.
31 * @param principle - the amount borrowed
32 * @param apr - the annual percentage rate
33 * @param terms - number of terms (usually months)
34 * @return
35 */
36 public static double getMonthlyPayment(double principle,
37 double apr, int terms) {
38 double rate = (apr / 12.0);
39 double payment = (principle * rate) / (1-Math.pow(1+rate, -terms));
40 return payment;
41 }
In each of the examples above, the first modifier keyword we used was public . This
makes the method visible to all other parts of the code base. Any other piece of code can
invoke the method and take advantage of the functionality it provides. Alternatively, we
could have used the keywords private (which makes it visible only to other methods in
the same class) protected or “package protected” by omitting the modifier altogether.
We will want our methods to be available to other classes, so we’ll make most of them
public . The second modifier is static which makes it so that the method belongs
to the class itself rather than instances of the class. We discuss visibility keywords and
instances in detail in Chapter 34. For now, we will make all of our methods static .
After the modifiers, we provide the method signature including the return type, its
identifier (name), and its parameter list. Method names must follow the same naming rules
as variables: they must begin with an alphabetic character and may contain alphanumeric
characters as well as underscores. However, using modern coding conventions we name
methods using lower camel casing. Immediately after the signature we provide a method
body which contains the code that will be run upon invocation of the method. The
method body is enclosed using opening/closing curly brackets.
425
29. Methods
29.1.1. Void Methods
The keyword void can be used in Java to indicate a method does not return a value,
in which case it is called a “void method.” Though it is not necessary, it is still good
practice to include a return statement.
1 public static void printCopyright()
2 System.out.println("(c) Bourke 2015");
3 return;
4 }
In the example above, we’ve also illustrated how to define a method that has no input
parameters.
29.1.2. Using Methods
Once a method has been defined in a class, you can make use of the method as follows.
First, you may need to import the class itself depending on where it is. For example,
suppose that the examples we’ve presented so far are contained in a class named Utils
(short for “utilities”) which is in a package named unl.cse . Then in the class in which
we want to call some of these functions we would import it using
import unl.cse.Utils;
prior to the class declaration. Once the class has been imported, we can invoke a method
in the class by first referencing the class and using the dot operator to access one of its
methods. For example,
1 int a = 10, b = 20;
2 int c = Utils.sum(a, b); //c contains the value 30
3
4 //invoke a method with literal values:
5 double dist = Utils.getDistance(0.0, 0.0, 10.0, 20.0);
6
7 //invoke a method with a combination:
8 double p = 1500.0;
9 double r = 0.05;
10 double monthlyPayment = Utils.getMonthlyPayment(p, r, 60);
426
29.1. Defining Methods
The Utils.methodName() syntax is used because the methods are static –they belong
to the class and so must be invoked through the class using the class’s name. We’ve
previously seen this syntax when using System. or Math. with the standard JDK
library functions.
29.1.3. Passing By Reference
Java does not allow you the ability to specify if a variable is passed by reference or by
value. Instead, all primitive types are passed by value while all object types are passed
by reference. Moreover, most of the built-in types such as Integer and String are
immutable, even though they are passed by reference, any method that receives them
cannot change them. Only if the passed object is mutable can the method make changes
to it (by invoking its methods).
As an example, consider the following piece of code. The StringBuilder class is a
mutable string object. You can change the string contents stored in a StringBuilder
by calling one of its many methods such as append() , which will add whatever string
you give it to the end.
In the main method, we create two objects, a String and a StringBuilder and
pass it to a method that makes changes to both by appending " world!" to them.
Understand what happens here though. The first line in change() actually creates a
new string and then changes what the parameter variable s references. The reference
to the original string, "Hello" is lost and replaced with the new string. In contrast,
the StringBuilder instance is actually changed via its append() method but is still
the same object.
1 public class Mutability {
2
3 public static void change(String s, StringBuilder sb) {
4 s = s + " world!";
5 sb.append(" world!");
6
7 System.out.println("change: s = " + s);
8 System.out.println("change: sb = " + sb);
9 }
10
11 public static void main(String args[]) {
12 String a = "Hello";
13 StringBuilder b = new StringBuilder("Hello");
14
15 System.out.println("main: s = " + a);
427
29. Methods
16 System.out.println("main: b = " + b);
17
18 change(a, b);
19
20 System.out.println("main after: s = " + a);
21 System.out.println("main after: b = " + b);
22
23 }
24 }
To see this, observe the following output. When we return to the main method, the
original string s is unchanged (since it was immutable). However, the StringBuilder
has been changed by the method.
main: s = Hello
main: b = Hello
change: s = Hello world!
change: sb = Hello world!
main after: s = Hello
main after: b = Hello world!
29.2. Examples
29.2.1. Generalized Rounding
Recall that the math library provides a Math.round() method that rounds a number
to the nearest whole number. We’ve had need to round to cents as well. We now have
the ability to write a method to do this for us. Before we do, however, let’s think more
generally. What if we wanted to round to the nearest tenth? Or what if we wanted to
round to the nearest 10s or 100s place? Let’s write a general purpose rounding method
that allows us to specify which decimal place to round to.
The most natural input would be to specify the place using an integer exponent. That
is, if we wanted to round to the nearest tenth, then we would pass it −1 as 0.1 = 10−1 ,
−2 if we wanted to round to the nearest 100th, etc. In the other direction, passing
in 0 would correspond to the usual round function, 1 to the nearest 10s spot, and so
428
29.2. Examples
on. We could demonstrate good code reuse (as well as good procedural abstraction)
by scaling the input value and reusing the functionality already provided in the math
library’s Math.round() method. We could further define a roundToCents() method
that used our generalized round method. Finally, we could place all of these methods
into RoundUtils Java class for good organization.
1 package unl.cse;
2
3 /**
4 * A collection of rounding utilities
5 *
6 */
7 public class RoundUtils {
8
9 /**
10 * Rounds to the nearest digit specified by the place
11 * argument. In particular to the (10^place)-th digit
12 *
13 * @param x the number to be rounded
14 * @param place the place to be rounded to
15 * @return
16 */
17 public static double roundToPlace(double x, int place) {
18 double scale = Math.pow(10, -place);
19 double rounded = Math.round(x * scale) / scale;
20 return rounded;
21 }
22
23 /**
24 * Rounds to the nearest cent (100th place)
25 *
26 * @param x
27 * @return
28 */
29 public static double roundToCents(double x) {
30 return RoundUtils.roundToPlace(x, -2);
31 }
32
33 }
Observe that this class does not contain a main() method. That means that this class
429
29. Methods
is not executable itself. It only provides functionality to other classes in the code base.
430
30. Error Handling & Exceptions
Java supports error handling through the use of exceptions. Java has many different
predefined types of exceptions that you can use in your own code. It also allows
you to define your own exception types by creating new classes that inherit from the
predefined classes. Java uses the standard try-catch-finally control structure to
handle exceptions and allows you to throw your own exceptions.
30.1. Exceptions
Java defines a base class named Throwable . There are two majors subtypes of
Throwable : Error and Exception . The Error class is used primarily for fatal
errors such as the JVM running out of memory or some other extreme case that your
code cannot reasonably be expected to recover from. There are dozens of types of
exceptions that are subclasses of the standard Java Exception class defined by the
JDK including IOException (and its subclasses such as FileNotFoundException ) or
SQLException (when working with Structured Query Language (SQL) databases). An
important subclass of Exception is RuntimeException which represent unchecked
exceptions that do not need to be explicitly caught (see Section 30.1.4). We’ll mostly
focus on this type of exception.
30.1.1. Catching Exceptions
To catch an exception in Java you can use the standard try-catch control block (and
optionally use the finally block to clean up any resources). Let’s take, for example,
the simple task of reading input from a user using Scanner and manually parsing its
value into an integer. If the user enters a non-numeric value, parsing will fail and result
in a NumberFormatException that we can then catch and handle. For example,
1 Scanner s = new Scanner(System.in);
2 int n = 0;
3
431
30. Error Handling & Exceptions
4 try {
5 String input = s.next();
6 n = Integer.parseInt(input);
7 } catch (NumberFormatException nfe) {
8 System.err.println("You entered invalid data!");
9 System.exit(1);
10 }
In this example, we’ve simply displayed an error message to the standard error output
and exited the program. That is, we’ve made the design decision that this error should
be fatal. We could have chosen to handle this error differently in the catch block.
The code above could have resulted in other exceptions. For example if the Scanner
had failed to read the next token from the standard input, it would have thrown a
NoSuchElementException . We can add as many catch blocks as we want to handle
each exception differently.
1 Scanner s = new Scanner(System.in);
2 int n = 0;
3
4 try {
5 String input = s.next();
6 n = Integer.parseInt(input);
7 } catch (NumberFormatException nfe) {
8 System.err.println("You entered invalid data!");
9 System.exit(1);
10 } catch (NoSuchElementException nsee) {
11 System.err.println("Input reading failed, using default...");
12 n = 20; //a default value
13 } catch(Exception e) {
14 System.err.println("A general exception occurred");
15 e.printStackTrace();
16 System.exit(1);
17 }
Each catch block catches a different type of exception. Thus, the name of the variable
that holds each exception must be different in the chain of catch blocks; nfe , nsee ,
e.
432
30.1. Exceptions
Note that the last catch block was written to catch a generic Exception . This last
block will essentially catch any other type of exception. Much like an if-else-if
statement, the first type of exception that is caught is the block that will be executed
and they are all mutually exclusive. Thus, a “catch all” block like this should always be
the last catch block. The most specific types of exceptions should be caught first and
the most general types should be caught last.
30.1.2. Throwing Exceptions
We can also manually throw an exception. For example, we can throw a generic
RuntimeException using the following.
1 throw new RuntimeException("Something went wrong");
By using a generic RuntimeException , we can attach a message to the exception (which
can be printed by code that catches the exception). If we want more fine-grained control
over the type of exceptions, we need to define our own exceptions.
30.1.3. Creating Custom Exceptions
To create your own exceptions, you need to create a new class to represent the exception
and make it extend RuntimeException by using the keyword extends . This makes
your exception a subclass or subtype of the RuntimeException . This is a concept known
as inheritance in OOP. Consider the example in the previous chapter of computing
the roots of a quadratic polynomial. One possible error situation is when the roots are
complex numbers. We could define a new Java class as follows.
1 public class ComplexRootException extends RuntimeException {
2
3 /**
4 * Constructor that takes an error message
5 */
6 public ComplexRootException(String errorMessage) {
7 super(errorMessage);
8 }
9 }
433
30. Error Handling & Exceptions
Now in our code we can throw and catch this new type of exception.
1 //throw this exception:
2 if( b*b - 4*a*c < 0) {
3 throw new ComplexRootException("Cannot Handle complex roots");
4 }
1 try {
2 r1 = getComplexRoot01(a, b, c);
3 } catch(ComplexRootException cre) {
4 //handle the exception here...
5 }
30.1.4. Checked Exceptions
A checked exception in Java is an exception that must be explicitly caught and han-
dled. For example, the generic Exception class is a checked exception (others include
IOException , SQLException , etc.). If a checked exception is thrown within a block of
code then it must either be caught and handled within that block of code or the method
must be specified to explicitly throw the exception. For example, the method
1 public static void processFile() {
2 Scanner s = new Scanner(new File("data.csv"));
3 }
would not actually compile because Scanner throws a checked FileNotFoundException .
Either we would have to explicitly catch the exception:
1 public static void processFile() {
2 Scanner s = null;
3 try {
4 s = new Scanner(new File("data.csv"));
5 } catch (FileNotFoundException e) {
434
30.1. Exceptions
6 //handle the exception here
7 }
8 }
or we would need to specify that the method processFile() explicitly throws the
exception:
1 public static void processFile() throws FileNotFoundException {
2 Scanner s = new Scanner(new File("data.csv"));
3 }
Doing this, however, would force any code that called the processFile() method to
surround it in a try-catch block and explicitly handle it (or once again, throw it back
to the calling method).
The point of a checked exception is to force code to deal with potential issues that can be
reasonably anticipated (such as the unavailability of a file). However, from another point
of view checked exceptions represent the exact opposite goal of error handling. Namely,
that a function or code block can and should inform the calling function that an error
has occurred, but not explicitly make a decision on how to handle the error. A checked
exception doesn’t make the full decision for the calling function, but it does eliminate
ignoring the error as an option from the calling function.
Java also supports unchecked exceptions which do not need to be explicitly caught. For
example, NumberFormatException or NullPointerException are unchecked excep-
tions. If an unchecked exception is thrown and not caught, it bubbles up through the
call stack until some piece of code does catch it. If no code catches it, it results in a fatal
error and terminates the execution of the JVM.
The RuntimeException class and any of its subclasses are unchecked exceptions. In
our ComplexRootException example above, because we extended RuntimeException
we made it an unchecked exception, allowing the calling function to decide not only how
to handle it, but whether or not to handle it at all. If we had instead decided to extend
Exception we would have made our exception a checked exception.
There is considerable debate as to whether or not checked exceptions are a good thing
(and as to whether or not unchecked exceptions are a good thing). Many1 feel that checked
1
The author included.
435
30. Error Handling & Exceptions
exceptions were a mistake and their usage should be avoided. The rationale behind
checked exceptions is summed up in the following quote from the Java documentation [7].
Here’s the bottom line guideline: If a client can reasonably be expected to
recover from an exception, make it a checked exception. If a client cannot do
anything to recover from the exception, make it an unchecked exception
The problem is that the JDK’s own design violates this principle. For example,
FileNotFoundException is a checked exception; the reasoning being that a program
could reprompt the user for a different file. The problem is the assumption that the
program we are writing is always interactive. In fact most software is not interactive and
is instead designed to interact with other software. Reprompting is not appropriate or
even an option in the vast majority of cases.
As another example, consider Java’s SQL library which allows you to programmatically
connect to an SQL database. Nearly every method in the API explicitly throws a checked
SQLException . It stretches the imagination to understand how our code or even a user
would be able to recover (programmatically at least) from a lost internet connection or a
bad password, etc. In general, you should use unchecked exceptions.
30.2. Enumerated Types
Another way to prevent errors is by restricting the values of a variable that a programmer
is allowed to use. Java allows you to define a special class called an enumerated type
which allow you to define a fixed list of possible values. For example, the days of the week
or months of the year are possible values used in a date. However, they are more-or-less
fixed (no one will be adding a new day of the week or month any time soon). An
enumerated class allows us to define these values using human-readable keywords.
To create an enumerated type class we use the keyword enum (short for enumeration)
instead of class . Since an enumerated type is a class, it must follow the same rules.
It must be in a .java source file of the same name. Inside the enum we provide a
comma-delimited list of keywords to define our enumeration. Consider the following
example.
1 public enum Day {
2 SUNDAY,
3 MONDAY,
4 TUESDAY,
5 WEDNESDAY,
6 THURSDAY,
7 FRIDAY,
436
30.2. Enumerated Types
8 SATURDAY;
9 }
In the example, since the name of the enumeration is Day this declaration must be in a
source file named Day.java . We can now declare variables of this type. The possible
values it can take are restricted to SUNDAY , MONDAY , etc. and we can use these keywords
in our program. However these values belong to the class Day and must be accessed
statically. For example,
1 Day today = Day.MONDAY;
2
3 if(today == Day.SUNDAY || today == Day.SATURDAY) {
4 System.out.println("Its the weekend!");
5 }
Note the naming conventions: the name of the enumerated type follows the same
upper camel casing that all classes use while the enumerated values follow an uppercase
underscore convention. Though our example does not contain a value with multiple
words, if it had, we would have used an underscore to separate them.
Using an enumerated type has two advantages. First, it enforces that only a particular
set of predefined values can be used. You would not be able to assign a value to a
Day variable that was not already defined by the Day enumeration. Second, without
an enumerated type we’d be forced to use a collection of magic numbers to indicate
values. Even for something as simple as the days of the week we’d be constantly trying to
remember: which day is Wednesday again? Do our weeks start with Monday or Sunday?
By using an enumerated type these questions are mostly moot as we can use the more
human-readable keywords and eliminate the guess work.
30.2.1. More Tricks
Every enum type has some additional built-in methods that you can use. For example,
there is a values() method that can be called on the enum that returns an array of
the enum ’s values. You can use an enhanced for loop to iterate over them, for example,
437
30. Error Handling & Exceptions
1 for(Day d : Day.values() {
2 System.out.println(d.name());
3 }
In the example above, we used another feature: each enum value has a name() method
that returns the value as a String . This example would end up printing the following.
SUNDAY
MONDAY
TUESDAY
WEDNESDAY
THURSDAY
FRIDAY
SATURDAY
Of course, we may want more human-oriented representations. To do this we could
override the class’s toString() method to return a better string representation. For
example:
1 public String toString() {
2 if(this == SUNDAY) {
3 return "Sunday";
4 } else if(this == MONDAY) {
5 return "Monday";
6 }
7 ...
8 } else {
9 return "Saturday";
10 }
11 }
Because enum types are full classes in Java, many more tricks can be used that leverage
the power of classes including using additional state and constructors. We will cover
these topics later.
438
31. Arrays
Java allows you to declare and use arrays. Since Java is statically typed, arrays must
also be typed when they are declared and may only hold that particular type of element.
Since Java has automated garbage collection, memory management is greatly simplified.
Finally, in Java, only locally scoped primitives and references are allocated on the program
call stack. As such, there are no static arrays; all arrays are allocated in the heap space.
31.1. Basic Usage
To declare an array reference, you use syntax similar to declaring a regular variable, but
you use square brackets to designate the variable as an array. Arrays for any type of
variable can be created including primitives and objects.
1 int arr[] = null;
2 double values[] = null;
3 String names[] = null;
This example1 only declares 3 references that can refer to an array, it doesn’t actually
create them as the references are all set to null . To create arrays of a particular size,
we need to initialize them using the keyword new .
1 arr = new int[10];
2 values = new double[20];
3 names = new String[5];
1
You may see code examples that use the alternative notation int[] arr = null; . Both are
acceptable. Some would argue that this way is more correct because it keeps the brackets with
the type, avoiding the type-variable name-type separation in our example. Those preferring the
int arr[] = null; notation would argue that it is “more natural” because that is how we
ultimately index the array. Six of one, half-dozen of the other.
439
31. Arrays
Each of these initializations creates a new array (allocated on the heap) of the specified
size (10, 20, and 5 respectively). These arrays can only hold values of the specified type,
int , double , and String respectively. The default value for each element in these
new arrays will be zero for the numeric types and null for object types. Alternatively,
you could use a compound declaration/assignment syntax to initialize specific values:
1 int arr[] = { 2, 3, 5, 7, 11 };
Using this syntax we do not need to specify the size of the array as the compiler is smart
enough to count the number of elements we’ve provided. The elements themselves are
denoted inside curly brackets and delimited with commas. For both types of syntax, the
actual array is always allocated on the heap while the reference variables, arr , values ,
and names are stored in the program call stack.
Indexing
Once an array has been created, its elements can be accessed by indexing them. Java
uses the standard 0-indexing scheme so the first element is at index 0, the second at index
1, etc. Indexing an element involves using the square bracket notation and providing
an integer index. Once indexed, an array element can be treated as a normal variable
and can be used with other operators such as the assignment operator or comparison
operators.
1 arr[0] = 42;
2 if(arr[4] < 0) {
3 System.out.println("negative!");
4 }
5 System.out.println("arr[1] = " + arr[1]);
Recall that an index is actually an offset. The compiler and system know exactly how
many bytes each element takes and so an index i calculates exactly how many bytes
from the first element the i-th element is located at. Consequently it is possible to index
elements that are beyond the range of the array. For example, arr[-1] or arr[5]
would attempt to access an element immediately before the first element and immediately
after the last element. Obviously, these elements are not part of the array. If you
attempt to access an element outside the bounds of an array, the JVM will throw an
IndexOutOfBoundsException which is an unchecked RuntimeException that you can
440
31.1. Basic Usage
catch and handle if you choose. To prevent such an exception you can write code that
does not exceed the bounds of the array. Java arrays have a special length property that
gives you the size of the array. You can access the property using the dot operator, so
arr.length would give the value 5 for the example above.
Iteration
Using the .length property you can design a for loop that increments an index variable
to iterate over the elements in an array.
1 int arr[] = new int[5];
2 for(int i=0; i<arr.length; i++) {
3 arr[i] = 5 * i;
4 }
The for loop above initializes the variable i to zero, corresponding to the first element
in the array. The continuation condition specifies that the loop continues while i is
strictly less than the size of the array denoted using the arr.length property. This for
loop iteration is idiomatic when processing arrays.
In addition, Java (as of version 5) supports foreach loops that allow you to iterate over
the elements of an array without using an index variable. Java refers to these loops as
“enhanced for loops,” but they are essentially foreach loops.
1 for(int a : arr) {
2 System.out.println(a);
3 }
The syntax still uses the keyword for , but instead of an index variable, it specifies the
type and a the loop-scoped variable identifier followed by a colon and the array that you
want to iterate over. Each iteration of the loop updates the variable a to the next value
in the array.
441
31. Arrays
31.2. Dynamic Memory
The use of the keyword new dynamically allocates memory space (on the heap) for the
array. Because Java has automated garbage collection, if the reference to the array goes
out of scope, it is automatically cleaned up by the JVM. This process is automated and
essentially transparent to us. There are sophisticated algorithms and heuristics at work
that determine the “optimal” time to perform garbage collection.
1 int arr[];
2 //create a new array of size 10:
3 arr = new arr[10];
4 //lose the reference by explicitly setting it to null:
5 arr = null;
6 //all references to the old memory are now lost and it is
7 //eligible for garbage collection
8
9 //we can also allocate new memory:
10 arr = new arr[20];
31.3. Using Arrays with Methods
We can pass and return arrays to and from methods in Java. We use the same syntax as
when we define them by specifying a type and using square brackets. As an example, the
following method takes an array of integers and computes its sum.
1 /**
2 * This method computes the sum of elements in the
3 * given array which contains n elements
4 */
5 public static int computeSum(int arr[]) {
6 int sum = 0;
7 for(int i=0; i<size; i++) {
8 sum += arr[i];
9 }
10 return sum;
11 }
442
31.4. Multidimensional Arrays
In Java, arrays are always passed by reference. Though we did not make any changes
to the contents of the passed array in the particular example, in general we could have.
Any such changes would be realized in the calling method. Unfortunately, there is no
mechanism by which we can prevent changes to arrays when passed to methods.2
We can also create an array in a method and return it as a value. For example, the
following method creates a deep copy of the given integer array. That is, a completely
new array that is a distinct copy of the old array. In contrast, a shallow copy would be if
we simply made one reference point to another reference.
1 /**
2 * This method creates a new copy of the given array
3 * and returns it.
4 */
5 public static int [] makeCopy(int a[]) {
6 int copy[] = new int[a.length];
7 for(int i=0; i<n; i++) {
8 copy[i] = a[i];
9 }
10 return copy;
11 }
The method returns an integer array. In fact, this method is so useful, that it is already
provided as part of the Java Software Development Kit (SDK). The class Arrays
contains dozens of utility methods that process arrays. In particular there is a copyOf()
method that allows you to create deep copies of arrays and even allows you to expand or
shrink their size.
31.4. Multidimensional Arrays
Java supports multidimensional arrays, though we’ll only focus on 2-dimensional arrays.
To declare and allocate 2-dimensional arrays, we use two square brackets with two
specified dimensions.
1 int matrix[][] = new int[10][20];
2
The use of the keyword final only prevents us from changing the array reference, not modifying its
contents.
443
31. Arrays
This creates a 2-dimensional array of integers with 10 rows and 20 columns. Once created,
we can index individual elements by specifying row and column indices.
1 for(int i=0; i<matrix.length; i++) {
2 for(int j=0; j<matrix[i].length; j++) {
3 matrix[i][j] = 10;
4 }
5 }
31.5. Dynamic Data Structures
The Java SDK provides a rich assortment of dynamic data structures as alternatives to
arrays including lists, sets and maps. The classes that support and implement these data
structures are defined in the Collections library under the java.util package. We will
cover how to use some of these data structures, but we will not go into the details of how
they are implemented nor the OOP concepts that underly them.
The Java List is an interface that defines a dynamic list data structure. This data
structure provides a dynamic collection that can grow and shrink automatically as you
add and remove elements from it. It is an interface, so it doesn’t actually provide an
implementation, just a specification for the publicly available methods that you can use.
Two common implementations are ArrayList , which uses an array to hold elements,
and LinkedList which stores elements in linked nodes.
To create an instance of either of these lists, you use the new keyword and the following
syntax.
1 List<Integer> a = new ArrayList<Integer>();
2 List<String> b = new LinkedList<String>();
The first line creates a new instance of an ArrayList that is parameterized to hold
Integer types. The second creates a new instance of a LinkedList that has been
parameterized to only hold String types. The parameterization is specified by placing
the parameterized type inside the angle brackets. Because of this parameterization, it
444
31.5. Dynamic Data Structures
would be a compiler error to attempt to add anything other than Integer s to the first
list or anything other than String s to the second. Once these lists have been created,
you can add and remove elements using the add() method.
1 a.add(42);
2 a.add(81);
3 a.add(17);
4
5 b.add("Hello");
6 b.add("World");
7 b.add("Computers!");
The order that you add elements is preserved, so in the first list, the first element would
be 42, the second 81, and the last 17. You can remove elements by specifying an index
of the element to remove. Like arrays, lists are 0-indexed.
1 a.remove(0);
2
3 b.remove(2);
4 b.remove(0);
As you remove elements, the indices are “shifted” down, so that after removing the first
element in the list a , 81 becomes the new first element. Removing the last then the
first element in the list b leaves it with only one element, "World" as the first element
(at index 0).
You can also retrieve elements from a list using 0-indexing and the get() method.
1 List<Double> values = new ArrayList<Double>();
2 values.add(3.14);
3 values.add(2.71);
4 values.add(42.0);
5
6 double x = values.get(1); //get the second value, 2.71
7 double y = values.get(2); //get the third value, 42.0
445
31. Arrays
Any attempt to access an element that lies outside the bounds of the List , will result
in an IndexOutOfBoundsException just as with arrays. To stay within bounds you
can use the size() method to determine how many elements are in the collection. In
this example, values.size() would return an integer value of 3.
Finally, most collections implement the Iterable interface which allows you iterate
over the elements using an enhanced for loop just as with arrays.
1 for(Double x : values) {
2 System.out.println(x);
3 }
There are dozens of other methods that allow you to insert, remove, and retrieve elements
from a Java List ; refer to the documentation for details.
Another type of collection supported by the Collections library is a Set . A set differs
from a list in that it is unordered. There is no concept of the first element or last element.
Moreover, a Set does not allow duplicate elements.3 A commonly used implementation
of the Set interface is the HashSet .
1 Set<String> names = new HashSet<String>();
2
3 names.add("Robin");
4 names.add("Little John");
5 names.add("Marian");
6
7 //this has no effect since Robin is already part of the set:
8 names.add("Robin");
Since the elements in a Set are unordered, we cannot use an index-based get() method
as we did with a List . Fortunately, we can still use an enhanced for loop to iterate over
the elements.
1 for(String name : names) {
2 System.out.println(name);
3
Duplicates are determined by how the equals() and possibly the hashCode() methods are imple-
mented in your particular objects.
446
31.5. Dynamic Data Structures
3 }
When this code executes we cannot expect any particular order of the three names. Any
permutation of the three may be printed. If we executed the loop more than once we
may even observe a different enumeration of the names!
Finally, Java also supports a Map data structure which allows you to store key-value
pairs. The keys and values can be any object type and are specified by two parameters
when you create the map. A common implementation is the HashMap .
1 //define a map that maps integers (keys) to strings (values):
2 Map<Integer, String> numbers = new HashMap<Integer, String>();
3
4 //add key-value pairs:
5 numbers.add(10, "ten");
6 numbers.add(20, "twenty");
7
8 //retrieve values given a key:
9 String name = numbers.get(20); //name equals "twenty"
10
11 //invalid mappings result in null:
12 name = numbers.get(30); //name is null
The Collections library is much more extensive than what we’ve presented here. It
includes implementations of stacks, queues, hash tables, balanced binary search trees,
and many other dynamic data structure implementations.
447
32. Strings
As we’ve previously seen, Java has a String class in the standard JDK. Internally, Java
strings are stored as arrays of characters. However, because of the String class, we
never directly interact with this representation. Making using strings much easier than
in other languages. Java strings have also supported Unicode since version 1.
Java provides many methods as part of the String class that can be used to process
and manipulate strings. These methods do not change the strings since strings in Java
are immutable. Instead, these methods operate by returning a new modified string that
can then be stored in a variable.
32.1. Basics
We can declare String variables and assign them values using the regular assignment
operator.
1 String firstName = "Thomas";
2 String lastName = "Waits";
3
4 //we can also reassign values
5 firstName = "Tom";
Note that the reassignment in the last line in the example does not change the original
string. It just makes the variable firstName point to a new string. If there are no other
references to the old string, it becomes eligible for garbage collection and the JVM takes
care of it. Strings can be copied using the String class’s copy constructor:
String copy = new String(firstName);
However, since strings are immutable, there is rarely reason to create such a deep copy.
Though you can’t change individual characters in a string, you can access them using the
449
32. Strings
charAt() method and providing an index. Characters in a string are 0-indexed just as
with elements in arrays.
1 String fullName = "Tom Waits";
2 //access individual characters:
3 char firstInitial = fullName.charAt(0); //'T'
4 char lastInitial = fullName.charAt(4); //'W'
5
6 if(fullName.charAt(8) == 's') {
7 ...
8 }
32.2. String Methods
The String class provides dozens of convenient methods that allow you to process
and modify strings. We highlight a few of the more common ones here. A full list of
supported functions can be found in standard documentation.
Length
When accessing individual characters in a string, it is necessary to know the length of
the string so that we do not access invalid characters. The length() method returns
an int that represents the number of characters in the string.
1 String s = "Hello World!";
2 char last = s.charAt(s.length()-1);
3 //last is '!'
Using this method we can easily iterate over each character in a string.
1 for(int i=0; i<fullName.length(); i++) {
2 System.out.printf("fullName[%d] = %c\n", i, fullName.charAt(i));
3 }
4
450
32.2. String Methods
5 //or we can use toCharArray and an enhanced for loop:
6 for(char c : fullName.toCharArray()) {
7 System.out.println(c);
8 }
Concatenation
Java has a concatenation operator built into the language. The familiar plus sign, + can
be used to combine one or more strings by appending them to each other. Concatenation
results in a new string.
1 String firstName = "Tom";
2 String lastName = "Waits";
3
4 String formattedName = lastName + ", " + firstName;
5 //formattedName now contains "Waits, Tom"
Concatenation also works with numeric types and even objects.
1 int x = 10;
2 double y = 3.14;
3
4 String s = "Hello, x is " + x + " and y = " + y;
5 //s contains "Hello, x is 10 and y = 3.14"
When used with objects, the concatenation operator internally invokes the object’s
toString() method. The plus operator as a concatenation operator is actually syntactic
sugar. When the code is compiled, it is actually replaced with equivalent code that uses a
series of the StringBuilder class’s (a mutable version of the String class) append()
method. The compiler will actually replace the code using the concatenation operator
with code that does not use the concatenation operator. The example above would be
replaced with something like the following.
451
32. Strings
1 String firstName = "Tom";
2 String lastName = "Waits";
3
4 String formattedName = new StringBuilder(lastName)
5 .append(", ")
6 .append(firstName)
7 .toString();
You can also use the StringBuilder class yourself directly.
Computing a Substring
There are two methods that allow you to compute a substring of a string. The first allows
you to specify a beginning index with the entire remainder of the string being included
in the returned string. The second allows you to specify a beginning index as well as an
ending index. In both cases, the beginning index is inclusive (that is the resulting string
includes the character at that index), but in the second, the ending index is exclusive
(the character at the end index is not included).
1 String name = "Thomas Alan Waits";
2
3 String firstName = name.substring(0, 6); //"Thomas"
4 String middleName = name.substring(7, 11); //"Alan"
5 String lastName = name.substring(12); //"Waits"
The result of the two argument substring() method will always have length equal to
endIndex - beginIndex .
32.3. Arrays of Strings
We often need to deal with collections of strings. In Java, we can define arrays of strings.
Indeed, we’ve seen arrays of strings before. In a Java class’s main() method, command
line arguments are passed as an array of strings:
public static void main(String args[])
452
32.4. Comparisons
We can create our own arrays of strings similar to how we created arrays of int and
double types.
1 //create an array that can hold 5 strings
2 String names[] = new String[5];
3
4 names[0] = "Margaret Hamilton";
5 names[1] = "Ada Lovelace";
6 names[2] = "Grace Hopper";
7 names[3] = "Marie Curie";
8 names[4] = "Hedy Lamarr";
Better yet, we can use dynamic collections such as a List or a Set of strings.
1 List<String> names = new ArrayList<String>();
2
3 names.add("Margaret Hamilton");
4 names.add("Ada Lovelace");
5 names.add("Grace Hopper");
6 names.add("Marie Curie");
7 names.add("Hedy Lamarr");
8
9 System.out.println(names.get(2)); //prints "Grace Hopper"
32.4. Comparisons
When comparing strings in Java, we cannot use the numerical comparison operators such
as == , or < . Because strings are objects, using these operators actually compares the
variables’ memory addresses.
1 String a = new String("Hello World!");
2 String b = new String("Hello World!");
3
4 if(a == b) {
5 System.out.println("strings match!");
453
32. Strings
6 }
The code above will not print anything even though the strings a and b have the same
content. This is because a == b is comparing the memory address of the two variables.
Since they point to different memory addresses (created by two separate calls to the
constructors) they will not be equal.
Instead, the String class provides a compareTo() method1 that takes another string
and returns something negative, zero, or something positive depending on the relative
lexicographic ordering of the strings.
1 int x;
2 String a = "apple";
3 String b = "zelda";
4 String c = "Hello";
5 x = a.compareTo("banana"); //x is negative
6 x = b.compareTo("mario"); //x is positive
7 x = c.compareTo("Hello"); //x is zero
8
9 //shorter strings precede longer strings:
10 x = a.compareTo("apples"); //x is negative
11
12 String d = "Apple";
13 x = d.compareTo("apple"); //x is negative
In the last example, "Apple" precedes "apple" since uppercase letters are ordered
before lowercase letters according to the ASCII table. We can also make case-insensitive
comparisons using the compareToIgnoreCase() method which works the same way.
Here, d.compareToIgnoreCase("apple") will return zero as the two strings are the
same ignoring the cases.
Note that the commonly used equals() method only returns true or false depending
on whether or not two strings are the same or different. They cannot be used to provide
a relative ordering of two strings.
1
This method is part of the String class due to the fact that strings implement the Comparable
interface which defines a lexicographic ordering.
454
32.5. Tokenizing
1 String a = "apple";
2 String b = "apple";
3 String c = "Hello";
4
5 boolean result;
6 result = a.equals(b); //true
7 result = a.equals(c); //false
32.5. Tokenizing
Recall that tokenizing is the process of splitting up a string using some delimiter. For
example, the comma delimited string, "Smith,Joe,12345678,1985-09-08" contains
four pieces of data delimited by a comma. Our aim is to split this string up into four
separate strings so that we can process each one.
Java provides a very simple method to do this called split() that takes a string
delimiter and returns an array of strings containing the tokens. For example,
1 String data = "Smith,Joe,12345678,1985-09-08";
2
3 String tokens[] = data.split(",");
4 //tokens is { "Smith", "Joe", "12345678", "1985-09-08" }
5
6 String dateTokens[] = tokens[3].split("-");
7 //dateTokens is now { "1985", "09", "08" }
The delimiter this method uses is actually a regular expression; a sequence of characters
that define a search pattern in which special characters can be used to define complex
patterns. For example, the complex expression,
^[+-]?(\d+(\.\d+)?|\.\d+)([eE][+-]?\d+)?$
will match any valid numerical value including scientific notation. We will not cover
regular expressions in depth, but to demonstrate their usefulness, here’s an example by
which you can split a string along any and all whitespace:
455
32. Strings
1 String s = "Alpha Beta \t Gamma \n Delta \t\nEpsilon";
2 String tokens[] = s.split("[\\s]+");
3 //tokens is now { "Alpha", "Beta", "Gamma", "Delta", "Epsilon" }
456
33. File I/O
Java provides several different classes and utilities that support manipulating and pro-
cessing files. In general, most file operations may result in an IOException , a checked
exception that must be caught and handled.
33.1. File Input
Though there are several ways that you can do file input, the easiest is to use the
familiar Scanner class. We’ve previously used this class to read from the standard
input, System.in , but it can also be used to read from a file using the File class
(in the java.io package). The File class is just a representation of a file resource
and does not represent the actual file (it cannot be opened and closed). To initialize a
Scanner to read from a file you can use the following.
1 Scanner s = null;
2 try {
3 s = new Scanner(new File("/user/apps/data.txt"));
4 } catch (FileNotFoundException e) {
5 //handle the exception here
6 }
When initializing a Scanner to read from a file, the exception, FileNotFoundException
must be caught and handled as it is a checked exception. Otherwise, once created, the
Scanner class does not throw any checked exceptions.
Once created, you can use the usual methods and functionality provided by the Scanner
class including reading the nextInt() , nextDouble() , next string using next() or
even the entire nextLine() . This last one can be used in conjunction with hasNext()
to read an entire file, line-by-line.
457
33. File I/O
1 String line;
2 while(s.hasNext()) {
3 line = s.nextLine();
4 //process the line
5 }
Once we are done reading the file, we can close the Scanner to free up resources:
s.close(); . We could have placed all this code within one large try-catch block
with perhaps a finally block to close the Scanner once were were done to ensure
that it would be closed regardless of any exceptions. However, Java 7 introduced a new
construct, the try-with-resources statement.
The try-with-resources statement allows us to place the initialization of a “closeable”
resource (defined by the AutoCloseable interface) into the try statement. The JVM
will then automatically close this resource upon the conclusion of the try-catch block.
We can still provide a finally block if we wish, but this relieves us of the need to
explicitly close the resource in a finally block. A full example:
1 File f = new File("/user/apps/data.txt");
2 //initialize a Scanner in the try statement
3 try (Scanner s = new Scanner(f)) {
4 String line;
5 while(s.hasNext()) {
6 line = s.nextLine();
7 //process the line
8 }
9 } catch (Exception e) {
10 //handle the exception here
11 }
Using the Scanner class to do file input offers a more abstract interaction with a file.
It also uses a buffered input stream for performance. Binary files can still be read using
nextByte() . However, when dealing with binary files, the better solution is to use a
class that models and abstracts the underlying file. For example, if you are reading or
writing an image file, you should use the java.awt.Image class to read and write to
files. The JDK and other libraries offer a wide variety of classes to model all kinds of
data.
458
33.2. File Output
33.2. File Output
There are several ways to achieve file output, but we’ll look at the simplest and most
useful way. Java provides a PrintWriter class which offers many convenient methods for
writing primitive and String types in a formatted manner. It has the usual print()
and println() methods that we are familiar with as well as a printf() style method
for formatting.
PrintWriter is also buffered, depending on how you instantiate it, it might “flush” its
buffer after every endline character or you may do it manually by invoking the flush()
method.
1 int x = 10;
2 double pi = 3.14;
3 PrintWriter pw = null;
4 try {
5 pw = new PrintWriter(new File("data.txt"));
6 } catch(FileNotFoundException fnfe) {
7 throw new RuntimeException(fnfe);
8 }
9
10 pw.println("Hello World!");
11 pw.println(x);
12 pw.printf("x = %d, pi = %f\n", x, pi);
13
14 pw.close();
The close() method will conveniently close all the underlying resources and flush the
buffer for us, writing any buffered data to the file. In addition, PrintWriter implements
AutoCloseable and so it can be used in a try-catch-with resources statement.
Another “convenience” of PrintWriter is that is “swallows” exceptions (just as the
Scanner class did). That means we don’t have to deal explicitly with the checked
IOException s that the underlying class(es) throw as the PrintWriter silently catches
them (though doesn’t handle them). However, this can also be viewed as a disadvantage
in that if we want to do error handling, we need to manually check if there was an
error (using checkError() ). The PrintWriter class is intended mostly for formatted
output. It does not provide a way to write binary data to an output file. Just as with
binary input, it is best to use a class that abstracts the file type and data so that we
don’t have to deal with the low-level details of the binary data.
459
33. File I/O
However, if necessary, binary output can be done using a FileOutputStream . Typically,
you can load all your data into a byte array and dump it all at once.
1 byte data[] = ...;
2 try (FileOutputStream fos =
3 new FileOutputStream(new File("outfile.bin")) ){
4 fos.write(data);
5 } catch(IOException ioe) {
6 throw new RuntimeException(ioe);
7 }
This example uses a try-with-resources statement so the FileOutputStream will auto-
matically be closed for us. You could wrap a FileOutputStream in a BufferedWriter ,
but it will likely not gain you anything in terms of performance. A buffered output
stream is better if your writes are frequent and “small.” Here small means smaller than
the size of the buffer ( BufferedWriter is typically 8KB). Writing several individual
integer values for example would be better done by buffering them and writing them
all at once. In our example, we simply wanted to dump a bunch of data, likely more
than 8KB in practice, all at once. Moreover, using a BufferedWriter would lose us
the ability to write raw byte data.
460
34. Objects
Java is a class-based object-oriented programming language, meaning that it facilitates
the creation of objects through the use of classes. Classes are essentially “blueprints”
for creating instances of objects. We’ve been implicitly using classes all along since
everything in Java is a class or belongs to a class. Now, however, we will start using
classes in more depth rather than simply using static methods.
An object is an entity that is characterized by identity, state and behavior. The identity
of an object is an aspect that distinguishes it from other objects. The variables and
values that a variable takes on within an object is its state. Typically the variables that
belong to an object are referred to as member variables. Finally, an object may also
have functions that operate on the data of an object. In the context of object-oriented
programming, a function that belongs to an object is referred to as a member method.
As a class-based object-oriented language, Java implements objects using classes. A
class is essentially a blueprint for creating instances of the class. A class simply specifies
the member variables and member methods that belong to instances of the class. We
can create actual instances through the use of special constructor methods. To begin,
let’s define a class that models a student by defining member variables to support a first
name, last name, a unique identifier, and GPA.
To declare a class, we use the class keyword. Inside the class (denoted by curly
brackets), we place any code that belongs to the class. To declare member variables
within a class, we use the normal variable declaration syntax, but we do so outside any
methods.
1 package unl.cse;
2
3 public class Student {
4
5 //member variables:
6 String firstName;
7 String lastName;
8 int id;
9 double gpa;
10
11 }
461
34. Objects
Recall that a package declaration allows you to organize classes and code within a package
(directory) hierarchy. Moreover, source code for a class must be in a source file with the
same name (and is case sensitive) with the .java extension. Our Student class would
need to be in a file named Student.java and would be compiled to a class named
Student.class .
34.1. Data Visibility
Recall that encapsulation involves not only the grouping of data, but the protection
of data. To provide for the protection of data, Java defines several visibility keywords
that specify what segments of code can “see” the variables. Visibility in this context
determines whether or not a segment of code can access and/or modify the variable’s
value. Java defines four levels of visibility using they keywords public , protected
and private (a fourth level is defined by the absence of any of these keywords). Each
of these keywords can be applied to both member variables and member methods.
• public – This is the least restrictive visibility level and makes the member variable
visible to every class.
• protected – This is a bit more restrictive and makes it so that the member
variable is only visible to the code in the same class, same package, or any subclass
of the class.1
• No modifier – the absence of any modifier means that the member variable is visible
to any class in the same package. This is also referred to as the default or package
protected visibility level.
• private – this is the most restrictive visibility level, private member variables
are only visible to instances of the class itself. As we’ll see later this also means
that the member variables are visible between instances. That is, one instance can
see another instance’s variables.
Table 34.1 summarizes these four keywords with respect to their access levels. It is
important to understand that protection in the context of encapsulation and does not
involve protection in the sense of “security.” The protection is this context is a design
principle. Limiting the access of variables only affects how the rest of the code base
interacts with our class and its data. Encapsulation can easily be “broken” by other
1
Subclasses are involved with inheritance, another object-oriented programming concept that we will
not discuss here).
462
34.2. Methods
code (through reflection2 or other means) and the values of variables can be accessed or
modified.
Modifier Class Package Subclass World
public Y Y Y Y
protected Y Y Y N
none (default) Y Y N N
private Y N N N
Table 34.1.: Java Visibility Keywords & Access Levels
We now update our class declaration to incorporate these visibility keywords. In general,
it is best practice to make member variables private and control access to them via
accessor and mutator methods (see below) unless there is a compelling design reason to
increase their visibility.
1 package unl.cse;
2
3 public class Student {
4
5 //member variables:
6 private String firstName;
7 private String lastName;
8 private int id;
9 private double gpa;
10
11 }
34.2. Methods
The third aspect of encapsulation involves the grouping of methods that act on an object’s
data (its state). Within a class, we can declare member methods using the syntax we’re
already familiar with. We declare a member method by providing a signature and body.
We can use the same visibility keywords as with member variables in order to allow or
restrict access to the methods. With methods, visibility and access determine whether or
not the method may be invoked.
2
Reflection is a mechanism by which you can write code that modifies other code at runtime. It is
more of an aspect-oriented programming paradigm.
463
34. Objects
In contrast to the methods we defined in Chapter 29, when defining a member method,
we do not use the static keyword. Making a variable or a method static means that
the method belongs to the class and not to instances of the class. We add to our example
by providing two public methods that compute and return a result on the member
variables. We also use Javadoc style comments to document each member method.
1 package unl.cse;
2
3 public class Student {
4
5 //member variables:
6 private String firstName;
7 private String lastName;
8 private int id;
9 private double gpa;
10
11 /**
12 * Returns a formatted String of the Student's
13 * name as Last, First.
14 */
15 public String getFormattedName() {
16 return lastName + ", " + firstName;
17 }
18
19 /**
20 * Scales the GPA, which is assumed to be on a
21 * 4.0 scale to a percentage.
22 */
23 public double getGpaAsPercentage() {
24 return gpa / 4.0;
25 }
26
27 }
34.2.1. Accessor & Mutator Methods
Since we have made all the member variables private , no code outside the class may
access or modify their values. It is generally good practice to make member variables
private to restrict access. However, if we still want code outside the object to access
464
34.2. Methods
or mutate (that is, change) an instance’s variables, we can define accessor and mutator
methods (or just simply getter and setter methods) to facilitate this.
Each getter method returns the value of the instance’s variable while each setter method
takes a value and sets the instance’s variable to the new value. It is common to name
each getter/setter by prefixing a get and set to the variable’s name using lower camel
casing. For example:
1 public String getFirstName() {
2 return firstName;
3 }
4
5 public void setFirstName(String firstName) {
6 firstName = firstName;
7 }
In the setter example, there is a problem: the code has no effect. There are two variables
named firstName : the instance’s member variable and the variable in the method
parameter. The scoping rules of Java mean that the parameter variable name(s) take
precedent. This code has no effect because it is setting the parameter variable to itself.
It is essentially doing the following.
1 int a = 10;
2 a = a;
To solve this, we use something called open recursion. When an instance of a class is
created, for example,
Student s = ...;
the reference variable s is how we can refer to it. This variable, however, exists outside
the class. Inside the class, we need a way to refer to the instance itself. In Java we use
the keyword this to refer to the instance inside the class. For example, the member
variables of an instance can be accessed using the this keyword along with the dot
operator (more below). In our example, this.firstName would refer to the instance’s
firstName and not to the parameter variable. Even when it is not necessary to use the
this keyword (as in the getter example above) it is still best practice to do so. Our
updated getters and setter methods would thus look like the following.
465
34. Objects
1 public String getFirstName() {
2 return this.firstName;
3 }
4
5 public void setFirstName(String firstName) {
6 this.firstName = firstName;
7 }
One advantage to using getters and setters (as opposed to naively making everything
public ) is that you can have greater control over the values that your variables can
take. For example, we may want to do some data validation by rejecting null values or
invalid values. For example:
1 public void setFirstName(String firstName) {
2 if(firstName == null) {
3 throw new IllegalArgumentException("names cannot be null");
4 } else {
5 this.firstName = firstName;
6 }
7 }
8
9 public void setGpa(double gpa) {
10 if(gpa < 0.0 || gpa > 4.0) {
11 throw new IllegalArgumentException("GPAs must be in [0, 4.0]");
12 } else {
13 this.gpa = gpa;
14 }
15 }
Controlling access of member variables through getters and setters is good encapsulation.
Doing so makes your code more predictable and more testable. Making your member
variables public means that any piece of code can change their values. There is no way
to do validation or prevent bad values.
In fact, it is good practice to not even have setter methods. If the value of member
variables cannot be changed, it makes the object immutable. We’ve seen this before with
the built-in wrapper classes ( Integer , String , etc.). Immutability is a nice property
because it makes instances of the class thread-safe. That is, we can use instances of
466
34.3. Constructors
the class in a multithreaded program without having to worry about threads changing
the state of instances on one another. Immutable classes are also safer to use in certain
collections such as a Set . Elements in a Set are unique; attempting to add a duplicate
element will have no effect on the Set . However, if the elements we add are mutable,
we could end up with duplicates (see Section 34.5).
34.3. Constructors
If we make the (good) design decision to make our class immutable, we still need a
way to initialize the object’s member variables. This is where constructors come in. A
constructor is a special method that specifies how an object is constructed. With built-in
primitive variables such as an int , the Java language (compiler and JVM) “know” how
to interpret and assign a value to such a variable. However, with user-defined objects
such as our Student class, we need to specify how the object is created.
A constructor method has special syntax. Though it may still one of the visibility
keywords, it has no return type and its name is the same as the class. A constructor may
take any number of parameters. For example, the following constructor allows someone
to construct a Student instance and specify all four member variables.
1 public Student(String firstName, String lastName,
2 int id, double gpa) {
3 this.firstName = firstName;
4 this.lastName = lastName;
5 this.id = id;
6 this.gpa = gpa;
7 }
Java allows us to define multiple constructors, or even no constructor at all. If we
do not specify a constructor, Java provides a default, no argument constructor. This
constructor uses default values for all member variables (zero for numerical types, false
for boolean types, and null for objects). If we do specify a constructor, this default
constructor becomes unavailable. However, we can always “restore” it by explicitly
defining it.
1 public Student() {
2 this.firstName = null;
3 this.lastName = null;
4 this.id = 0;
467
34. Objects
5 this.gpa = 0.0;
6 }
Alternatively, we can define constructors that accept a subset of variable values.
1 public Student(String firstName, String lastName) {
2 this.firstName = firstName;
3 this.lastName = lastName;
4 this.id = 0;
5 this.gpa = 0.0;
6 }
In both of these examples, we repeated a lot of code. One shortcut is to make all your
constructors call the most general constructor. To invoke another constructor, we use
the this keyword as a method call. For example:
1 public Student() {
2 this(null, null, 0, 0.0);
3 }
4
5 public Student(String firstName, String lastName) {
6 this(firstName, lastName, 0, 0.0);
7 }
Another, very useful type of constructor is the copy constructor that allows you to make
a copy of an instance by passing it to a constructor. The following example copies each
of the member variables of s into this .
1 public Student(Student s) {
2 this(s.firstName, s.lastName, s.id, s.gpa);
3 }
468
34.4. Usage
34.4. Usage
Once we have defined our class and its constructors, we can create and use instances of
it. Just as with regular variables, we need to declare instances of a class by providing
the type and a variable name. For example:
1 Student s = null;
2 Student t = null;
Both of these declarations are simply just reference variables. They may refer to an
instance of the class Student , but we have initialized them to null . To make these
variables refer to valid instances, we invoke a constructor by using the new keyword and
providing arguments to the constructor.
1 Student s = new Student("Alan", "Turing", 1234, 3.4);
2 Student t = new Student("Margaret", "Hamilton", 4321, 3.9);
The process of creating a new instance by invoking a constructor is referred to as
instantiation. Once instances have been instantiated, they can be used by invoking their
methods via the dot operator. The dot operator is used to select a member variable (if
public ) or member method.
1 System.out.println(s.getFormattedName());
2
3 if(s.getGpa() < t.getGpa()) {
4 System.out.println(t.getFirstName() + " has a better GPA");
5 }
34.5. Common Methods
Every class in Java has several methods that they inherit from the java.lang.Object
class. Here, we will highlight three of these important methods.
469
34. Objects
The toString() method returns a String representation of the object. However, the
default behavior that all classes inherit from the Object class is that it returns a string
containing the fully qualified class name (package and class name) along with a hexadeci-
mal representation of the JVM memory address at which the instance is stored. An exam-
ple with our Student class may produce something like: unl.cse.Student@272d7a10 .
We can override this functionality and change the behavior of the toString() method
to return whatever we want. To do so, we simply define the function (with a signature
that matches the toString() method in the Object class) in our class.
1 public String toString() {
2 return String.format("%s, %s (ID = %d); %.2f",
3 this.lastName,
4 this.firstName,
5 this.id,
6 this.gpa);
7 }
This example would return a String containing something similar to
"Hamilton, Margaret (ID = 4321); 3.90"
The toString() method is a very convenient way to print instances of your class.
Two other methods, the equals() and the hashCode() method are used extensively
by other classes such as the Collections library. The equals() method:
public boolean equals(Object obj)
takes another object obj and returns true or false depending on whether or not
the instance is “equal” to obj . Recall that identity is one of the defining characteristics
of objects. This method is how Java achieves identity; this method allows you to define
what “equality” means. By default, the behavior inherited from the Object class simply
checks if the object, this and the passed object, obj are located at the same memory
address, essentially (this == obj) .
However, conceptually we may want different behavior. For example, two Student
objects may be the same if they have the same id value (it is, after all supposed to be
a unique identifier). Alternatively, we may consider two objects to be the same if every
member variable holds the same value. Even with only a four member variables, the
logic can get quite complicated, especially if we have to account for null values. For
470
34.5. Common Methods
this reason, many IDEs provide functionality to automatically generate such methods.
The following example was generated by an IDE.
1 public boolean equals(Object obj) {
2 if (this == obj) {
3 return true;
4 }
5 if (obj == null) {
6 return false;
7 }
8 if (!(obj instanceof Student)) {
9 return false;
10 }
11 Student other = (Student) obj;
12 if (firstName == null) {
13 if (other.firstName != null) {
14 return false;
15 }
16 } else if (!firstName.equals(other.firstName)) {
17 return false;
18 }
19 if (Double.doubleToLongBits(gpa) !=
20 Double.doubleToLongBits(other.gpa)) {
21 return false;
22 }
23 if (lastName == null) {
24 if (other.lastName != null) {
25 return false;
26 }
27 } else if (!lastName.equals(other.lastName)) {
28 return false;
29 }
30 if (nuid != other.nuid) {
31 return false;
32 }
33 return true;
34 }
Related, the hashCode() method,
public int hashCode()
returns an integer representation of the object. As with the equals() method, the
default behavior is to return a value associated with the memory address of the instance.
In general, however, the behavior should be overridden to be based on the entire state
of the object. A hash is simply a function that maps data to a “small” set of values.
In this context, we are mapping object instances to integers so that they can be used
in hash table-based data structures such as HashSet or HashMap . The hashCode()
method is used to map an instance to an integer so that it can be used as an index in
these data structures. Again, most IDEs will provide functionality to generate a good
implementation for the hashCode() method (as the example below is).
How ever you design the equals() and hashCode() method, there is a requirement:
471
34. Objects
if two instances are equal (that is, equals() returns true ) then they must have the
same hashCode() value. This requirement is necessary to ensure that hash table-based
data structures operate properly. It is okay if unequal objects have equal or unequal
hash values. This rule only applies when the objects are equal.
1 public int hashCode() {
2 final int prime = 31;
3 int result = 1;
4 result = prime * result + ((firstName == null) ? 0 :
5 firstName.hashCode());
6 long temp;
7 temp = Double.doubleToLongBits(gpa);
8 result = prime * result + (int) (temp ^ (temp >>> 32));
9 result = prime * result + ((lastName == null) ? 0 :
10 lastName.hashCode());
11 result = prime * result + nuid;
12 return result;
13 }
34.6. Composition
Another important concept when designing classes is composition. Composition is a
mechanism by which an object is made up of other objects. One object is said to “own”
an instance of another object. We’ve already seen this with our Student example: the
Student class owns two instances of the String class.
To illustrate the importance of composition, we could extend the design of our Student
class to include a date of birth. However, a date of birth is also made up of multiple
pieces of data (a year, a month, a date, and maybe even a time and/or locale). We could
design our own date/time class to model this, but its generally best to use what the
language already provides. Java 8 introduced the java.time package in which there
are many updated and improved classes for dealing with dates and times. The class
LocalDate for example, could be used to model a date of birth:
1 private LocalDate dateOfBirth;
472
34.6. Composition
We can take this concept further and design our classes to own collections of other
classes. For example, we could define a Course class and then update our Student
class to own a collection of Course objects representing a student’s class schedule (this
type of collection ownership is sometimes referred to as aggregation rather than strict
composition).
1 private Set<Course> schedule;
Both of these updates beg the question: who is responsible for instantiating the instances
of dateOfBirth and the schedule ? Should we force the “outside” user of our Student
class to build the LocalDate instance and pass it to a constructor? Should we allow
the outside code to simply provide us a date of birth as a string? Both of these design
choices have advantages and disadvantages that have to be considered.
What about the course schedule? We could require that a user provide the constructor
with a pre-computed Set of courses, but care must be taken. Consider the following
(partial) example.
1 public Student(..., Set<Course> schedule) {
2 ...
3 this.schedule = schedule;
4 }
This is an example of a shallow copy: the instance’s schedule variable is referencing
the same collection as the parameter variable. If a change is made, say a course is added,
via one of these references, then the change is effectively made for both. If we are going
to design it this way, it would be better to make a deep copy of the set of courses:
1 public Student(..., Set<Course> schedule) {
2 ...
3 this.schedule = new HashSet<Course>(schedule);
4 }
This is the same pattern we described above: almost every data structure in the Java
Collections library has a (deep) copy constructor.
473
34. Objects
Alternatively, we could make our design a bit more flexible by allowing the construction of
a Student instance without having to provide a course schedule. Instead, we could add
a method that allowed the outside code to add a course to the schedule . Something
like the following.
1 public void addCourse(Course c) {
2 this.schedule.add(c);
3 }
This adds some flexibility to our object, but removes the immutability property. Design
is always a balance and compromise between competing considerations.
34.7. Example
We present the full and completed Student class in Code Sample 34.1.
474
34.7. Example
1 package unl.cse;
2
3 public class Student {
4
5 private String firstName;
6 private String lastName;
7 private int id;
8 private double gpa;
9
10 public Student(String firstName, String lastName, int id, double gpa) {
11 this.firstName = firstName;
12 this.lastName = lastName;
13 this.id = id;
14 this.gpa = gpa;
15 }
16
17 public Student() {
18 this(null, null, 0, 0.0);
19 }
20
21 public Student(String firstName, String lastName) {
22 this(firstName, lastName, 0, 0.0);
23 }
24
25 public String getFirstName() {
26 return firstName;
27 }
28
29 public String getLastName() {
30 return lastName;
31 }
32
33 public int getId() {
34 return id;
35 }
36
37 public double getGpa() {
38 return gpa;
39 }
40
41 /**
42 * Returns a formatted String of the Student's
43 * name as Last, First.
44 */
45 public String getFormattedName() {
46 return lastName + ", " + firstName;
475
34. Objects
47 }
48
49 /**
50 * Scales the GPA, which is assumed to be on a
51 * 4.0 scale to a percentage.
52 */
53 public double getGpaAsPercentage() {
54 return gpa / 4.0;
55 }
56
57 @Override
58 public String toString() {
59 return String.format("%s, %s (ID = %d); %.2f",
60 this.lastName,
61 this.firstName,
62 this.id,
63 this.gpa);
64 }
65
66 @Override
67 public int hashCode() {
68 final int prime = 31;
69 int result = 1;
70 result = prime * result + ((firstName == null) ? 0 : firstName.hashCode());
71 long temp;
72 temp = Double.doubleToLongBits(gpa);
73 result = prime * result + (int) (temp ^ (temp >>> 32));
74 result = prime * result + id;
75 result = prime * result + ((lastName == null) ? 0 : lastName.hashCode());
76 return result;
77 }
78
79
80 @Override
81 public boolean equals(Object obj) {
82 if (this == obj) {
83 return true;
84 }
85 if (obj == null) {
86 return false;
87 }
88 if (!(obj instanceof Student)) {
89 return false;
90 }
91 Student other = (Student) obj;
92 if (firstName == null) {
476
34.7. Example
93 if (other.firstName != null) {
94 return false;
95 }
96 } else if (!firstName.equals(other.firstName)) {
97 return false;
98 }
99 if (Double.doubleToLongBits(gpa) != Double.doubleToLongBits(other.gpa)) {
100 return false;
101 }
102 if (id != other.id) {
103 return false;
104 }
105 if (lastName == null) {
106 if (other.lastName != null) {
107 return false;
108 }
109 } else if (!lastName.equals(other.lastName)) {
110 return false;
111 }
112 return true;
113 }
114
115
116
117 }
Code Sample 34.1.: The completed Java Student class.
477
35. Recursion
Java supports recursion with no special syntax necessary. However, as an object-oriented
language, recursion is generally expensive and iterative or other non-recursive solutions
are generally preferred. We present a few examples to demonstrate how to write recursive
methods in Java. The first example of a recursive method we gave was the toy count
down example. In Java it could be implemented as follows.
1 public static void countDown(int n) {
2 if(n == 0) {
3 System.out.println("Happy New Year!");
4 } else {
5 System.out.println(n);
6 countDown(n-1);
7 }
8 }
As another example that actually does something useful, consider the following recursive
summation method that takes an array and an index variable. The recursion works as
follows: if the index variable has reached the size of the array, it stops and returns zero
(the base case). Otherwise, it makes a recursive call to recSum() , incrementing the
index variable by 1. When the method returns, it adds its result to the i-th element in
the array. To invoke this method we would call it with an initial value of 0 for the index
variable: recSum(arr, 0) .
1 public static int recSum(int arr[], int i) {
2 if(i == arr.length) {
3 return 0;
4 } else {
5 return recSum(arr, i+1) + arr[i];
6 }
7 }
This example was not tail-recursive as the recursive call was not the final operation (the
sum was the final operation). To make this method tail recursive, we can carry the
summation through to each method call ensuring that the summation is done prior to
479
35. Recursion
the recursive method call.
1 public static int recSumTail(int arr[], int i, int sum) {
2 if(i == arr.length) {
3 return sum;
4 } else {
5 return recSumTail(arr, i+1, sum + arr[i]);
6 }
7 }
As another example, consider the following Java implementation of the naive recursive
Fibonacci sequence. An additional condition has been included to check for “invalid”
negative values of n for which an exception is thrown.
1 public static int fibonacci(int n) {
2 if(n < 0) {
3 throw new IllegalArgumentException("Undefined for n < 0");
4 } else if(n <= 1) {
5 return 1;
6 } else {
7 return fibonacci(n-1) + fibonacci(n-2);
8 }
9 }
Java is not a language that provides implicit memoization. Instead, we need to explicitly
keep track of values using a table. In the following example, we use a Map data structure
to store previously computed values.
1 public static int fibMemoization(int n, Map<Integer, Integer> m) {
2 if(n < 0) {
3 throw new IllegalArgumentException("Undefined for n < 0");
4 } else if(n <= 1) {
5 return 1;
6 } else {
7 Integer result = m.get(n);
8 if(result == null) {
9 Integer a = fibMemoization(n-1, m);
10 Integer b = fibMemoization(n-2, m);
11 result = a + b;
12 m.put(n, result);
13 }
480
14 return result;
15 }
16 }
Java provides an arbitrary precision data type, BigInteger that can be used to compute
arbitrarily large integer values. Since Fibonacci numbers grow exponentially, using an
int we could only represent up to to F45 . Using BigInteger we can support much
larger values. An example:
1 public static BigInteger fibMem(int n, Map<Integer, BigInteger> m) {
2 if(n < 0) {
3 throw new IllegalArgumentException("Undefined for n < 0");
4 } else if(n <= 1) {
5 return BigInteger.ONE;
6 } else {
7 BigInteger result = m.get(n);
8 if(result == null) {
9 BigInteger a = fibMem(n-1, m);
10 BigInteger b = fibMem(n-2, m);
11 result = a.add(b);
12 m.put(n, result);
13 }
14 return result;
15 }
16 }
481
36. Searching & Sorting
Java provides several methods to search and sort arrays as well as List s of elements of
any type. These methods are able to operate on collections of any type because there are
several overloaded versions of these functions as well as versions that take a Comparator
object that specifies how the elements should be ordered.
36.1. Comparators
Let’s consider a “generic” Quick Sort algorithm as was presented in Algorithm 12.6. The
algorithm itself specifies how to sort elements, but it doesn’t specify how they are ordered.
The difference is subtle but important. Quick Sort needs to know when two elements, a, b
are in order, out of order, or equivalent in order to decide which partition each element
goes in. However, it doesn’t “know” anything about the elements a and b themselves.
They could be numbers, they could be strings, they could be user-defined objects.
A sorting algorithm still needs to be able to determine the proper ordering in order to
sort. In Java this is achieved by using a Comparator object, which is responsible for
comparing two elements and determining their proper order. A Comparator<T> is an
interface in Java that specifies a single method:
public int compare(T a, T b)
• A Comparator<T> is parameterized to operate on any type T . The parameteriza-
tion of T is basically a variable for a type. When you create a Comparator , you
specify an actual type just as we did with with ArrayList<Integer> . However,
the implementation itself is generic and can operate on any type.
• The method takes two instances, a and b whose type matches the parameterized
type T
• The method returns an integer indicating the relative ordering of the two elements:
– It returns something negative, < 0 if a comes before b (that is, a < b)
– It returns zero if a and b are equal (a = b)
– It returns something positive, > 0 if a comes after b (that is, a > b)
There is no guarantee on the value’s magnitude, it does not necessarily return −1 or +1;
it just returns something negative or positive. We’ve previously seen this pattern when
comparing strings and other wrapper classes. Each of the standard types implements
483
36. Searching & Sorting
something similar, the Comparable interface, that specifies a compareTo() method
with the same basic contract. Strings for example, are ordered in lexicographic ordering.
Numeric types such as Integer and Double also have compareTo() methods that
order elements in ascending order. Java refers to these built-in orderings as “natural”
orderings.
For user-defined classes, however, we need to specify how to order them. We could use the
Comparable<T> interface as the built-in wrapper classes have, but using a Comparator
is more flexible. Making a class Comparable locks you into one “natural” ordering. If
you wanted a different ordering, you would still have to use a Comparator . Even for the
wrapper classes, if we wanted a descending order, we would need to use a Comparator .
As an example, let’s write a Comparator that orders Integer types in ascending order,
matching the “natural” ordering already defined.
1 Comparator<Integer> cmpInt = new Comparator<Integer>(){
2 public int compare(Integer a, Integer b) {
3 if(a < b) {
4 return -1;
5 } else if(a == b) {
6 return 0;
7 } else {
8 return 1;
9 }
10 }
11 };
This is new syntax. When we create a Comparator in Java we are creating a new instance
of a class. However, we didn’t define a class. We didn’t use public class... nor did
we place it into a .java source file. Instead, this is an anonymous class declaration.
The class we’ve created has no name; the cmpInt is the variable’s name, but the class
itself has no name, its “anonymous.” This syntax allows us to define and instantiate a
class inline without having to create a separate class source file. This is an advantage
because we generally do not need multiple instances of a Comparator ; they would all
have the same functionality anyway. An anonymous class allows us to create ad-hoc
classes with a one-time (or a single purpose) use.
Another issue with this method is that it may not be able to handle null values. When
a and b get unboxed for the comparisons, if they are null , a NullPointerException
will be thrown. We discuss how to deal with this below in Section 36.3.2.
Another issue with this Comparator is the second case where we use the equality operator
== to compare values. With the less-than operator, the two integers get unboxed and
their values are compared. However, when we use the == operator on object instances,
it is comparing memory addresses in the JVM, not the actual values. We could solve
484
36.1. Comparators
this issue by rearranging our cases so that the equality is our final case, avoiding the
use of the equality operator. Even better, however, we can exploit the built-in natural
ordering of the integers by using the compareTo() method.
1 Comparator<Integer> cmpInt = new Comparator<Integer>(){
2 public int compare(Integer a, Integer b) {
3 return a.compareTo(b);
4 }
5 };
What if we wanted to order integers in the opposite, descending order? We could simply
write another Comparator that reversed the ordering:
1 Comparator<Integer> cmpIntDesc = new Comparator<Integer>(){
2 public int compare(Integer a, Integer b) {
3 return b.compareTo(a);
4 }
5 };
We might be tempted to instead reuse the original comparator and write line 3 above
simply as
return cmpInt(b, a);
However, Java will not allow you to reference another “outside” variable like this inside a
Comparator object. An anonymous class in Java is a sort-of closure; a function that has
a scope in which variables are bound. In this case, the anonymous class has a reference to
the cmpInt variable, but it is not necessarily “bound” as the variable could be reassigned
outside the Comparator . If we want to do something like this, Java forces us to make
the cmpInt variable final so that it cannot be changed.
To illustrate some more examples, consider the Student object we defined in Code
Sample 34.1. The following Code Samples demonstrate various ways of ordering Student
instances based on one or more of their member variable values.
1 /**
2 * This Comparator orders Student objects by
3 * last name/first name
4 */
5 Comparator<Student> byName = new Comparator<Student>() {
6 @Override
7 public int compare(Student a, Student b) {
8 if(a.getLastName().equals(b.getLastName())) {
485
36. Searching & Sorting
9 return a.getFirstName().compareTo(b.getFirstName());
10 } else {
11 return a.getLastName().compareTo(b.getLastName());
12 }
13 }
14 };
1 /**
2 * This Comparator orders Student objects by
3 * last name/first name in descending (Z-to-A) order
4 */
5 Comparator<Student> byNameDesc = new Comparator<Student>() {
6 @Override
7 public int compare(Student a, Student b) {
8 if(b.getLastName().equals(a.getLastName())) {
9 return b.getFirstName().compareTo(a.getFirstName());
10 } else {
11 return b.getLastName().compareTo(a.getLastName());
12 }
13 }
14 };
1 /**
2 * This Comparator orders Student objects by
3 * id in ascending order
4 */
5 Comparator<Student> byId = new Comparator<Student>() {
6 @Override
7 public int compare(Student a, Student b) {
8 return a.getId().compareTo(b.getId());
9 }
10 };
1 /**
2 * This Comparator orders Student objects by
3 * GPA in descending order
486
36.2. Searching & Sorting
4 */
5 Comparator<Student> byGpa = new Comparator<Student>() {
6 @Override
7 public int compare(Student a, Student b) {
8 return b.getGpa().compareTo(a.getGpa());
9 }
10 };
36.2. Searching & Sorting
We now turn our attention to the search and sorting methods provided by the JDK.
Most of these methods are generic implementations that either sort an array or collection
using the natural ordering or take a take a parameterized Comparator<T> to determine
the ordering.
36.2.1. Searching
Linear Search
Java Set and List collections provide several linear search methods. Both have a
public boolean contains(Object o) method that returns true or false depend-
ing on whether or not an object matching o is in the collection. The List collection has
an additional public int indexOf(Object o) method that returns the index of the
first matched element and −1 if no such element is found ( Set s are unordered and have
no indices, so this method would not apply). All of these functions are equality-based
and they do not take a Comparator object. Instead, the elements are compared using
the object’s equals() (and possibly hashCode() ) method. The first element x such
that x.equals(o) returns true is the element that is determined to match. For this
reason, it is important to override both of these methods when designing objects (see
Section 36.3.3).
Binary Search
The Arrays and Collections classes provide many variations on methods that imple-
ment binary search. All of these methods assume that the array or List being searched
are sorted appropriately (you cannot use binary search on a Set as it is an unordered
collection).
The Arrays class provides several binarySearch() methods, one for each primitive
type as well as variations that allow you to search within a specified range of elements.
The most generally useful version is as follows:
487
36. Searching & Sorting
public static <T> int binarySearch(T[] a, T key, Comparator<T> c)
That is, it takes an array of elements as well as key and a Comparator all of the same
type T . It returns an integer representing the index at which it finds the first matching
element (there is no guarantee that the first element in the sorted list is returned). If
no match is found, then the method returns something negative.1 Another version has
the same behavior but can be called without a Comparator , relying instead on the
natural ordering of elements. For this variation, the type of elements must implement
the Comparable interface.
The Collections class provides a similar method,
public static <T> int binarySearch(List<T> list, T key, Comparator<T> c)
The only difference is that the method takes a List instead of an array. Otherwise, the
behavior is the same. We present several examples in Code Sample 36.1.
36.2.2. Sorting
As with searching, the Arrays and Collections classes provide parameterized sorting
methods to sort arrays and List s. In Java 6 and prior, the implementation was a hybrid
merge/insertion sort. Java 7 switched the implementation to Tim Sort. Here too, there
are several variations that rely on the natural ordering or allow you to sort a subpart of
the collection.
The Arrays provides the following method, which sorts arrays of a particular type with
a Comparator for that type.
public static <T> void sort(T[] a, Comparator<T> c)
Likewise, Collections provides the following method.
public static <T> void sort(List<T> list, Comparator<T> c)
Several examples of the usage of these methods are presented in Code Sample 36.2.
36.3. Other Considerations
36.3.1. Sorted Collections
The Java Collections framework also provides several sorted data structures. Though
an ordered collection such as a List can be sorted calling the Collections.sort()
method, a sorted data structure maintains an ordering. As you add elements to the data
structure, they are inserted in the appropriate spot. Such data structures also prevent
you from arbitrarily inserting elements in any order.
Java defines the SortedSet<T> interface for sorted collections with a TreeSet<T>
implementation.2 You can construct a TreeSet<T> by providing it a Comparator<T>
1
It actually returns a negative value corresponding to the insertion point at which the element would
be if it had existed.
2
As the name implies, the implementation is a balanced binary search tree, in particular a red-black
tree.
488
36.3. Other Considerations
1 ArrayList<Student> roster = ...
2
3 Student castroKey = null;
4 int castroIndex;
5
6 //create a "key" that will match according to the
7 // Student.equals() method
8 castroKey = new Student("Starlin", "Castro", 131313, 3.95);
9 castroIndex = roster.indexOf(castroKey);
10 System.out.println("at index " + castroIndex + ": " +
11 roster.get(castroIndex));
12
13 //create a key with only the necessary fields to match
14 / the comparator
15 castroKey = new Student("Starlin", "Castro", 0, 0.0);
16 //sort the list according to the comparator
17 Collections.sort(roster, byName);
18 castroIndex = Collections.binarySearch(roster, castroKey, byName);
19 System.out.println("at index " + castroIndex + ": " +
20 roster.get(castroIndex));
21
22 //create a key with only the necessary fields to match
23 // the comparator
24 castroKey = new Student(null, null, 131313, 0.0);
25 //sort the list according to the comparator
26 Collections.sort(roster, byId);
27 castroIndex = Collections.binarySearch(roster, castroKey, byId);
28 System.out.println("at index " + castroIndex + ": " +
29 roster.get(castroIndex));
Code Sample 36.1.: Java Search Examples
to use to maintain the ordering (alternatively, you may omit the Comparator and the
TreeSet will use the natural ordering of elements).
1 Comparator<Integer> cmpIntDesc = new Comparator<Integer>() { ... };
2 SortedSet<Integer> sortedInts = new TreeSet<Integer>(cmpIntDesc);
3 sortedInts.add(10);
4 sortedInts.add(30);
5 sortedInts.add(20);
489
36. Searching & Sorting
1 List<Student> roster = ...
2 Student rosterArr[] = ...
3 Comparator byName = ...
4 Comparator byGPA = ...
5
6 //sort by name:
7 Collections.sort(roster, byName);
8 Arrays.sort(rosterArr, byName);
9
10 //sort by GPA:
11 Collections.sort(roster, byGPA);
12 Arrays.sort(rosterArr, byGPA);
Code Sample 36.2.: Using Java Collection’s Sort Method
6 //sortedInts has elements 30, 20, 10 in descending order
7
8 SortedSet<Student> sortedStudents = new TreeSet<Student>(byName);
9 //add students, they will be sorted by name
10 for(Student s : sortedStudents) {
11 System.out.println(s);
12 }
When using a SortedSet it is important that the Comparator properly orders all
elements. A SortedSet is still a Set : it does not allow duplicate elements. If the
Comparator you use returns zero for any element that you attempt to insert, it will
not be inserted. To demonstrate how this might fail, consider our byName Comparator
for Student objects. Suppose two students have the same first name and last name,
“John Doe” and “John Doe,” but have different IDs (as they are different people). The
Comparator would return 0 for these two objects because they have the same first/last
name, even though they are distinct people. Only one of these objects could exist in the
SortedSet . To solve this problem, it is important to define Comparator s that “break
ties” appropriately. In this case, we would want to modify the Comparator to return a
comparison of IDs if the first and last name are the same.
36.3.2. Handling null values
When sorting collections or arrays of objects, we may need to consider the possibility
of uninitialized null objects. Some collections allow null element(s) while others do
490
36.3. Other Considerations
not. How we handle these is a design decision. We could ignore it, in which case such
elements would likely result in a NullPointerException and expect the user to prevent
or handle such instances. This may be the preferable choice in most instances, in fact.
Alternatively, we could handle null objects in the design of our Comparator . Code
Sample 36.3 presents a Comparator for our Student class that orders null instances
first.
1 Comparator<Student> byNameWithNulls = new Comparator<Student>() {
2 @Override
3 public int compare(Student a, Student b) {
4 if(a == null && b == null) {
5 return 0;
6 } else if(a == null && b != null) {
7 return -1;
8 } else if(a != null && b == null) {
9 return 1;
10 } else {
11 if(a.getLastName().equals(b.getLastName())) {
12 return a.getFirstName().compareTo(b.getFirstName());
13 } else {
14 return a.getLastName().compareTo(b.getLastName());
15 }
16 }
17 }
18 };
Code Sample 36.3.: Handling Null Values in Java Comparators
This solution only handles null Student values not null values within the Student
object. If the getters used in the Comparator return null values, then we could still
have NullPointerException s.
36.3.3. Importance of equals() and hashCode() Methods
Recall that in Chapter 34 we briefly discussed the importance of overloading the
equals() and hashCode() methods of our objects. We reiterate this in the con-
text of searching. Recall that the Set and List collections provide linear search
methods that do not require the use of a Comparator . This is because the collections
use the object’s equals() to determine when a particular instance has been found. In
the case of hash-based data structures such as HashSet , the hashCode() method is
491
36. Searching & Sorting
also important. To illustrate the importance of these methods, consider the following
code.
1 Student a = new Student("Joe", "Smith", 1234, 3.5);
2 Student b = new Student("Joe", "Smith", 1234, 3.5);
3
4 Set<Student> s = new HashSet<Student>();
5 s.add(a);
6 s.add(b);
If we do not override the equals() and hashCode() methods, at the end of this
code snippet, the set will contain both of the Student instances even though they are
conceptually the same object (all of their member variables will have the same values).
However, if we do override the equals() and hashCode() methods as described in
Section 34.5, then the code snippet above would result in the Set only having one object
(the first one added). This is because during the attempt to add the second instance, the
equals() method would have returned true when compared to the first instance and
the duplicate element would not have been added to the Set (as Set s do not allow
duplicates).
Also recall that we saw some of the advantages of immutable objects. Again, we point
out another advantage. Suppose that we properly override the equals() and the
hashCode() methods in our Student object. Further, suppose that we make our
Student class mutable: allowing a user to change the ID via a setter. Consider the
following code snippet.
1 Student a = new Student("Joe", "Smith", 1234, 3.5);
2 Student b = new Student("Joe", "Smith", 5679, 3.5);
3
4 Set<Student> s = new HashSet<Student>();
5 s.add(a);
6 s.add(b);
7 //s now contains both students
8 b.setId(1234);
When we instantiate the two Student instances, they are distinct as their IDs are
different. So when we add them to the set, their equals() method returns false and
they are both added to the Set . However, when we change the ID using the setter
on the last line, both objects are now identical, violating the no-duplicates property of
the Set . This is not a failing of the Set class, just one of the many consequences of
designing mutable objects.
492
36.3. Other Considerations
36.3.4. Java 8: Lambda Expressions
Java 8 introduced a lot of functional-style syntax, including lambda expressions. Lambda
expressions are essentially anonymous functions that can be passed around to other
methods or objects. One use for lambda expressions is if we want to sort a List with
respect to one data field, we need not build a full Comparator . Instead we can use the
following syntax.
1 List<Student> roster = ...
2
3 roster.sort((a, b) -> a.getLastName().compareTo(b.getLastName()));
The new syntax is the use of the arrow operator as a lambda expres-
sion. In this case, it maps a pair, (a, b) to the value of the expression
a.getLastName().compareTo(b.getLastName()) (which takes advantage of the fact
that strings implement the Comparable interface). With respect to Comparator s, we
can use the following syntax to build a more complex ordering.
1 Comparator<Student> c =
2 (a, b) -> a.getLastName().compareTo(b.getLastName());
3 c = c.thenComparing( (a, b) ->
4 a.getFirstName().compareTo(b.getFirstName()));
5 c = c.thenComparing( (a, b) -> a.getGpa().compareTo(b.getGpa()));
6
7 //pass the comparator to the sort method:
8 roster.sort(c);
We can make this even more terse using method references, another new feature in Java
8.
1 //using getters as key extractors
2 myList.sort(
3 Comparator.comparing(Student::getLastName)
4 .thenComparing(Student::getFirstName)
5 .thenComparing(Student::getGpa));
There are several other convenient methods provided by the updated Comparator
interface. For example, the reversed() member method returns a new Comparator
that defines the reversed order. The static methods, nullsFirst() and nullsLast()
493
36. Searching & Sorting
can be used to modify a Comparator to order null values.
494
Part III.
The PHP Programming Language
495
37. Basics
In the mid-1990s the World Wide Web was in its infancy but becoming more and more
popular. For the most part, web pages contained static content: articles and text that
was “just-there.” Web pages were far from the fully interactive and dynamic applications
that they’ve become. Rasmus Lerdorf had a home page containing his resume and he
wanted to track how many visitors were coming to his page. With purely static pages,
this was not possible. So, in 1994 he developed PHP/FI which stood for Personal Home
Page tools and Forms Interpreter. This was a series of binary tools written in C that
operated through a web server’s Common Gateway Interface. When a user visited a
webpage, instead of just retrieving static content, a script was invoked: it could do a
number of operations and send back HTML formatted as a response. This made web
pages much more dynamic. By serving it through a script, a counter could be maintained
that tracked how many people had visited the site. Lerdorf eventually released his source
code in 1995 and it became widely used.
Today, PHP is used in a substantial number of pages on the web and is used in many
Content Management System (CMS) applications such as Drupal and WordPress. Because
of its history, much of the syntax and aspects of PHP (now referred to as “PHP: Hypertext
Preprocessor”) are influenced or inspired by C. In fact, many of the standard functions
available in the language are directly from the C language.
PHP is a scripting language and is not compiled. Instead, PHP code is interpreted by
a PHP interpreter. Though there are several interpreters available, the de facto PHP
interpreter is the Zend Engine, a free and open source project that is widely available on
many platforms, operating systems, and web servers. Because it was originally intended
to serve web pages, PHP code can be interleaved with static HTML tags. This allows
PHP code to be embedded in web pages and dynamically interpreted/rendered when
a user requests a webpage through a web browser. Though rendering web pages is its
primary purpose, PHP can be used as a general scripting language from the command
line.
PHP is a dirty, ugly language held together by duct tape, cracked asbestos-filled spackle
and sadness (http://phpsadness.com/). It is the cockroach of languages: it is invasive
and it is a survivor. It is a hydra; rewrite one PHP app and two more pop up. It is
much maligned and a source of ridicule. It is the source of hundreds of bad practices,
thousands of bad programmers, millions of bugs and an infinite abyss of security holes
and vulnerabilities. It is a language that was born in the wild and raised in the darkness
by two schizophrenic monkeys. But its got character; and in this world, that’s enough.
497
37. Basics
1 <?php
2
3 printf("Hello World\n");
4
5 ?>
Code Sample 37.1.: Hello World Program in PHP
1 <html>
2 <head>
3 <title>Hello World PHP Page</title>
4 </head>
5 <body>
6 <h1>A Simple PHP Script</h1>
7
8 <?php printf("<p>Hello World</p>"); ?>
9
10 </body>
11 </html>
Code Sample 37.2.: Hello World Program in PHP with HTML
37.1. Getting Started: Hello World
The hallmark of an introduction to a new programming language is the Hello World!
program. It consists of a simple program whose only purpose is to print the message
“Hello World!” to the user. The simplicity of the program allows the focus to be on the
basic syntax of the language. It is also typically used to ensure that your development
environment, interpretrer, runtime environment, etc. are functioning properly with a
minimal example. A basic Hello World! program in PHP can be found in Code Sample
37.1. A version in which the PHP code is interleaved in HTML is presented in Code
Sample 37.2.
We will not focus on any particular development environment, code editor, or any
particular operating system, interpreter, or ancillary standards in our presentation.
However, as a first step, you should be able to write and run the above program on
the environment you intend to use for the rest of this book. This may require that
you download and install a basic PHP interpreter/development environment (such as
a standard LAMP, WAMP or MAMP technology stack) or a full IDE (such as Eclipse,
PhpStorm, etc.).
498
37.2. Basic Elements
37.2. Basic Elements
Using the Hello World! program as a starting point, we will examine the basic elements
of the PHP language.
37.2.1. Basic Syntax Rules
PHP has adopted many aspects of the C programming language (the interpreter itself is
written in C). However, there are some major aspects in which it differs from C. The
major aspects and syntactic elements of PHP include the following.
• PHP is an interpreted language: it is not compiled. Instead it is interpreted through
an interpreter that parses commands in a script file line-by-line. Any syntax errors,
therefore, become runtime errors.
• PHP is dynamically typed : you do not declare variables or specify a variable’s
type. Instead, when you assign a variable a value, the variable’s type dynamically
changes to accommodate the assigned value. Variable names always begin with a
dollar sign, $ .
• Strings and characters are essentially the same thing (characters are strings of
length 1). Strings and characters can be delimited by either single quotes or double
quotes. "this is a string" , 'this is also a string' ; 'A' and "a" are
both single character strings.
• Executable statements are terminated by a semicolon, ;
• Code blocks are defined by using opening and closing curly brackets, { ... } .
Moreover, code blocks can be nested : code blocks can be defined within other code
blocks.
• A complete list of reserved and keywords can be found in the PHP Manual: http://
php.net/manual/en/reserved.php and http://php.net/manual/en/reserved.
keywords.php
PHP also supports aspects of OOP including classes and inheritance. There is also no
memory management in PHP: it has automated garbage collection.
Though not a syntactic requirement, the proper use of whitespace is important for good,
readable code. Code inside code blocks is indented at the same indentation. Nested
code blocks are indented further. Think of a typical table of contents or the outline of a
formal paper or essay. Sections and subsections or points and subpoints all follow proper
indentation with elements at the same level at the same indentation. This convention is
used to organize code and make it more readable.
499
37. Basics
37.2.2. PHP Tags
PHP code can be interleaved with static HTML or text. Because of this, we need a way
to indicate what should be interpreted as PHP and what should be treated as static text.
We can do this using PHP tags: the opening tag is <?php and the closing tag is ?> .
Anything placed between these tags will be interpreted as PHP code which must adhere
to the syntax rules of the language.
A file can contain multiple opening/closing PHP tags to allow you to interleave multiple
sections of HTML or text. When an interpreter runs a PHP script, it will start processing
the script file. Whenever it sees the opening PHP tag, it begins to execute the commands
and stops executing commands when it sees the closing tag. The text outside the PHP
tags is treated as raw data. The interpreter includes it as part of its output without
modifying or processing it.
37.2.3. Libraries
PHP has many built-in functions that you can use. These standard libraries are loaded
and available to use without any special command to import or include them. Full docu-
mentation on each of these functions is maintained in the PHP manual, available online
at http://php.net/. The manual’s web pages also contain many curated comments
from PHP developers which contain further explanations, tips & tricks, suggestions, and
sample code to provide further assistance.
There are many useful functions that we’ll mention as we progress through each topic.
One especially useful collection of functions is the math library. This library is directly
adapted from C’s standard math library so all the function names are the same. It
provides many common mathematical functions such as the square root and natural
logarithm. Table 37.1 highlights several of these functions; full documentation can be
found in the PHP manual (http://php.net/manual/en/ref.math.php). To use these,
you simply “call” them by providing input and assigning the output to a variable.
1 $x = 1.5; √ √
2 $y = sqrt($x); //y now has the value x = 1.5
3 $z = sin($x); //z now has the value sin (x) = sin (1.5)
In both of the function calls above, the value of the variable $x is “passed” to the math
function which computes and “returns” the result which then gets assigned to another
variable.
37.2.4. Comments
Comments can be written in PHP code either as a single line using two forward slashes,
//comment or as a multiline comment using a combination of forward slash and asterisk:
/* comment */ . With a single line comment, everything on the line after the forward
500
37.2. Basic Elements
Function Description
abs($x) Absolute value, |x|
ceil($x) Ceiling function, d46.3e = 47.0
floor($x) Floor function, b46.3c = 46.0
cos($x) Cosine functiona
sin($x) Sine functiona
tan($x) Tangent functiona
exp($x) Exponential function, ex , e = 2.71828 . . .
log($x) Natural logarithm, ln (x)b
log10($x) Logarithm base 10, log10 (x)b
pow($x,$y) The power function, computes xyc
sqrt($x) Square root functionb
Table 37.1.: Several functions defined in the PHP math library. a All trigonometric
functions assume input is in radians, not degrees. b Input is assumed to
be positive, x > 0. c Alternatively, PHP supports exponentiation by using
x ** y .
501
37. Basics
slashes is ignored. With a multiline comment, everything in between the forward
slash/asterisk is ignored. Comments are ultimately ignored by the interpreter. Consider
the following example.
1 //this is a single line comment
2 $x = 10; //this is also a single line comment, but after some code
3
4 /*
5 This is a comment that can
6 span multiple lines to format the comment
7 message more clearly
8 */
9 $y = 3.14;
Most code editors and IDEs will present comments in a special color or font to distinguish
them from the rest of the code (just as our example above does). Failure to close a
multiline comment will likely result in a fatal interpreter error but with color-coded
comments its easy to see the mistake visually.
37.2.5. Entry Point & Command Line Arguments
Every PHP script begins executing at the top of the script file and proceed in a linear,
sequential manner top-to-bottom. In addition, you can provide a PHP script with inputs
when you run it from the command line. These command line arguments are stored in
two variables, $argc and $argv . The first variable, $argc is an integer that indicates
the number of arguments provided including the name of the script file being executed.
The second, $argv is an array (see Section 42) of strings consisting of the command
line arguments. To access them, you can index them starting at zero, the first being
$argv[0] , the second $argv[1] , the last one would be $argv[$argc-1] . The first
one is always the name of the script file being run. The remaining are the command line
arguments provided by the user when the script is executed. We’ll see several examples
later.
37.3. Variables
PHP is a dynamically typed language. As a consequence, you do not declare variables
before you start using them. If you need to store a value into a variable, you simply
name the variable and use an assignment operator to assign the value. Since you do not
declare variables, you also do not specify a variable’s type. If you assign a string value
to a variable, its type becomes a string. If you assign an integer to a variable, its type
becomes an integer. If you reassign the value of a variable to a value with a different
type, the variable’s type also changes.
502
37.3. Variables
Internally PHP supports several different types: Booleans, integers, floating point
numbers, strings, arrays, and objects. The way that integers are represented may be
platform dependent, but are usually 32-bit signed two’s complement integers, able to
represent integers between −2, 147, 483, 648 and 2,147,483,647. Floating point numbers
are also platform dependent, but are usually 64-bit double precision numbers defined
by the IEEE 754 standard, providing about 16 digits of precision. Strings and single
characters are the same thing in PHP. Strings are represented as sequences of characters
from the extended ASCII text table (see Table 2.4) which includes all characters in the
range 0–255. PHP does not have native Unicode support for international characters.
37.3.1. Using Variables
To use a variable in PHP, you simply need to assign a value to a named variable identifier
and the variable is in scope. Variable names always begin with a single dollar sign, $ .
The assignment operator is a single equal sign, = and is a right-to-left assignment. The
variable that we wish to assign the value to appears on the left-hand-side while the value
(literal, variable or expression) is on the right-hand-size. For example:
1 $numUnits = 42;
2 $costPerUnit = 32.79;
3 $firstInitial = "C";
Each assignment also implicitly changes the variable’s type. Each of the variables above
becomes an integer, floating point number, and string respectively. Assignment statements
are terminated by a semicolon like most executable statements in PHP. The identifier
rules are fairly standard: a variable’s name can consist of lowercase and uppercase
alphabetic characters, numbers, and underscores. You can also use the extended ASCII
character set in variable names but it is not recommended (umlauts and other diacritics
can easily be confused). Variable names are case sensitive. As previously mentioned,
variable names must always begin with a dollar sign, $ . Stylistically, we adopt the
modern lower camel casing naming convention for variables in our code.
If you do not assign a value to a variable, that variable remains undefined or “unset.”
Undefined variables are treated as null in PHP. The concept of “null” refers to
uninitialized, undefined, empty, missing, or meaningless values. In PHP the keyword
null is used which is case insensitive ( null , Null and NULL are all the same), but
for consistency, we’ll use null . When null values are used in arithmetic expressions,
null is treated as zero. So, (10 + null) is equal to 10. When null is used in the
context of strings, it is treated as an empty string and ignored. When used in a Boolean
expression or conditional, null is treated as false .
PHP also allows you to define constants: values that cannot be changed once set. To
define a constant, you invoke a function named define and providing a name and value.
503
37. Basics
1 define("PI", 3.14159);
2 define("INSTITUTION", "University of Nebraska-Lincoln");
3 define("COST_PER_UNIT", 2.50);
Constant names are case sensitive. By convention, we use uppercase underscore casing.
An attempt to redefine a constant value will raise a script warning, but will ultimately
have no effect. When referring to constants later in the script, you use the constant’s
name. You do not treat it as a string, nor do you use a dollar sign. For example:
$area = $r * $r * PI;
37.4. Operators
PHP supports the standard arithmetic operators for addition, subtraction, multiplication,
and division using + , - , * , and / respectively. Each of these operators is a binary op-
erator that acts on two operands which can either be literals, variables or expressions and
follow the usual rules of arithmetic when it comes to order of precedence (multiplication
and division before addition and subtraction).
1 $a = 10, $b = 20, $c = 30;
2 $d = $a + 5;
3 $d = $a + $b;
4 $d = $a - $b;
5 $d = $a + $b * $c;
6 $d = $a * $b; //d becomes a floating point number with a value .5
7
8 $x = 1.5, $y = 3.4, $z = 10.5;
9 $w = $x + 5.0;
10 $w = $x + $y;
11 $w = $x - $y;
12 $w = $x + $y * $z;
13 $w = $x * $y;
14 $w = $x / $y;
15
16 //mixing integers and floating point numbers is no problem
17 $w = $a + $x;
PHP also supports the integer remainder operator using the % symbol. This operator
gives the remainder of the result of dividing two integers. Examples:
504
37.4. Operators
1 $x = 10 % 5; //x is 0
2 $x = 10 % 3; //x is 1
3 $x = 29 % 5; //x is 4
37.4.1. Type Juggling
The expectations of an arithmetic expression involving two variables that are either
integers or floating point numbers are straightforward. We expect the sum/product/etc.
as a result. However, since PHP is dynamically typed, a variable involved in an arithmetic
expression could be anything, including a Boolean, object, array, or string. When a
Boolean is involved in an arithmetic expression, true is treated as 1 and false is
treated as zero. If an array is involved in an expression, it is usually a fatal error.1
Non-null objects are treated as 1 and null is treated as 0.
However, when string values are involved in an arithmetic expression, PHP does something
called type juggling. When juggled, an attempt is made to convert a string variable into
a numeric value by parsing it. The parsing goes over each numeric character, converting
the value to a numeric type (either an integer or floating point number). The first type a
non-numeric character is encountered, the parsing stops and the value parsed so far is
the value used in the expression.
Consider the examples in Code Sample 37.3. In the first segment, $a is type juggled to
the value 10, then added to 5 , resulting in 15. In the second example, $a represents a
floating point number, and is converted to 3.14, the result of adding to 5 is thus 8.14. In
the third example, the string does not contain any numerical values. In this case, the
parsing stops at the first character and what has been parsed so far is zero! Finally, in
the last example, the first two characters in $a are numeric, so the parsing ends at the
third character, and what has been parsed so far is 10.
Relying on type juggling to convert values can be ugly and error prone. You can write
much more intentional code by using the several conversion functions provided by PHP.
For example:
1 $a = intval("10");
2 $b = floatval("3.14");
3 $c = intval("ten"); //c has the value zero
In all three of the examples above, the strings are converted just as they are when type
juggled. However, the variables are guaranteed to have the type indicated (integer or
floating point number).
1
PHP does allow you to “add” two arrays together which results in their union.
505
37. Basics
1 $a = "10";
2 $b = 5 + $a; //b = 15
3
4 $a = "3.14";
5 $b = 5 + $a; //b = 8.14
6
7 $a = "ten";
8 $b = 5 + $a; //b = 5
9
10 //partial conversions also occur:
11 $a = "10ten";
12 $b = 5 + $a; //b = 15
Code Sample 37.3.: Type Juggling in PHP
There are several utility functions that can be used to help determine the type of variable.
The function is_numeric($x) returns true if $x is a numeric (integer or floating
point number) or represents a pure numeric string. The functions is_int($x) and
is_float($x) each return true or false depending on whether or not $x is of that
type.
1 $a = 10;
2 $b = "10";
3 $c = 3.14;
4 $d = "3.14";
5 $e = "hello";
6 $f = "10foo";
7
8 is_numeric($a); //true
9 is_numeric($b); //true
10 is_numeric($c); //true
11 is_numeric($d); //true
12 is_numeric($e); //false
13 is_numeric($f); //false
14
15 is_int($a); //true
16 is_int($b); //false
17 is_int($c); //false
18 is_int($d); //false
19 is_int($e); //false
506
37.4. Operators
Value of $var isset($var) empty($var) is_null($var)
42 bool(true) bool(false) bool(false)
"" (an empty string) bool(true) bool(true) bool(false)
" " (space) bool(true) bool(false) bool(false)
false bool(true) bool(true) bool(false)
true bool(true) bool(false) bool(false)
array() (an empty array) bool(true) bool(true) bool(false)
null bool(false) bool(true) bool(true)
"0" (0 as a string) bool(true) bool(true) bool(false)
0 (0 as an integer) bool(true) bool(true) bool(false)
0.0 (0 as a float) bool(true) bool(true) bool(false)
var $var; (declared with no value) bool(false) bool(true) bool(true)
NULL byte ( "\0" ) bool(true) bool(false) bool(false)
Table 37.2.: Results for various variable values
20 is_int($f); //false
21
22 is_float($a); //false
23 is_float($b); //false
24 is_float($c); //true
25 is_float($d); //false
26 is_float($e); //false
27 is_float($f); //false
A more general way to determine the type of a variable is to use the function gettype($x)
which returns a string representation of the type of the variable $x . The string returned
by this function is one of the following depending on the type of $x : "boolean" ,
"integer" , "double" , "string" , "array" , "object" , "resource" , "NULL" , or
"unknown type" .
Other checker functions allow you to determine if a variable has been set, if its null,
“empty” etc. For example, is_null($x) returns true if $x is not set or is set, but
has been set to null . The function isset($x) returns true only if $x is set and it
is not null . The function empty($x) returns true if $x represents an empty entity:
an empty string, false , an empty array, null , "0" , 0, or an unset variable. Several
examples are presented in Table 37.2.
507
37. Basics
37.4.2. String Concatenation
Strings in PHP can be concatenated (combined) in several different ways. One way
you can combine strings is by using the concatenation operator. In PHP the string
concatenation operator is a single period.
1 $s = "Hello";
2 $t = "World!";
3 $msg = $s . " " . $t; //msg contains "Hello World!"
Another way you can combine strings is by placing variables directly inside a string. The
variables inside the string are replaced with the variable’s values. Example:
1 $x = 13;
2 $name = "Starlin";
3 $msg = "Hello, $name, your number is $x";
4 //msg contains the string "Hello, Starlin, your number is 13"
37.5. Basic I/O
Recall the main purpose of PHP is as a scripting language to serve dynamic webpages.
However, it does support input and output from the standard input/output. There are
several ways to print output to the standard output. The keywords print and echo
(which are aliases of each other) allow you to print any variable or string. PHP also has
a printf() function to allow formatted output. Some examples:
1 $a = 10;
2 $b = 3.14;
3
4 print $a;
5 print "The value of a is $a\n";
6
7 echo $a;
8 echo "The value of a is $a\n";
9
10 printf("The value of a is %d, and b is %f\n", $a, $b);
There are also several ways to perform standard input, but the easiest is to use fgets
508
37.6. Examples
(short for f ile get string) using the keyword STDIN (Standard Input). This function
will return, as a string, everything the user enters up to and including the enter key
(interpreted as the endline character, \n ). To remove the endline character, you can use
another function, trim which removes leading and trailing whitespace from a string. A
full example:
1 //prompt the user to enter input
2 printf("Please enter a number: ");
3 $a = fgets(STDIN);
4 $a = trim($a);
Alternatively, lines 3–4 could be combined into one: $a = trim(fgets(STDIN)); The
call to fgets waits (referred to as “blocking”) for the user to enter input. The user is
free to start typing. When the user is done, they hit the enter key at which point the
program resumes and reads the input from the standard input buffer, and returns it as a
string value which we assign to the variable $a .
The standard input is unstructured. The user is free to type whatever they want. If
we prompt the user for a number but they just start mashing the keyboard giving
non-numerical input, we may get incorrect results. We can use the conversion functions
mentioned above to attempt to properly convert the values. However, this only guarantees
that the resulting variable is of the type we want (integer or floating point value for
example). The standard input is not a good mechanism for reading input, but it provides
a good starting point to develop a few simple programs.
37.6. Examples
37.6.1. Converting Units
Let’s write a program that prompts the user to enter a temperature in degrees Fahrenheit
and convert it to degrees Celsius using the formula
5
C = (F − 32) ·
9
We begin with the basic script shell with the opening and closing PHP tags and some
comments documenting the purpose of our script.
1 <?php
2
3 /**
4 * This program converts Fahrenheit temperatures to
5 * Celsius
509
37. Basics
6 */
7
8 //TODO: implement this
9
10 ?>
It is common for programmers to use a comment along with a TODO note to themselves
as a reminder of things that they still need to do with the program. Let’s first outline
the basic steps that our program will go through:
1. We’ll first prompt the user for input, asking them for a temperature in Fahrenheit
2. Next we’ll read the user’s input and use a conversion function to ensure the input
is a floating point number
3. Once we have the input, we can calculate the degrees Celsius by using the formula
above
4. Lastly, we will want to print the result to the user to inform them of the value
Sometimes it is helpful to write an outline of such a program directly in the code using
comments to provide a step-by-step process. For example:
1 <?php
2
3 /**
4 * This program converts Fahrenheit temperatures to
5 * Celsius
6 */
7
8 //TODO: implement this
9
10 //1. Prompt the user for input in Fahrenheit
11 //2. Read the Fahrenheit value from the standard input
12 //3. Compute the degrees Celsius
13 //4. Print the result to the user
14
15 ?>
As we read each step it becomes apparent that we’ll need a couple of variables: one to
hold the Fahrenheit (input) value and one for the Celsius (output) value. We’ll want to
ensure that these are floating point numbers which we can do by making some explicit
conversion. We use a printf() statement in the first step to prompt the user for input.
510
37.6. Examples
printf("Please enter degrees in Fahrenheit: ");
In the second step, we’ll use the standard input to read the $fahrenheit variable value
from the user. Recall that we can use fgets to read from the standard input, but may
have to trim the trailing whitespace.
$fahrenheit = trim(fgets(STDIN));
If we want to ensure that the variable $fahrenheit is a floating point value, we can
use floatval() :
$fahrenheit = floatval($fahrenheit);
We can now compute $celsius using the formula provided:
$celsius = ($fahrenheit - 32) * (5 / 9);
Finally, we use printf() again to output the result to the user:
printf("%f Fahrenheit is %f Celsius\n", $fahrenheit, $celsius);
The full program can be found in Code Sample 37.4.
1 <?php
2
3 /**
4 * This program converts Fahrenheit temperatures to
5 * Celsius
6 */
7
8 //1. Prompt the user for input in Fahrenheit
9 printf("Please enter degrees in Fahrenheit: ");
10
11 //2. Read the Fahrenheit value from the standard input
12 $fahrenheit = trim(fgets(STDIN));
13 $fahrenheit = floatval($fahrenheit);
14
15 //3. Compute the degrees Celsius
16 $celsius = ($fahrenheit - 32) * (5/9);
17
18 //4. Print the result to the user
19 printf("%f Fahrenheit is %f Celsius\n", $fahrenheit, $celsius);
20
21 ?>
Code Sample 37.4.: Fahrenheit-to-Celsius Conversion Program in PHP
511
37. Basics
37.6.2. Computing Quadratic Roots
Some programs require the user to enter multiple inputs. The prompt-input process can
be repeated. In this example, consider asking the user for the coefficients, a, b, c to a
quadratic polynomial,
ax2 + bx + c
and computing its roots using the quadratic formula,
√
−b ± b2 − 4ac
x=
2a
As before, we can create a basic program with PHP tags and start filling in the details.
In particular, we’ll need to prompt for the input a, then read it in; then prompt for b,
read it in and repeat for c. Thus, we have
1 printf("Please enter a: ");
2 $a = floatval(trim(fgets(STDIN)));
3 printf("Please enter b: ");
4 $b = floatval(trim(fgets(STDIN)));
5 printf("Please enter c: ");
6 $c = floatval(trim(fgets(STDIN)));
We need to take care that we correctly adapt the formula so it accurately reflects the
order of operations. We also need to use the math library’s square root function.
1 $root1 = (-$b + sqrt($b*$b - 4*$a*$c) ) / (2*$a);
2 $root2 = (-$b - sqrt($b*$b - 4*$a*$c) ) / (2*$a);
Finally, we print the output using printf() . The full program can be found in Code
Sample 37.5.
This program was interactive. As an alternative, we could have read all three of the
inputs as command line arguments, taking care to convert them to floating point numbers.
Lines 8–13 in the program could have been changed to
1 $a = floatval($argv[1]);
2 $b = floatval($argv[2]);
3 $c = floatval($argv[3]);
Finally, think about the possible input a user could provide that may cause problems for
this program. For example:
512
37.6. Examples
1 <?php
2
3 /**
4 * This program computes the roots to a quadratic equation
5 * using the quadratic formula.
6 */
7
8 printf("Please enter a: ");
9 $a = floatval(trim(fgets(STDIN)));
10 printf("Please enter b: ");
11 $b = floatval(trim(fgets(STDIN)));
12 printf("Please enter c: ");
13 $c = floatval(trim(fgets(STDIN)));
14
15 $root1 = (-$b + sqrt($b*$b - 4*$a*$c) ) / (2*$a);
16 $root2 = (-$b - sqrt($b*$b - 4*$a*$c) ) / (2*$a);
17
18 printf("The roots of %fx^2 + %fx + %f are: \n", $a, $b, $c);
19 printf(" root1 = %f\n", $root1);
20 printf(" root2 = %f\n", $root2);
21
22 ?>
Code Sample 37.5.: Quadratic Roots Program in PHP
• What if the user entered zero for a?
• What if the user entered some combination such that b2 < 4ac?
• What if the user entered non-numeric values?
• For the command line argument version, what if the user provided less than three
arguments? Or more?
How might we prevent the consequences of such bad input? How might we handle the
event that a user enters bad input and how do we communicate these errors to the user?
To begin to resolve these issues, we’ll need conditionals.
513
38. Conditionals
PHP supports the basic if, if-else, and if-else-if conditional structures as well as switch
statements. Logical statements are built using the standard logical operators for numeric
comparisons as well as logical operators such as negations, And, and Or.
38.1. Logical Operators
PHP has a built-in Boolean type and supports the keywords true and false . However,
any variable can be treated as a Boolean if used in a logical expression. Depending on
the variable, it could evaluate to true or false! For example, an empty string, "" , null ,
or a numeric value of zero, 0 are all considered false. A non-empty string, a non-zero
numeric value, or a non-empty array all evaluate to true. It is best to avoid these issues
by writing clean code that uses clear, explicit statements.
Because PHP is dynamically typed, comparison operators work differently depending on
how they are used. First, let’s consider the four basic inequality operators, < , <= , > ,
and >= . When used to compare numeric types to numeric types, these operators work
as expected and the value of the numbers are compared.
1 $a = 10;
2 $b = 20;
3 $c = 20;
4
5 $r = ($a < $b); //true
6 $r = ($a <= $b); //false
7 $r = ($b <= $c); //true
8 $r = ($a > $b); //false
9 $r = ($a >= $b); //false
10 $r = ($b >= $c); //true
When these operators are used to compare strings to strings, the strings are compared
lexicographically according to the standard ASCII text table. Some examples follow,
but it is better to use a function (in particular strcmp see Chapter 43) to do string
comparisons.
515
38. Conditionals
1 $s = "aardvark";
2 $t = "zebra";
3
4 $r = ($s < $t); //true
5 $r = ($s <= $t); //true
6 $r = ($s >= $t); //false
7 $r = ($s > $t); //false
However, when these operators are used to compare strings to numeric types, the strings
are converted to numbers using the same type juggling that happens when strings are
mixed with arithmetic operators. In the following example, $b gets converted to a
numeric type when compared to $a which give the results indicated in the comments.
1 $a = 10;
2 $b = "10";
3
4 $r = ($a <= $b); //true
5 $r = ($a < $b); //false
6 $r = ($a >= $b); //true
7 $r = ($a > $b); //false
With the equality operators, == and != , something similar happens. When the types of
the two operands match, the expected comparison is made: when numbers are compared
to numbers their values are compared; when strings are compared to strings, their content
is compared (case sensitively). However, when the types are different they are type
juggled and strings are converted to numbers for the purpose of comparison. Thus, a
comparison like (10 == "10") ends up being true! The operators are == and != are
referred to as loose comparison operators because of this.
What if we want to ensure that we’re comparing apples to apples? To rectify this, PHP
offers another set of comparison operators, strict comparison operators, === and !==
(each has an extra equals sign, = ). These operators will make a comparison without
type juggling either operand first. Now a similar comparison, (10 === "10") ends up
evaluating to false. The operator === will only evaluate to true if the both the operands’
type and value are the same.
1 $a = 10;
2 $b = "10";
3
4 $r = ($a == $b); //true
5 $r = ($a != $b); //false
516
38.2. If, If-Else, If-Else-If Statements
Operator(s) Associativity Notes
Highest ++ , -- left-to-right increment operators
-, ! right-to-left unary negation operator, logical
not
*, /, % left-to-right
+, - left-to-right addition, subtraction
< , <= , > , >= left-to-right comparison
== , != , === , !== left-to-right equality, inequality
&& left-to-right logical And
|| left-to-right logical Or
Lowest = , += , -= , *= , /= right-to-left assignment and compound assign-
ment operators
Table 38.1.: Operator Order of Precedence in PHP. Operators on the same level have
equivalent order and are performed in the associative order specified.
6 $r = ($a === $b); //false
7 $r = ($a !== $b); //true
The three basic logical operators, not ! , and && , and or || are also supported in PHP.
38.1.1. Order of Precedence
At this point it is worth summarizing the order of precedence of all the operators that
we’ve seen so far including assignment, arithmetic, comparison, and logical. Since all of
these operators could be used in one statement, for example,
($b*$b < 4*$a*$c || $a === 0 || $argc != 4)
it is important to understand the order in which each one gets evaluated. Table 38.1
summarizes the order of precedence for the operators seen so far. This is not an exhaustive
list of PHP operators.
38.2. If, If-Else, If-Else-If Statements
Conditional statements in PHP utilize the keywords if , else , and else if . Condi-
tions are placed inside parentheses immediately after the if and else if keywords.
Examples of all three can be found in Code Sample 38.1.
Observe that the statement, if($x < 10) does not have a semicolon at the end. This
is because it is a conditional statement that determines the flow of control and not an
executable statement. Therefore, no semicolon is used. Suppose we made a mistake and
did include a semicolon:
517
38. Conditionals
1 //example of an if statement:
2 if($x < 10) {
3 printf("x is less than 10\n");
4 }
5
6 //example of an if-else statement:
7 if($x < 10) {
8 printf("x is less than 10\n");
9 } else {
10 printf("x is 10 or more \n");
11 }
12
13 //example of an if-else-if statement:
14 if($x < 10) {
15 printf("x is less than 10\n");
16 } else if($x === 10) {
17 printf("x is equal to ten\n");
18 } else {
19 printf("x is greater than 10\n");
20 }
Code Sample 38.1.: Examples of Conditional Statements in PHP
518
38.3. Examples
1 $x = 15;
2 if($x < 10); {
3 printf("x is less than 10\n");
4 }
This PHP code will run without error or warning. However, it will end up printing
x is less than 10 , even though x = 15! Recall that a conditional statement binds
to the executable statement or code block immediately following it. In this case, we’ve
provided an empty executable statement ended by the semicolon. The code is essentially
equivalent to
1 $x = 15;
2 if($x < 10) {
3 }
4 printf("x is less than 10\n");
This is obviously not what we wanted. The semicolon was bound to the empty executable
statement and the code block containing the print statement immediately followed, but
was not bound to the conditional statement which is why the print statement executed
regardless of the value of x.
Another convention that we’ve used in our code is where we have placed the curly brackets.
If a conditional statement is bound to only one statement, the curly brackets are not
necessary. However, it is best practice to include them even if they are not necessary
and we’ll follow this convention. Second, the opening curly bracket is on the same line as
the conditional statement while the closing curly bracket is indented to the same level
as the start of the conditional statement. Moreover, the code inside the code block is
indented. If there were more statements in the block, they would have all been at the
same indentation level.
38.3. Examples
38.3.1. Computing a Logarithm
The logarithm of x is the exponent that some base must be raised to get x. The most
common logarithm is the natural logarithm, ln (x) which is base e = 2.71828 . . .. But
logarithms can be in any base b > 1.1 What if we wanted to compute log2 (x)? Or
logπ (x)? Let’s write a program that will prompt the user for a number x and a base
b and computes logb (x). Arbitrary bases can be computed using the change of base
1
Bases can also be 0 < b < 1, but we’ll restrict our attention to increasing functions only.
519
38. Conditionals
formula:
loga (x)
logb (x) =
loga (b)
If we can compute some base a, then we can compute any base b. Fortunately we have
such a solution. Recall that the standard library provides a function to compute the
natural logarithm, log() ). This is one of the fundamentals of problems solving: if a
solution already exists, use it. In this case, a solution exists for a different, but similar
problem (computing the natural logarithm), but we can adapt the solution using the
change of base formula. In particular, if we have variables b (base) and x , we can
compute logb (x) using
log(x) / log(b)
We have a problem similar to the examples in the previous section. The user could enter
invalid values such as b = −10 or x = −2.54 (logarithms are undefined for non-positive
values in any base). We want to ensure that b > 1 and x > 0. With conditionals, we
can now do this. Once we have read in the input from the user we can make a check for
good input using an if statement.
1 if($x <= 0 || $b <= 1) {
2 printf("Error: bad input!\n");
3 exit(1);
4 }
This code has something new: exit(1) . The exit() function immediately terminates
the script regardless of the rest of the code that may remain. The argument passed to
exit is an integer that represents an error code. The convention is that zero indicates
“no error” while non-zero values indicate some error. This is a simple way of performing
error handling: if the user provides bad input, we inform them and quit the program,
forcing them to run it again and provide good input. By prematurely terminating the
program we avoid any illegal operation that would give a bad result.
Alternatively, we could have split the conditions into two statements and given a more
descriptive error message. We use this design in the full program which can be found
in Code Sample 38.2. The program also takes the input as command line arguments.
Now that we have conditionals, we can check that the correct number of arguments was
provided by the user and quit in the event that they don’t provide the correct number.
38.3.2. Life & Taxes
Let’s adapt the conditional statements we developed in Section 3.6.4 into a full PHP
script. The first thing we need to do is establish the variables we’ll need and read them
in from the user. At the same time we can check for bad input (negative values) for both
the inputs.
520
38.3. Examples
1 //prompt for income from the user
2 printf("Please enter your Adjusted Gross Income: ");
3
4 $income = floatval(trim(fgets(STDIN)));
5
6 //prompt for children
7 printf("How many children do you have? ");
8 $numChildren = intval(trim(fgets(STDIN)));
9
10 if($income < 0 || $numChildren < 0) {
11 printf("Invalid inputs");
12 exit(1);
13 }
Next, we can code a series of if-else-if statements for the income range. By placing the
ranges in increasing order, we only need to check the upper bounds just as in the original
example.
1 if($income <= 18150) {
2 $baseTax = $income * .10;
3 } else if($income <= 73800) {
4 $baseTax = 1815 + ($income -18150) * .15;
5 } else if($income <= 148850) {
6 ...
7 } else {
8 $baseTax = 127962.50 + ($income - 457600) * .396;
9 }
Next we compute the child tax credit, taking care that it does not exceed $3,000. A
conditional based on the number of children suffices as at this point in the program we
already know it is zero or greater.
1 if($numChildren <= 3) {
2 $credit = $numChildren * 1000;
3 } else {
4 $credit = 3000;
5 }
Finally, we need to ensure that the credit does not exceed the total tax liability (the
credit is non-refundable, so if the credit is greater, the tax should only be zero, not
521
38. Conditionals
negative).
1 if($baseTax - $credit >= 0) {
2 $totalTax = $baseTax - $credit;
3 } else {
4 $totalTax = 0;
5 }
The full program is presented in Code Sample 38.3.
38.3.3. Quadratic Roots Revisited
Let’s return to the quadratic roots program we previously designed that uses the quadratic
equation to compute the roots of a quadratic polynomial by reading coefficients a, b, c
in from the user. One of the problems we had previously identified is if the user enters
“bad” input: if a = 0, we would end up dividing by zero; if b2 − 4ac < 0 then we would
have complex roots. With conditionals, we can now check for these issues and exit with
an error message.
Another potential case we might want to handle differently is when there is only one
distinct root (b2 − 4ac = 0). In that case, the quadratic formula simplifies to −b
2a
and we
can print a different, more specific message to the user. The full program can be found
in Code Sample 38.4.
522
38.3. Examples
1 <?php
2
3 /**
4 * This program computes the logarithm base b (b > 1)
5 * of a given number x > 0
6 */
7
8 if($argc != 3) {
9 printf("Usage: %s b x \n", $argv[0]);
10 exit(1);
11 }
12
13 $b = floatval($argv[1]);
14 $x = floatval($argv[2]);
15
16 if($x <= 0) {
17 printf("Error: x must be greater than zero\n");
18 exit(1);
19 }
20 if($b <= 1) {
21 printf("Error: base must be greater than one\n");
22 exit(1);
23 }
24
25 $result = log($x) / log($b);
26 printf("log_(%f)(%f) = %f\n", $b, $x, $result);
27
28 ?>
Code Sample 38.2.: Logarithm Calculator Program in C
523
38. Conditionals
1 <?php
2 //prompt for income from the user
3 printf("Please enter your Adjusted Gross Income: ");
4
5 $income = floatval(trim(fgets(STDIN)));
6
7 //prompt for children
8 printf("How many children do you have? ");
9 $numChildren = intval(trim(fgets(STDIN)));
10
11 if($income < 0 || $numChildren < 0) {
12 printf("Invalid inputs");
13 exit(1);
14 }
15
16 if($income <= 18150) {
17 $baseTax = $income * .10;
18 } else if($income <= 73800) {
19 $baseTax = 1815 + ($income -18150) * .15;
20 } else if($income <= 148850) {
21 $baseTax = 10162.50 + ($income - 73800) * .25;
22 } else if($income <= 225850) {
23 $baseTax = 28925.00 + ($income - 148850) * .28;
24 } else if($income <= 405100) {
25 $baseTax = 50765.00 + ($income - 225850) * .33;
26 } else if($income <= 457600) {
27 $baseTax = 109587.50 + ($income - 405100) * .35;
28 } else {
29 $baseTax = 127962.50 + ($income - 457600) * .396;
30 }
31
32 if($numChildren <= 3) {
33 $credit = $numChildren * 1000;
34 } else {
35 $credit = 3000;
36 }
37
38 if($baseTax - $credit >= 0) {
39 $totalTax = $baseTax - $credit;
40 } else {
41 $totalTax = 0;
42 }
43
44 printf("AGI: $%10.2f\n", $income);
45 printf("Tax: $%10.2f\n", $baseTax);
46 printf("Credit: $%10.2f\n", $credit);
47 printf("Tax Liability: $%10.2f\n", $totalTax);
48
49 ?>
Code Sample 38.3.: Tax Program in PHP
524
38.3. Examples
1 <?php
2
3 /**
4 * This program computes the roots to a quadratic equation
5 * using the quadratic formula.
6 */
7
8 if($argc != 4) {
9 printf("Usage: %s a b c\n", $argv[0]);
10 exit(1);
11 }
12
13 $a = floatval($argv[1]);
14 $b = floatval($argv[2]);
15 $c = floatval($argv[3]);
16
17 if($a === 0) {
18 printf("Error: a cannot be zero\n");
19 exit(1);
20 } else if($b*$b < 4*$a*$c) {
21 printf("Error: cannot handle complex roots\n");
22 exit(1);
23 } else if($b*$b === 4*$a*$c) {
24 $root1 = -$b / (2*$a);
25 printf("Only one distinct root: %f\n", $root1);
26 } else {
27 $root1 = (-$b + sqrt($b*$b - 4*$a*$c) ) / (2*$a);
28 $root2 = (-$b - sqrt($b*$b - 4*$a*$c) ) / (2*$a);
29
30 printf("The roots of %fx^2 + %fx + %f are: \n", $a, $b, $c);
31 printf(" root1 = %f\n", $root1);
32 printf(" root2 = %f\n", $root2);
33 }
34
35 ?>
Code Sample 38.4.: Quadratic Roots Program in PHP With Error Checking
525
39. Loops
PHP supports while loops, for loops, and do-while loops using the keywords while , for ,
and do (along with another while ). Continuation conditions for loops are enclosed in
parentheses, (...) and blocks of code associated with the loop are enclosed in curly
brackets.
39.1. While Loops
Code Sample 39.1 contains an example of a basic while loop in PHP. As with conditional
statements, our code style places the opening curly bracket on the same line as the
while keyword and continuation condition. The inner block of code is also indented
and all lines in the block are indented to the same level.
In addition, the continuation condition does not contain a semicolon since it is not an
executable statement. Just as with an if-statement, if we had placed a semicolon it would
have led to unintended results. Consider the following:
1 while($i <= 10); {
2 //perform some action
3 $i++; //iteration
4 }
A similar problem occurs. The while keyword and continuation condition bind to
the next executable statement or code block. As a consequence of the semicolon, the
executable statement that gets bound to the while loop is empty. What happens is
1 $i = 1; //Initialization
2 while($i <= 10) { //continuation condition
3 //perform some action
4 $i++; //iteration
5 }
Code Sample 39.1.: While Loop in PHP
527
39. Loops
1 $i = 1;
2 $flag = true;
3 while($flag) {
4 //perform some action
5 $i++; //iteration
6 if($i>10) {
7 $flag = false;
8 }
9 }
Code Sample 39.2.: Flag-controlled While Loop in PHP
even worse: the program will enter an infinite loop. To see this, the code is essentially
equivalent to the following:
1 while($i <= 10) {
2 }
3 {
4 //perform some action
5 $i++; //iteration
6 }
In the while loop, we never increment the counter variable $i , the loop does nothing,
and so the computation will continue on forever! It is valid PHP and will run, but
obviously won’t work as intended. Avoid this problem by using proper syntax.
Another common use for a while loop is a flag-controlled loop in which we use a Boolean
flag rather than an expression to determine if a loop should continue or not. Since PHP
has built-in Boolean types, we can use a variable along with the keywords true and
false . An example can be found in Code Sample 39.2.
39.2. For Loops
For loops in PHP use the familiar syntax of placing the initialization, continuation
condition, and iteration on the same line as the for keyword. An example can be found
in Code Sample 39.3.
Semicolons are placed at the end of the initialization and continuation condition, but not
the iteration statement. With while loops, the opening curly bracket is placed on the
same line as the for keyword. Code within the loop body is indented, all at the same
indentation level.
528
39.3. Do-While Loops
1 $i;
2 for($i=1; $i<=10; $i++) {
3 //perform some action
4 }
Code Sample 39.3.: For Loop in PHP
1 $i;
2 do {
3 //perform some action
4 $i++;
5 } while($i <= 10);
Code Sample 39.4.: Do-While Loop in PHP
39.3. Do-While Loops
PHP also supports do-while loops. Recall that the difference between a while loop and a
do-while loop is when the continuation condition is checked. For a while loop it is prior
to the beginning of the loop body and in a do-while loop it is at the end of the loop.
This means that a do-while always executes at least once. An example can be found in
Code Sample 39.4.
The opening curly bracket is again on the same line as the keyword do . The while
keyword and continuation condition are on the same line as the closing curly bracket.
In a slight departure from previous syntax, a semicolon does appear at the end of the
continuation condition even though it is not an executable statement.
39.4. Foreach Loops
Finally, PHP supports foreach loops using the keyword foreach . Some of this will be a
preview of Section 42 where we discuss arrays in PHP,1 In short you can iterate over the
elements of an array as follows.
1 $arr = array(1.41, 2.71, 3.14);
2 foreach($arr as $x) {
3 //x now holds the "current" element in arr
1
Actually, PHP supports associative arrays, which are not the same thing as traditional arrays.
529
39. Loops
4 }
In the foreach syntax we specify the array we want to iterate over, $arr and use the
keyword as . The last element in the statement is the variable name that we want to use
within the loop. This should be read as “ foreach element $x in the array $arr ...”.
Inside the loop, the variable $x will be automatically updated on each iteration to the
next element in $arr .
39.5. Examples
39.5.1. Normalizing a Number
Let’s revisit the example from Section 4.1.1 in which we normalize a number by continually
dividing it by 10 until it is less than 10. The code in Code Sample 39.5 specifically refers
to the value 32145.234 but would work equally well with any value of $x .
1 $x = 32145.234;
2 $k = 0;
3 while($x > 10) {
4 $x = $x / 10;
5 $k++;
6 }
Code Sample 39.5.: Normalizing a Number with a While Loop in PHP
39.5.2. Summation
Let’s revisit the example from Section 4.2.1 in which we computed the sum of integers
1 + 2 + · · · + 10. The code is presented in Code Sample 39.6
We could easily generalize this code. Instead of computing a sum up to a particular
number, we could have written it to sum up to another variable $n , in which case the
for loop would instead look like the following.
1 for($i=1; $i<=$n; $i++) {
2 $sum += $i;
3 }
530
39.5. Examples
1 $sum = 0;
2 for($i=1; $i<=10; $i++) {
3 $sum += $i;
4 }
Code Sample 39.6.: Summation of Numbers using a For Loop in PHP
39.5.3. Nested Loops
Recall that you can write loops within loops. The inner loop will execute fully for each
iteration of the outer loop. An example of two nested of loops in PHP can be found in
Code Sample 39.7.
1 $n = 10;
2 $m = 20;
3 for($i=0; $i<$n; $i++) {
4 for($j=0; $j<$m; $j++) {
5 printf("(i, j) = (%d, %d)\n", $i, $j);
6 }
7 }
Code Sample 39.7.: Nested For Loops in PHP
The inner loop executes for j = 0, 1, 2, . . . , 19 < m = 20 for a total of 20 itera-
tions. However, it executes 20 times for each iteration of the outer loop. Since
the outer loop executes for i = 0, 1, 2, . . . , 9 < n = 10, the total number of times
the printf() statement executes is 10 × 20 = 200. In this example, the sequence
(0, 0), (0, 1), (0, 2), . . . , (0, 19), (1, 0), . . . , (9, 19) will be printed.
39.5.4. Paying the Piper
Let’s adapt the solution for the loan amortization schedule we developed in Section 4.7.3.
First, we’ll read the principle, terms, and interest as command line inputs. Adapting the
formula for the monthly payment and using the standard math library’s pow() function,
we get
1 $monthlyPayment = ($monthlyInterestRate * $principle) /
2 (1 - pow( (1 + $monthlyInterestRate), -$n));
531
39. Loops
The monthly payment may come out to be a fraction of a cent, say $43.871. For accuracy,
we need to ensure that all of the figures for currency are rounded to the nearest cent.
The standard math library does have a round() function, but it only rounds to the
nearest whole number, not the nearest 100th.
However, we can adapt the “off-the-shelf” solution to fit our needs. If we take the number,
multiply it by 100, we get 4387.1 which we can now round to the nearest whole number,
giving us 4387. We can then divide by 100 to get a number that has been rounded to
the nearest 100th!
$monthlyPayment = round($monthlyPayment * 100) / 100;
We can use the same trick to round the monthly interest payment and any other number
expected to be whole cents. To output our numbers, we use printf() and take care to
align our columns to make make it look nice. To finish our adaptation, we handle the
final month separately to account for an over/under payment due to rounding. The full
solution can be found in Code Sample 39.8.
532
39.5. Examples
1 <?php
2 if($argc != 4) {
3 printf("Usage: %s principle apr terms\n", $argv[0]);
4 exit(1);
5 }
6
7 $principle = floatval($argv[1]);
8 $apr = floatval($argv[2]);
9 $n = intval($argv[3]);
10
11 $balance = $principle;
12 $monthlyInterestRate = $apr / 12;
13
14 //monthly payment
15 $monthlyPayment = ($monthlyInterestRate * $principle) /
16 (1 - pow( (1 + $monthlyInterestRate), -$n));
17 //round to the nearest cent
18 $monthlyPayment = round($monthlyPayment * 100) / 100;
19
20 printf("Principle: $%.2f\n", $principle);
21 printf("APR: %.4f%%\n", $apr * 100.0);
22 printf("Months: %d\n", $n);
23 printf("Monthly Payment: $%.2f\n", $monthlyPayment);
24
25 //for the first n-1 payments in a loop:
26 for($i=1; $i<$n; $i++) {
27 // compute the monthly interest, rounded:
28 $monthlyInterest =
29 round( ($balance * $monthlyInterestRate) * 100) / 100;
30 // compute the monthly principle payment
31 $monthlyPrinciplePayment = $monthlyPayment - $monthlyInterest;
32 // update the balance
33 $balance = $balance - $monthlyPrinciplePayment;
34 // print i, monthly interest, monthly principle, new balance
35 printf("%d\t$%10.2f $%10.2f $%10.2f\n", $i, $monthlyInterest,
36 $monthlyPrinciplePayment, $balance);
37 }
38
39 //handle the last month and last payment separately
40 $lastInterest = round( ($balance * $monthlyInterestRate) * 100) / 100;
41 $lastPayment = $balance + $lastInterest;
42
43 printf("Last payment = $%.2f\n", $lastPayment);
44 ?>
Code Sample 39.8.: Loan Amortization Program in PHP
533
40. Functions
Functions are essential in PHP programming. PHP provides a large library of standard
functions to perform basic input/output, math, and many other functions. PHP also
provides the ability to define and use your own functions.
PHP does not support function overloading, so when you define a function and give it a
name, that name cannot be in conflict with any other function name in the standard
library or any other code that you might use. Careful thought should go into the design
and naming of your functions.
PHP supports both call by value and call by reference. As of PHP 5.6, vararg functions
are also supported (though earlier versions supported some vararg-like functions such as
printf() ). However, we will not go into detail here. Finally, another feature of PHP
is that function parameters are all optional. You may invoke a function with a subset
of the parameters. Depending on your PHP setup, the interpreter may issue a warning
that a parameter was omitted. However, PHP allows you to define default values for
optional parameters.
40.1. Defining & Using Functions
In general, you can define functions anywhere in your PHP script or codebase. They can
even appear after code that invokes them because PHP hoists the function definitions
by doing two passes of the script. However, it is good style to include function definitions
at the top of your script or in a separate PHP file for organization.
40.1.1. Declaring Functions
In PHP, to declare a function you use the keyword function . Because PHP is dynami-
cally typed, a function can return any type. Therefore, you do not declare the return
type (just as you do not declare a variable’s type). After the function keyword you
provide an identifier and parameters as the function signature. Immediately following,
you provide the function body enclosed with opening/closing curly brackets.
Typically, the documentation for functions is included with its declaration. Consider
the following examples. In these examples we use a commenting style known as “doc
comments.” This style was originally developed for Java but has since been adopted by
many other languages.
535
40. Functions
1 /**
2 * Computes the sum of the two arguments.
3 */
4 function sum($a, $b) {
5 return ($a + $b);
6 }
7
8 /**
9 * Computes the Euclidean distance between the 2-D points,
10 * (x1,y1) and (x2,y2).
11 */
12 function getDistance($x1, $y1, $x2, $y2) {
13 $xDiff = ($x1-$x2);
14 $yDiff = ($y1-$y2);
15 return sqrt( $xDiff * $xDiff + $yDiff * $yDiff);
16 }
17
18 /**
19 * Computes a monthly payment for a loan with the given
20 * principle at the given APR (annual percentage rate) which
21 * is to be repaid over the given number of terms (usually
22 * months).
23 */
24 function getMonthlyPayment($principle, $apr, $terms) {
25 $rate = ($apr / 12.0);
26 $payment = ($principle * $rate) / (1-pow(1+$rate, -$terms));
27 return $payment;
28 }
Function identifiers (names) follow similar naming rules as variables, however they do
not begin with a dollar sign. Function names must begin with an alphabetic character
and may contain alphanumeric characters as well as underscores. However, using modern
coding conventions we usually name functions using lower camel casing. Another quirk
of PHP is that function names are case insensitive. Though we declared a function,
getDistance() above, it could be invoked with either getdistance() , GETDISTANCE
or any other combination of uppercase/lowercase letters. However, good code will use
consistent naming and your function calls should match their declaration.
The keyword return is used to specify the value that is returned to the calling function.
Whatever value you end up returning is the return type of the function. Since you do not
specify variable or return types, functions are usually referred to as returning a “mixed”
type. You could design a function that, given one set of inputs, returns a number while
another set of inputs returns a string. You can use the syntax return; to return no
536
40.1. Defining & Using Functions
value (you do not use the keyword void ). In practice, however, the function ends up
returning null when doing this.
40.1.2. Organizing Functions
There are many coding standards that guide how PHP code should be organized. We’ll
only discuss a simple mechanism here. One way to organize functions is to collect
functions with similar functionality into separate PHP source files.
Suppose the functions above are in a PHP source file named utils.php . We could
include them in another source file (our “main” source file) using an include_once
function invocation. An example:
1 <?php
2
3 include_once("utils.php");
4
5 //we can now use the functions in utils.php:
6 $p = getMonthlyPayment(1000, 0.05, 12);
7
8 ?>
The include_once function loads and evaluates the given PHP source file at the point
in the code in which it is invoked. The “once” in the function refers to the fact that if
the source file was already included in the script/code before, it will not be included
a second time. This allows you to include the same source file in multiple source files
without a conflict.
40.1.3. Calling Functions
The syntax for calling a function is to simply provide the function name followed by
parentheses containing values or variables to pass to the function. Some examples:
1 $a = 10, $b = 20;
2 $c = sum($a, $b); //c contains the value 30
3
4 //invoke a function with literal values:
5 $dist = getDistance(0.0, 0.0, 10.0, 20.0);
6
7 //invoke a function with a combination:
8 $p = 1500.0;
9 $r = 0.05;
10 $monthlyPayment = getMonthlyPayment($p, $r, 60);
537
40. Functions
40.1.4. Passing By Reference
By default, all types (including numbers, strings, etc.) are passed by value. To be able
to pass arguments by reference, we need to use slightly different syntax when defining
our functions.
To specify that a parameter is to be passed by reference, we place an ampersand, & in
front of it in the function signature.1 No other syntax is necessary. When you call the
function, PHP automatically takes care of the referencing/dereferencing for you.
1 <?php
2
3 function swap($a, $b) {
4 $t = $a;
5 $a = $b;
6 $b = $t;
7 }
8
9 function swapByRef(&$a, &$b) {
10 $t = $a;
11 $a = $b;
12 $b = $t;
13 }
14
15 $x = 10;
16 $y = 20;
17
18 printf("x = %d, y = %d\n", $x, $y);
19 swap($x, $y);
20 printf("x = %d, y = %d\n", $x, $y);
21 swapByRef($x, $y);
22 printf("x = %d, y = %d\n", $x, $y);
23
24 ?>
The first function, swap() passes both variables by value. Swapping the values only
affects the copies of the parameters. The original variables $x and $y will be unaffected.
In the second function, swapByRef() , both variables are passed by reference as there
are ampersands in front of them. Swapping them inside the function swaps the original
1
Those familiar with pointers in C will note that this is the exact opposite of the C operator.
538
40.1. Defining & Using Functions
variables. The output to this code is as follows.
x = 10, y = 20
x = 10, y = 20
x = 20, y = 10
Observe that when we invoked the function, swapByRef($x, $y); we used the same
syntax as the pass by value version. The only syntax needed to pass by reference is in
the function signature itself.
40.1.5. Optional & Default Parameters
Parameters in PHP functions are optional. You can invoke a function without providing
a subset of parameters. However, if a parameter is not provided, PHP will treat
the parameter as null . If we invoked the getDistance() function with only two
parameters:
getDistance(10.0, 20.0);
then inside the function, $x1 and $y1 would take on the values 10 and 20, but $x2
and $y2 would be null . When used in the distance formula calculations, both would
be treated as zero. If we had invoked the function with no arguments,
getDistance();
then all four parameters would be treated as null (and thus zero in the calculations).
PHP also allows you to define alternative default values for function parameters. Consider
the following example.
1 function getMonthlyPayment($principle, $apr = 0.05, $terms = 60) {
2 $rate = ($apr / 12);
3 $mp = (($principle * $rate) / (1-pow(1+$rate, -$terms)));
4 return round($mp * 100) / 100;
5 }
In this example, the second and third parameter have been given default values of 0.05
and 60 respectively. If a call to this function omits these parameters, they are not treated
as null , but take on these defaults instead.
1 $x = getMonthlyPayment(10000, 0.07, 72);
2 print $x."\n"; //170.49
3
4 //terms will be 60
5 $x = getMonthlyPayment(10000, 0.07);
539
40. Functions
6 print $x."\n"; //198.01
7
8 //apr will be 0.05, terms will be 60
9 $x = getMonthlyPayment(10000);
10 print $x."\n"; //188.71
11
12 //balance will be null (0), apr will be 0.05, terms will be 60
13 $x = getMonthlyPayment();
14 print $x."\n"; //0 but also a warning
It would not be possible to invoke getMonthlyPayment() by omitting only the second
argument. Providing n arguments will match the first n parameters. Thus, in your
function design you should place any optional/default parameters last.
40.1.6. Function Pointers
Functions are just pieces of code that reside somewhere in memory just as variables do.
Since we can pass variables by reference, it also makes sense that we would do the same
with functions.
In PHP, functions are first-class citizens2 meaning that you can assign a function to a
variable just as you would a numeric value. For example, you can do the following.
1 $func = swapByRef;
2
3 $func($x, $y);
In the example above, we assigned the function swapByRef() to the variable $func
by using its identifier. The variable essentially holds a reference to the swapByRef()
function. Since it refers to a function, we can also invoke the function using the variable
as in the last line. This allows you to treat functions as callbacks to other functions. We
will revisit this concept in Chapter 47.
40.2. Examples
40.2.1. Generalized Rounding
Recall that the standard math library provides a round() function that rounds a number
to the nearest whole number. We’ve had need to round to cents as well. We now have
2
Some would use a much more restrictive definition of first-class and would not consider them first-class
citizens in this sense
540
40.2. Examples
the ability to write a function to do this for us. Before we do, however, let’s think more
generally. What if we wanted to round to the nearest tenth? Or what if we wanted to
round to the nearest 10s or 100s place? Let’s write a general purpose rounding function
that allows us to specify which decimal place to round to.
The most natural input would be to specify the place using an integer exponent. That
is, if we wanted to round to the nearest tenth, then we would pass it −1 as 0.1 = 10−1 ,
−2 if we wanted to round to the nearest 100th, etc. In the other direction, passing in 0
would correspond to the usual round function, 1 to the nearest 10s spot, and so on.
Moreover, we could demonstrate good code reuse (as well as procedural abstraction)
by scaling the input value and reusing the functionality already provided in the math
library’s round() function. We could further define a roundToCents() function that
used our generalized round function. Consider the following.
1 <?php
2
3 /**
4 * Rounds to the nearest digit specified by the place
5 * argument. In particular to the (10^place)-th digit
6 */
7 function roundToPlace($x, $place) {
8 $scale = pow(10, -$place);
9 $rounded = round(x * $scale) / $scale;
10 return $rounded;
11 }
12
13 /**
14 * Rounds to the nearest cent
15 */
16 function roundToCents($x) {
17 return roundToPlace($x, -2);
18 }
19
20 ?>
We could place these functions into a file named round.php and include them in another
PHP source file.
40.2.2. Quadratic Roots
Another advantage of passing variables by reference is that we can “return” multiple
values with one function call. Functions are limited in that they can only return at most
one value. But if we pass multiple parameters by reference, the function can manipulate
541
40. Functions
the contents of them, thereby communicating (though not strictly returning) multiple
values.
Consider again the problem of computing the roots of a quadratic equation,
ax2 + bx + c = 0
using the quadratic formula, √
−b ± b2 − 4ac
x=
2a
Since there are two roots, we may have to write two functions, one for the “plus” root
and one for the “minus” root both of which take the coefficients, a, b, c as arguments.
However, if we wrote a single function that took the coefficients as parameters by value
as well as two other parameters by reference, we could compute both root values, one in
each of the by-reference variables.
1 function quadraticRoots($a, $b, $c, &$root1, &$root2) {
2 $discriminant = sqrt($b*$b - 4*$a*$c);
3 $root1 = (-$b + $discriminant) / (2*$a);
4 $root2 = (-$b - $discriminant) / (2*$a);
5 return;
6 }
By using pass by reference variables, we avoid multiple functions. Recall that there
could be several “bad” inputs to this function. The roots could be complex values, the
coefficient a could be zero, etc. In the next chapter, we examine how we can handle these
errors.
542
41. Error Handling & Exceptions
Modern versions of PHP support error handling through the use of exceptions. PHP has
several different predefined types of exceptions and also allows you to define your own
exception types by creating new classes that inherit from the generic Exception class.
PHP uses the standard try-catch-finally control structure to handle exceptions and
allows you to throw your own exceptions.
41.1. Throwing Exceptions
Though PHP defines several different types of exceptions, we’ll only cover the generic
Exception class. We can throw an exception in PHP by using the keyword throw
and creating a new Exception with an error message.
throw new Exception("Something went wrong");
By using a generic Exception , we can only attach a message to the exception (which
can be printed by code that catches the exception). If we want more fine-grained control
over the type of exceptions, we need to define our own exceptions.
41.2. Catching Exceptions
To catch an exception in PHP you can use the standard try-catch control block.
Optionally (and as of PHP version 5.5.0) you can use the finally block to clean up any
resources or execute code regardless of whether or not an exception was raised. Consider
the simple task of reading input from a user and manually parsing its value into an
integer. If the user enters a non-numeric value, parsing will fail and we should instead
throw an exception. Consider the following function.
1 function readNumber() {
2 $input = readline("Please enter a number: ");
3 if( is_numeric($input) ) {
4 $value = floatval($input);
5 } else {
6 throw new Exception("Invalid input!");
7 }
8 }
543
41. Error Handling & Exceptions
Elsewhere in the code, we can surround a call to readNumber() in a try-catch
statement.
1 try {
2 readNumber();
3 } catch(Exception $e) {
4 printf("Error: exception encountered: " . $e->getMessage());
5 exit(1);
6 }
In this example, we’ve simply displayed an error message to the standard output and exited
the program. We’ve made the design decision that this error should be fatal. We could
have chosen to handle this error differently in the catch block. The $e->getMessage()
prints the message that the exception was created with. In this case, "Invalid input!" .
41.3. Creating Custom Exceptions
As of PHP 5.3.0 it is possible to define custom exceptions by extending the Exception
class. To do this, you need to declare a new class. We cover classes and objects in
Chapter 45. For now, we present a simple example. Consider the example in the previous
chapter of computing the roots of a quadratic polynomial. One possible error situation
is when the roots are complex numbers. We could define a new PHP exception class as
follows.
1 /**
2 * Defines a ComplexRoot exception class
3 */
4 class ComplexRootException extends Exception
5 {
6 public function __construct($message = null,
7 $code = 0,
8 Exception $previous = null) {
9 // call the parent constructor
10 parent::__construct($message, $code, $previous);
11 }
12
13 // custom string representation of object
14 public function __toString() {
15 return __CLASS__ . ": [{$this->code}]: {$this->message}\n";
16 }
17 }
544
41.3. Creating Custom Exceptions
Now in our code we can catch and even throw this new type of exception.
1 if( $b*$b - 4*$a*$c < 0) {
2 throw new ComplexRootException("Cannot Handle complex roots");
3 }
1 try {
2 $r1 = getRoot($a, $b, $c);
3 } catch(ComplexRootException $e) {
4 //handle here
5 } catch(Exception $e) {
6 //handle all other types of exceptions here
7 }
In the code above we had two catch blocks. Since we can have multiple types of
exceptions, we can catch each different type and handle them differently if we choose.
Each catch block catches a different type of exception. The last catch block was
written to catch a generic Exception . Much like an if-else-if statement, the first
type of exception that is caught is the block that will be executed and they are all
mutually exclusive. Thus, a generic “catch all” block like this should always be the last
catch block. The most specific types of exceptions should be caught first and the most
general types should be caught last.
545
42. Arrays
PHP allows you to use arrays, but PHP arrays are actually associative arrays. Though
you can treat them as regular arrays and use contiguous integer indices, they are more
flexible than that. Integer indices need to be contiguous or start at zero and you can
use strings as indices. In addition, since PHP is dynamically typed, PHP arrays allow
mixed types. An array has no fixed type and you can place different mixed types
into the same array. PHP arrays are dynamic, so there is no memory management or
allocation/deallocation of memory space. Arrays will grow and shrink automatically as
you add and remove elements.
42.1. Creating Arrays
Since PHP is dynamically typed, you do not need to declare an array or specify a
particular type of variable that it holds. However, there are several ways that you
can initialize an array. To create an empty array, you can call the array() function.
Optionally, you can provide an initial list of elements to insert into the array by providing
the list of elements as arguments to the function.
1 //create an empty array:
2 $arr = array();
3
4 //create an array with elements 10, 20, 30:
5 $arr = array(10, 20, 30);
6
7 //create an array with mixed types:
8 $arr = array(10, 3.14, "Hello");
42.2. Indexing
By default, when inserting elements, 0-indexing is used. In the three examples above,
each element would be located at indices 0, 1, and 2 respectively. The usual square
bracket syntax can be used to access and assign elements.
547
42. Arrays
1 //create an array with elements 10, 20, 30:
2 $arr = array(10, 20, 30);
3
4 //get the first element:
5 $x = $arr[0]; //x has value 10
6
7 //change the 3rd element to 5:
8 $arr[2] = 5;
9
10 //print the 2nd element:
11 printf("$arr[1] = %d\n", $arr[1]);
Attempting to access an element at an invalid index does not result in an error or an
exception (though a warning may be issued depending on how PHP is setup). Instead, if
you attempt to access an invalid element, it will be treated as a null value.
1 $arr = array(10, 20, 30);
2 $x = $arr[10]; //x is null
However, an array could have null values in it as elements. How do we distinguish
whether or not an accessed value was actually null or if it is not part of the array?
PHP provides a function, array_key_exists() to distinguish between these two cases.
It returns true or false depending on whether or not a particular index has been set
or not.
1 $arr = array(10, null, 30);
2 if(array_key_exists(1, $arr)) {
3 print "index 1 contains an element\n";
4 }
5 if(!array_key_exists(10, $arr)) {
6 print "index 10 does not contain an element\n";
7 }
8
9 if($arr[1] === $arr[10]) {
10 print "but they are both null\n";
11 }
548
42.2. Indexing
42.2.1. Strings as Indices
Since arrays in PHP are associative arrays, keys are not limited to integers. You can also
use strings as keys to index elements.
1 $arr = array();
2 $arr[0] = 5;
3 $arr["foo"] = 10;
4 $arr["hello"] = "world";
5
6 print "value = " . $arr["hello"];
Note that strings that contain integer values will be type-juggled into their numeric
values. For example, $arr["10"] = 3; will be equivalent to $arr[10] = 3; . However,
strings containing floating point values will not be coerced but will remain as strings,
$arr["3.15"] = 7; for example.
42.2.2. Non-Contiguous Indices
Another aspect of PHP associative arrays is that integer indices need not be contiguous.
For example,
1 $arr = array();
2 $arr[0] = 10;
3 $arr[5] = 20;
The values at indices 1 through 4 are undefined and the array contains some “holes” in
its indices.
42.2.3. Key-Value Initialization
Since associative arrays in PHP can be indexed by either integers or strings and need not
be ordered or contiguous, we can use a special key-value initialization syntax to define
not only the values, but the keys that map to those values when we initialize an array.
The “double arrow,” => is used to denote the mapping.
1 $arr = array(
2 "foo" => 5,
3 4 => "bar",
4 0 => 3.14,
549
42. Arrays
5 "baz" => "ten"
6 );
42.3. Useful Functions
There are dozens of useful functions PHP defines that can be used with arrays. We’ll
only highlight a few of the more useful ones. First, the count() function can be used
to compute how many elements are stored in the array.
1 $arr = array(10, 20, 30);
2 $n = count($arr); //n is 3
For convenience and debugging, a special function, print_r() allows you to print the
contents of an array in a human-readable format that resembles the key-value initialization
syntax above. For example,
1 $arr = array(
2 "foo" => 5,
3 4 => "bar",
4 0 => 3.14,
5 "baz" => "ten"
6 );
7 print_r($arr);
would end up printing
Array
(
[foo] => 5
[4] => bar
[0] => 3.14
[baz] => ten
)
Two other functions, array_keys() and array_values() return new zero-indexed
arrays containing the keys and the values of an array respectively. Reusing the example
above,
550
42.4. Iteration
1 $keys = array_keys($arr);
2 $vals = array_values($arr);
3 print_r($keys);
4 print_r($vals);
would print
Array
(
[0] => foo
[1] => 4
[2] => 0
[3] => baz
)
Array
(
[0] => 5
[1] => bar
[2] => 3.14
[3] => ten
)
Finally, you can use the equality operators, == and === to compare arrays. The first is
the loose equality operator and evaluates to true if the two compared arrays have the
same key-value pairs while the second is the strict equality operator and is true only if
the arrays have the same key/value pairs in the same order and are of the same type.
42.4. Iteration
If we have an array in PHP that we know is 0-indexed and all elements are contiguous, we
can use a normal for loop to iterate over its elements by incrementing an index variable.
1 for($i=0; $i<count($arr); $i++) {
2 print $arr[$i] . "\n";
3 }
This fails, however, when we have an associative array that has a mix of integer and
string keys or “holes” in the indexing of integer keys. For this reason, it is more reliable
to use foreach loops. There are several ways that we can use a foreach loop. The
most general usage is to use the double arrow notation to iterate over each key-value
pair.
551
42. Arrays
1 //for each key value pair:
2 foreach($arr as $key => $val) {
3 print "$key maps to $val \n";
4 }
This syntax gives you access to both the key and the value for each element in the array
$arr . The keyword as is used to denote the variable names $key and $val that
will be changed on each iteration of the loop. You need not use the identifiers $key and
$val ; you can use any legal variable names for the key/value variables. If you do not
need the keys when iterating, you can use the following shorthand syntax.
1 //for each value:
2 foreach($arr as $val) {
3 print "$val \n";
4 }
42.5. Adding Elements
You can easily add elements to an array by providing an index and using the assignment
operator as in the previous examples. There are also several functions PHP defines that
can insert elements to the beginning ( array_unshift() ), end ( array_push() ) or at
an arbitrary position ( array_splice() ).
1 $arr = array(10, 20, 30);
2
3 array_unshift($arr, 15);
4 //arr is now [15, 10, 20, 30]
5
6 array_push($arr, 25);
7 //arr is now [15, 10, 20, 30, 25]
8
9 //insert 35 at index 3:
10 array_splice($arr, 3, 0, 35);
11 //arr is now [15, 10, 20, 35, 30, 25]
Another, simpler way of adding elements is to use the following syntax:
552
42.6. Removing Elements
1 $arr = array(10, 20, 30);
2 $arr[] = 5;
3 $arr[] = 15;
4 $arr[] = 25;
5 print_r($arr);
By using the assignment operator but not specifying the index, the element will be added
to the next available integer index. Since there were already 3 elements in the array, each
subsequent element is inserted at index 3, 4, and 5 respectively. In general, the element
will be inserted at the maximum index value already used plus one. The example above
results in the following.
Array
(
[0] => 10
[1] => 20
[2] => 30
[3] => 5
[4] => 15
[5] => 25
)
42.6. Removing Elements
You can remove elements from an array using the unset() function. This function only
removes the element from the array, it does not shift other elements down to fill in the
unused index.
1 $arr = array(10, 20, 30);
2 unset($arr[1]);
3 print_r($arr);
This example would result in the following.
Array
(
[0] => 10
[2] => 30
)
Further, you can use unset() to destroy all elements in the array:
553
42. Arrays
unset($arr);
destroys the entire array. It does not merely empty the array, but it unsets the variable
$arr itself.
42.7. Using Arrays in Functions
By default, all arguments to a function in PHP are passed by value; this includes arrays.
Thus, if you make any changes to an array passed to a function, the changes are not
realized in the calling function. You can explicitly specify that the array parameter is
passed by reference so that any changes to the array are realized in the calling function.
To illustrate, consider the following example.
1 function setFirst($a) {
2 $a[0] = 5;
3 }
4
5 $arr = array(10, 20, 30);
6 print_r($arr);
7 setFirst($arr);
8 print_r($arr);
This example results in the following.
Array
(
[0] => 10
[1] => 20
[2] => 30
)
Array
(
[0] => 10
[1] => 20
[2] => 30
)
That is, the change to the first element does not affect the original array. However, if we
specify that the array is passed by reference, then the change is realized. For example,
1 function setFirst(&$a) {
2 $a[0] = 5;
3 }
4
5 $arr = array(10, 20, 30);
554
42.8. Multidimensional Arrays
6 print_r($arr);
7 setFirst($arr);
8 print_r($arr);
This now results in the original array being changed:
Array
(
[0] => 10
[1] => 20
[2] => 30
)
Array
(
[0] => 5
[1] => 20
[2] => 30
)
42.8. Multidimensional Arrays
PHP supports multidimensional arrays in the sense that elements in an array can be of
any type, including other arrays. We can use the same syntax and operations for single
dimensional arrays. For example, we can use the double arrow syntax and assign arrays
as values to create a 2-dimensional array.
1 $mat = array(
2 0 => array(10, 20, 30),
3 1 => array(40, 50, 60),
4 2 => array(70, 80, 90)
5 );
6 print_r($mat);
Which results in the following:
Array
(
[0] => Array
(
[0] => 10
[1] => 20
[2] => 30
)
555
42. Arrays
[1] => Array
(
[0] => 40
[1] => 50
[2] => 60
)
[2] => Array
(
[0] => 70
[1] => 80
[2] => 90
)
)
Alternatively, you can use two indices to get and set values from a 2-dimensional array.
1 for($i=0; $i<3; $i++) {
2 for($j=0; $j<4; $j++) {
3 $mat[$i][$j] = ($i+$j)*3;
4 }
5 }
which results in:
Array
(
[0] => Array
(
[0] => 0
[1] => 3
[2] => 6
[3] => 9
)
[1] => Array
(
[0] => 3
[1] => 6
[2] => 9
[3] => 12
)
[2] => Array
(
[0] => 6
[1] => 9
[2] => 12
[3] => 15
)
)
556
43. Strings
As we’ve previously seen, PHP has a built-in string type. Internally, PHP strings are
simply a sequence of bytes, but for our purposes we can treat it as a 0-indexed character
array. PHP strings are mutable and can be changed, but it is considered best practice to
treat them as immutable and rely on the many functions PHP provides to manipulate
strings.
43.1. Basics
We can create strings by assigning a string literal value to a variable. Strings can be
specified by either single quotes or double quotes (there are no individual characters in
PHP, only single character strings), but we will use the double quote syntax.
1 $firstName = "Thomas";
2 $lastName = "Waits";
3
4 //we can also reassign values
5 $firstName = "Tom";
The reassignment in the last line in the example effectively destroys the old string. The
assignment operator can also be used to make copies of strings.
1 $firstName = "Thomas";
2 $alias = $firstName;
It is important to understand that this assignment makes a deep copy of the string.
Changes to the first do not affect the second one. You can make changes to individual
characters in a string by treating it like a zero-indexed array.
1 $a = "hello";
2 $a[0] = "H";
3 $a[5] = "!";
4 //a is now "Hello!"
557
43. Strings
The last line extends the string by adding an additional character. You can even remove
characters by setting them to the empty string.
1 $a = "Apples!";
2 $a[5] = "";
3 //a is now "Apple!"
43.2. String Functions
PHP provides dozens of convenient functions that allow you to process and modify strings.
We highlight a few of the more common ones here. A full list of supported functions can
be found in standard documentation. Because of the history of PHP, many of the same
functions defined in the C string library can also be used in PHP.
Length
When accessing individual characters in a string, it is necessary that we know the length
of the string so that we do not access invalid characters (though doing so is not an error,
it just results in null ). The strlen() function returns an integer that represents the
number of characters in the string.
1 $s = "Hello World!";
2 $x = strlen($s); //x is 12
3 $s = "";
4 $x = strlen($s); //x is 0
5
6 //careful:
7 $s = NULL
8 $x = strlen($s); //x is 0
As demonstrated in the last example, strlen() will return 0 for null strings. Recall
that we can distinguish between these two situations by using is_null() . Using this
function we can iterate over each individual character in a string.
1 $fullName = "Tom Waits";
2 for($i=0; $i<strlen($fullName); $i++) {
3 printf("fullName[%d] = %s\n", $i, $fullName[$i]);
4 }
558
43.2. String Functions
This would print the following
fullName[0] = T
fullName[1] = o
fullName[2] = m
fullName[3] =
fullName[4] = W
fullName[5] = a
fullName[6] = i
fullName[7] = t
fullName[8] = s
Concatenation
PHP has a concatenation operator built into the language. To concatenate one or more
strings together, you can use a simple period between them as the concatenation operator.
Concatenation results in a new string.
1 $firstName = "Tom";
2 $lastName = "Waits";
3
4 $formattedName = $lastName . ", " . $firstName;
5 //formattedName now contains "Waits, Tom"
Concatenation also works with other variable types.
1 $x = 10;
2 $y = 3.14;
3
4 $s = "Hello, x is " . $x . " and y = " . $y;
5 //s contains "Hello, x is 10 and y = 3.14"
Computing a Substring
PHP provides a simple function, substr() to compute a substring of a string. It takes
at at least 2 arguments: the string to operate on and the starting index. There is a third,
optional parameter that allows you to specify the length of the resulting substring.
559
43. Strings
1 $name = "Thomas Alan Waits";
2
3 $firstName = substr($name, 0, 6); //"Thomas"
4 $middleName = substr($name, 7, 4); //"Alan"
5 $lastName = substr($name, 12); //"Waits"
In the final example, omitting the optional length parameter results in the entire remainder
of the string being returned as the substring.
43.3. Arrays of Strings
We often need to deal with collections of strings. In PHP we can define arrays of strings.
Indeed, we’ve seen arrays of strings before. When processing command line arguments,
PHP defines an array of strings, $argv . Each string can be accessed using an index,
$argv[0] for example is always the name of the script.
We can create our own arrays of strings using the same syntax as with other arrays.
1 $names = array(
2 "Margaret Hamilton",
3 "Ada Lovelace",
4 "Grace Hopper",
5 "Marie Curie",
6 "Hedy Lamarr");
43.4. Comparisons
When comparing strings in PHP, we can use the usual comparison operators such
as === , < , or <= which will compare the strings lexicographically. However, this is
generally discouraged because of type juggling issues and strict vs loose equality/inequality
comparisons. Instead, there are several comparator methods that PHP provides to
compare strings based on their content. strcmp($a, $b) takes two strings and returns
an integer based on the lexicographic ordering of $a and $b . If $a precedes $b ,
strcmp() returns something negative. It returns zero if $a and $b have the same
content. Otherwise it returns something positive if $b precedes $a .
1 $x = strcmp("apple", "banana"); //x is negative
2 $x = strcmp("zelda", "mario"); //x is positive
560
43.5. Tokenizing
3 $x = strcmp("Hello", "Hello"); //x is zero
4
5 //shorter strings precede longer strings:
6 $x = strcmp("apple", "apples"); //x is negative
7
8 $x = strcmp("Apple", "apple"); //x is negative
In the last example, "Apple" precedes "apple" since uppercase letters are ordered
before lowercase letters according to the ASCII table. We can also make case insen-
sitive comparisons if we need to using the alternative, strcasecmp($a, $b) . Here,
strcasecmp("Apple", "apple") will return zero as the two strings are the same ig-
noring the cases.
The comparison functions also have length-limited versions, strncmp($a, $b, $n)
and strncasecmp($a, $b, $n) . Both will only make comparisons in the first $n
characters of the strings. Thus, strncmp("apple", "apples", 5) will result in zero
as the two strings are equal in the first 5 characters.
43.5. Tokenizing
Recall that tokenizing is the process of splitting up a string along some delimiter. For
example, the comma delimited string, "Smith,Joe,12345678,1985-09-08" contains
four pieces of data delimited by a comma. Our aim is to split this string up into four
separate strings so that we can process each one. PHP provides several functions to to
this, explode() and preg_split() .
The simpler one, explode() takes two arguments: the first one is a string delimiter and
the second is the string to be processed. It then returns an array of strings.
1 $data = "Smith,Joe,12345678,1985-09-08";
2
3 $tokens = explode(",", $data);
4 //tokens is [ "Smith", "Joe", "12345678", "1985-09-08" ]
5
6 $dateTokens = explode("-", $tokens[3]);
7 //dateTokens is now [ "1985", "09", "08" ]
The more sophisticated preg_split() also takes two arguments,1 but instead of a
simple delimiter, it uses a regular expression; a sequence of characters that define a
search pattern in which special characters can be used to define complex patterns. For
1
The “preg” stands for Perl Compatible Regular Expression.
561
43. Strings
example, the complex expression ^[+-]?(\d+(\.\d+)?|\.\d+)([eE][+-]?\d+)?$ will
match any valid numerical value including scientific notation. We will not cover regular
expressions in depth, but to demonstrate their usefulness, here’s an example by which
you can split a string along any and all whitespace:
1 $s = "Alpha Beta \t Gamma \n Delta \t\nEpsilon";
2 $tokens = preg_split("/[\s]+/", $s);
3 //tokens is now [ "Alpha", "Beta", "Gamma", "Delta", "Epsilon" ]
562
44. File I/O
Because of the history of PHP, file functions, just like string functions, were mostly
influenced by the C standard library functions and have very similar naming and usage.
Writing binary or plaintext data is determined by which functions you use. In general
whether or not a file input/output stream is buffered or unbuffered is determined by the
system configuration. There are some ways in which this can be changed, but we will
not cover them in detail.
44.1. Opening Files
Files are represented in PHP as a “resource” (also referred to as a handle) that can
be passed around to other functions to read and write to the file. For our purposes, a
resource is simply a variable that can be stored and passed to other functions.
To open a file, you use the fopen() function (short for f ile open) which requires two
arguments and returns a file handle. The first argument is the file path/name that you
want to open for processing. The second argument is a string representing the “mode”
that you want to open the file in. There are several supported modes, but the two we
will be interested in are reading, in which case you pass it "r" and writing in which case
you pass it "w" . The path can be an absolute path, relative path, or may be omitted if
the file is in the current working directory.
1 //open a file for reading (input):
2 $input = fopen("/user/apps/data.txt", "r");
3 //open a file for writing (output):
4 $output = fopen("./results.txt", "w");
5
6 if(!$input) {
7 printf("Unable to open input file\n");
8 exit(1);
9 }
10
11 if(!$output) {
12 printf("Unable to open output file\n");
13 exit(1);
14 }
563
44. File I/O
1 $h = fopen("input.data", "r");
2
3 while( $line = fgets($h) ) {
4 printf("%s", $line);
5 }
Code Sample 44.1.: Processing a file line-by-line in PHP
The two conditionals above check that the file opened successfully. If opening the file
failed, fopen() returns false (and the interpreter issues warning).
44.2. Reading & Writing
When a file is opened, the file handle returned by fopen() initially points to the
beginning of the file. As you read or write from it, the resource advances through the file
content.
Reading
There are a couple of ways to read input from a file. To read a file line by line, we
can use fgets() to get each line. It takes a single argument: the file handle that was
returned by fopen() and returns a string containing the entire line including the endline
character. If necessary, leading and trailing whitespace can be removed using trim() .
When no remaining lines are available in the file, fgets() returns false which can
thus be used in a while loop to process a file line by line. Code Sample 44.1 contains a
full example of processing a file line-by-line.
Alternatively there is a convenient function, file_get_contents() that will retrieve
the entire file as a string.
$fileContents = file_get_contents("./inputFile.txt");
Writing
There are several ways that we can output to files, but the easiest is to simply use
fwrite() (short for f ile write). This is a “binary-safe” file output function that takes
two arguments: the file handle to write to and a string of data to be written. It also
returns an integer representing the number of bytes written to the file (or false on
error).
564
44.2. Reading & Writing
1 $x = 10;
2 $y = 3.14;
3
4 //write to a plaintext file
5 fwrite($output, "Hello World!\n");
6 fwrite($output, "x = $x, y = $y\n");
44.2.1. Using URLs
A nice feature of PHP is that you can use URLs as file names to read and write to a URL.
“Reading” from a URL mean connecting to a remote resource, such as a webservice and
downloading its contents (which may be HTML, XML or JSON data). Writing to a URL
may be used to post data to a web page in order to receive a response.
As an example, we can download a webpage in PHP as follows.
1 $h = fopen("http://cse.unl.edu", "r");
2 $contents = "";
3 while(!feof($h)) {
4 $contents .= fgets($h);
5 }
6
7 //or just:
8 $contents = file_get_contents("http://cse.unl.edu");
44.2.2. Closing Files
Once you are done processing a file, you should close it using the fclose() function.
fclose($h);
which takes a single argument, the file handle that you wish to close.
565
45. Objects
Object-oriented features have been continually added to PHP with each new version.
Starting with version 5, PHP has had a full, class-based object-oriented programming
support, meaning that it facilitates the creation of objects through the use of classes and
class declarations. Classes are essentially “blueprints” for creating instances of objects.
An object is an entity that is characterized by identity, state and behavior. The identity
of an object is an aspect that distinguishes it from other objects. The variables and
values that a variable takes on within an object is its state. Typically the variables that
belong to an object are referred to as member variables. Finally, an object may also
have functions that operate on the data of an object. In the context of object-oriented
programming, a function that belongs to an object is referred to as a member method.
A class declaration specifies the member variables and member methods that belong
to instances of the class. We discuss how to create and use instances of a class below.
However, to begin, let’s define a class that models a student by defining member variables
to support a first name, last name, a unique identifier, and GPA.
To declare a class, we use the class keyword. Inside the class (denoted by curly
brackets), we place any code that belongs to the class. To declare member variables in a
class, we specify the variable names and their visibility inside the class, but outside any
methods in the class.
1 class Student {
2
3 //member variables:
4 private $firstName;
5 private $lastName;
6 private $id;
7 private $gpa;
8
9 }
To organize code, it is common practice to place class declarations in separate files with
the same name as the class. For example, this Student class declaration would be
placed in a file named Student.php and included in any other script files that utilized
the class.
567
45. Objects
45.1. Data Visibility
Recall that encapsulation involves not only the grouping of data, but the protection of
data. The class declaration above achieves the grouping of data. To provide for the
protection of data, PHP defines several visibility keywords that specify what segments
of code can “see” the variables. Visibility in this context determines whether or not a
segment of code can access and/or modify the variable’s value. PHP defines three levels
of visibility using they keywords public , protected and private . Each of these
keywords can be applied to both member variables and member methods.
• public – This is the least restrictive visibility level and makes the member variable
visible to any code segment.
• protected – This is a bit more restrictive and makes it so that the member
variable is only visible to the code in the same class, or any subclass of the class.1
• private – this is the most restrictive visibility level, private member variables
are only visible to instances of the class itself.
Table 45.1 summarizes these four keywords with respect to their access levels. It is
important to understand that protection is in the context of encapsulation and does
not involve protection in the sense of “security.” Protection is this context is a design
principle. Limiting the access of variables only affects how the rest of the code base
interacts with our class and its data.
Modifier Class Subclass World
public Y Y Y
protected Y Y N
private Y N N
Table 45.1.: PHP Visibility Keywords & Access Levels
In general, it is best practice to make member variables private and control access to
them via accessor and mutator methods (see below) unless there is a compelling design
reason to increase their visibility.
45.2. Methods
The third aspect of encapsulation involves the grouping of methods that act on an object’s
data. Within a class, we can declare member methods using the syntax we’re already
familiar with. We declare a member method by using the keyword function and
providing a signature and body. We can use the same visibility keywords as with member
1
Subclasses are involved with inheritance, another object-oriented programming concept that we will
not discuss here.
568
45.2. Methods
variables in order allow or restrict access to the methods. With methods, visibility and
access determine whether or not the method may be invoked.
We add to our example by providing two public methods that compute and return a
result on the member variables. We also use javadoc-style comments to document each
member method.
1 class Student {
2
3 //member variables:
4 private $firstName;
5 private $lastName;
6 private $id;
7 private $gpa;
8
9 /**
10 * Returns a formatted String of the Student's
11 * name as Last, First.
12 */
13 public function getFormattedName() {
14 return $this->lastName . ", " . $this->firstName;
15 }
16
17 /**
18 * Scales the GPA, which is assumed to be on a
19 * 4.0 scale to a percentage.
20 */
21 public function getGpaAsPercentage() {
22 return $this->gpa / 4.0;
23 }
24
25 }
There is some new syntax in the example above. In the member methods, we need a way
to refer to the instance’s member variables. The keyword $this is used to refer to the
instance, this is known as open recursion.
When an instance of a class is created, for example,
$s = new Student();
the reference variable $s is how we can refer to it. This variable, however, exists outside
the class. Inside the class, we need a way to refer to the instance itself. Since we don’t
have a variable inside the class to reference the instance itself, PHP provides the keyword
$this in order to do so. Then, to access the member variables we use the arrow operator
569
45. Objects
(more below) and reference the member variable via its identifier but with no dollar sign.2
45.2.1. Accessor & Mutator Methods
Since we have made all the member variables private , no code outside the class may
access or modify their values. It is generally good practice to make member variables
private to restrict access. However, if we still want code outside the object to access or
mutate (that is, change) the variable values, we can define accessor and mutator methods
(or simply getter and setter methods) to facilitate this.
Each getter method returns the value of the instance’s variable while each setter method
takes a value and sets the instance’s variable to the new value. It is common to name
each getter/setter by prefixing a get and set to the variable’s name using lower camel
casing. For example:
1 public function getFirstName() {
2 return $this->firstName;
3 }
4
5 public function setFirstName($firstName) {
6 $this->firstName = $firstName;
7 }
One advantage to using getters and setters (as opposed to naively making everything
public ) is that you can have greater control over the values that your variables can
take. For example, we may want to do some data validation by rejecting null values or
invalid values. For example:
1 public function setFirstName($firstName) {
2 if($firstName === null) {
3 throw new Exception("names cannot be null");
4 } else {
5 $this->firstName = $firstName;
6 }
7 }
8
9 public function setGpa($gpa) {
10 if($gpa < 0.0 || $gpa > 4.0) {
2
You can use the syntax $this->$foo but it will assume that $foo is a string that contains the
name of another variable, for example, if $foo = "firstName"; then $this->$foo would resolve
to the instance’s $firstName variable. This is useful if your object has been dynamically created
by adding variables at runtime that were not part of the original class declaration.
570
45.3. Constructors
11 throw new Exception("GPAs must be in [0, 4.0]");
12 } else {
13 $this->gpa = $gpa;
14 }
15 }
Controlling access of member variables through getters and setters is good encapsulation.
Doing so makes your code more predictable and more testable. Making your member
variables public means that any piece of code can change their values. There is no way
to do validation or prevent bad values.
In fact, it is good practice to not even have setter methods. If the value of member
variables cannot be changed, it makes the object immutable. Immutability is a nice
property because it makes instances of the class thread-safe. That is, we can use instances
of the class in a multithreaded program without having to worry about threads changing
the values of the instance on one another.
45.3. Constructors
If we make the (good) design decision to make our class immutable, we still need a way
to initialize the values. This is where a constructor comes in. A constructor is a special
method that specifies how an object is constructed. With built-in variable types such as
an numbers or strings, PHP “knows” how to interpret and assign a value. However, with
user-defined objects such as our Student class, we need to specify how the object is
created.
Just as with functions outside of classes, PHP does not support function overloading
inside classes. That is, you can have one and only one function with a given identifier
(name). Thus, there is only one possible constructor. Moreover, PHP reserves the
name __construct for the constructor method. The two underscores are a naming
convention used by PHP to denote “magic methods” that are reserved and have a special
purpose in the language. Further, magic methods must be made public . Some magic
methods provide default behavior while others do not. For example, if you do not define
a constructor method, the default behavior will be to create an object whose member
variables all have null values.
The following constructor allows a user to construct an instance of our Student instance
and specify all four member variables.
1 public function __construct($firstName, $lastName, $id, $gpa) {
2 $this->firstName = $firstName;
3 $this->lastName = $lastName;
4 $this->id = $id;
5 $this->gpa = $gpa;
571
45. Objects
6 }
Though we cannot define multiple constructors, we can use the default value feature
of PHP functions to allow a user to call our constructor with a different number of
parameters. For example,
1 public function __construct($firstName, $lastName,
2 $id = 0, $gpa = 0.0) {
3 $this->firstName = $firstName;
4 $this->lastName = $lastName;
5 $this->id = $id;
6 $this->gpa = $gpa;
7 }
45.4. Usage
Once we have defined our class and its constructors, we can create and use instances of
it. With regular variables, we simply need to assign them to an instance of an object
and their type will dynamically change to match. To create new instances, we invoke a
constructor by using the new keyword and providing arguments to the constructor.
1 $s = new Student("Alan", "Turing", 1234, 3.4);
2 $t = new Student("Margaret", "Hamilton", 4321, 3.9);
3 $u = new Student("John", "Smith");
The process of creating a new instance by invoking a constructor is referred to as
instantiation. Once instances have been instantiated, they can be used by invoking their
methods via the same arrow operator we used to access member variables. Outside the
class, however this will only work if the member method is public .
1 print $t->getFormattedName() . "\n";
2
3 if($s->getGpa() < $t->getGpa()) {
4 print $t->getFirstName() . " has a better GPA\n";
5 }
572
45.5. Common Methods
45.5. Common Methods
Another useful magic method is the __toString() method which returns a string
representation of the object. Unlike the constructor method, there is no default behavior
with the __toString() method. If you do not define this function, it cannot be used
(and any attempts to do so will result in a fatal error). We can define the method to
return the values of all or some of the class’s variables in whatever format we want.
1 public function __toString() {
2 return sprintf("%s, %s (ID = %d); %.2f",
3 $this->lastName,
4 $this->firstName,
5 $this->id,
6 $this->gpa);
7 }
This would return a string containing something similar to
"Hamilton, Margaret (ID = 4321); 3.90"
45.6. Composition
Another important concept when designing classes is composition. Composition is a
mechanism by which an object is made up of other objects. One object is said to “own”
an instance of another object.
To illustrate the importance of composition, we could extend the design of our Student
class to include a date of birth. However, a date of birth is also made up of multiple
pieces of data (a year, a month, a date, and maybe even a time and/or locale). We could
design our own date/time class to model this, but its generally best to use what the
language already provides. PHP 5.2 introduced the DateTime object in which there is
a lot of functionality supporting the representation and comparison of dates and time.
We can take this concept further and have our own user-defined classes own instances of
each other. For example, we could define a Course class and then update our Student
class to own a collection of Course objects representing a student’s class schedule
(this type of collection ownership is sometimes referred to as aggregation rather than
composition).
Both of these design updates beg the question: who is responsible for instantiating the
instances of $dateOfBirth and the $schedule ? Should we force the “outside” user of
our Student class to build a DateTime instance and pass it to a constructor? Should
we allow the outside code to simply provide us a date of birth as a string and make the
constructor responsible for creating the proper DateTime instance? Do we require that
a user create a complete array of Course instances and provide it to the constructor at
instantiation?
573
45. Objects
A more flexible approach might be to allow the construction of a Student instance
without having to provide a course schedule. Instead, we could add a method that
allowed the outside code to add a course to the student. For example,
1 public function addCourse($c) {
2 $this->schedule[] = $c;
3 }
This adds some flexibility to our object, but removes the immutability property. Design
is always a balance and compromise between competing considerations.
45.7. Example
We present the full and completed Student class in Code Sample 45.1.
574
45.7. Example
1 <?php
2 class Student {
3
4 private $firstName;
5 private $lastName;
6 private $id;
7 private $gpa;
8 private $dateOfBirth;
9 private $schedule;
10
11 public function __construct($firstName, $lastName, $id = 0, $gpa = 0.0,
12 $dateOfBirth = null, $schedule = array()) {
13 $this->firstName = $firstName;
14 $this->lastName = $lastName;
15 $this->id = $id;
16 $this->gpa = $gpa;
17 $this->dateOfBirth = new DateTime($dateOfBirth);
18 $this->schedule = $schedule;
19 }
20
21 public function __toString() {
22 return $this->getFormattedName() . " born " .
23 $this->dateOfBirth->format("Y-m-d");
24 }
25
26 /**
27 * Returns a formatted String of the Student's
28 * name as Last, First.
29 */
30 public function getFormattedName() {
31 return $this->lastName . ", " . $this->firstName;
32 }
33
34 /**
35 * Scales the GPA, which is assumed to be on a
36 * 4.0 scale to a percentage.
37 */
38 public function getGpaAsPercentage() {
39 return $this->gpa / 4.0;
40 }
41
42 public function getFirstName() {
43 return $this->firstName;
44 }
45
46 public function getLastName() {
575
45. Objects
47 return $this->lastName;
48 }
49
50 public function getId() {
51 return $this->id;
52 }
53
54 public function getGpa() {
55 return $this->gpa;
56 }
57
58 public function addCourse($c) {
59 $this->schedule[] = $c;
60 }
61
62 }
63
64 ?>
Code Sample 45.1.: The completed PHP Student class.
576
46. Recursion
PHP supports recursion with no special syntax necessary. However, recursion is generally
expensive and iterative or other non-recursive solutions are generally preferred. We
present a few examples to demonstrate how to write recursive functions in PHP.
The first example of a recursive function we gave was the toy count down example. In
PHP it could be implemented as follows.
1 function countDown($n) {
2 if($n===0) {
3 printf("Happy New Year!\n");
4 } else {
5 printf("%d\n", $n);
6 countDown($n-1);
7 }
8 }
As another example that actually does something useful, consider the following recursive
summation function that takes an array, its size and an index variable. The recursion
works as follows: if the index variable has reached the size of the array, it stops and returns
zero (the base case). Otherwise, it makes a recursive call to recSum() , incrementing
the index variable by 1. When the function returns, it adds the result to the i-th element
in the array. To invoke this function we would call it with an initial value of 0 for the
index variable: recSum($arr, 0) .
1 function recSum($arr, $i) {
2 if($i === count($arr)) {
3 return 0;
4 } else {
5 return recSum($arr, $i+1) + $arr[$i];
6 }
7 }
This example was not tail-recursive as the recursive call was not the final operation (the
sum was the final operation). To make this function tail recursive, we can carry the
summation through to each function call ensuring that the summation is done prior to
577
46. Recursion
the recursive function call.
1 function recSumTail($arr, $i, $sum) {
2 if($i === count($arr)) {
3 return $sum;
4 } else {
5 return recSumTail($arr, $i+1, $sum + $arr[$i]);
6 }
7 }
As a final example, consider the following PHP implementation of the naive recursive
Fibonacci sequence. An additional condition has been included to check for “invalid”
negative values of n for which we throw an exception.
1 function fibonacci($n) {
2 if($n < 0) {
3 throw new Exception("Undefined for n<0.");
4 } else if($n <= 1) {
5 return 1;
6 } else {
7 return fibonacci($n-1) + fibonacci($n-2);
8 }
9 }
PHP is not a language that provides implicit memoization. Instead, we need to explicitly
keep track of values using a table. In the following example, the table is passed through
as an argument.
1 function fibonacciMemoization($n, $table) {
2 if($n < 0) {
3 return 0;
4 } else if($n <= 1) {
5 return 1;
6 } else if(isset($table[$n])) {
7 return $table[$n];
8 } else {
9 $a = fibonacciMemoization($n-1, $table);
10 $b = fibonacciMemoization($n-2, $table);
11 $result = ($a + $b);
12 $table[$n] = $result;
13 return $result;
578
14 }
15 }
579
47. Searching & Sorting
PHP provides over a dozen different sorting functions each with different properties and
behavior. Recall that PHP has associative arrays which store elements as key-value
pairs. Some functions sort by keys, others sort by the value (with some in ascending
order, others in descending order). Some functions preserve the key-value mapping
and others do not. For simplicity, we will focus on two of the most common sorting
functions, sort() , which sorts the elements in ascending order and usort() which
sorts according to a comparator function.
47.1. Comparator Functions
Consider a “generic” Quick Sort algorithm as was presented in Algorithm 12.6. The
algorithm itself specifies how to sort elements, but it doesn’t specify how they are ordered.
The difference is subtle but important. Quick Sort needs to know when two elements, a, b
are in order, out of order, or equivalent in order to decide which partition each element
goes in. However, it doesn’t “know” anything about the elements a and b themselves.
They could be numbers, they could be strings, they could be user-defined objects.
A sorting algorithm still needs to be able to determine the proper ordering in order
to sort. In PHP this is achieved through a comparator function, which is a function
that is responsible for comparing two elements and determining their proper order. A
comparator function has the following signature and behavior.
• The function takes two elements $a and $b to be compared.
• The function returns an integer indicating the relative ordering of the two elements:
– It returns something negative if $a comes before $b (that is, a < b)
– It returns zero if $a and $b are equal (a = b)
– It returns something positive if $a comes after $b (that is, a > b)
There is no guarantee on the value’s magnitude, it does not necessarily return −1 or +1;
it just returns something negative or positive. We’ve previously seen this pattern when
comparing strings. The standard PHP library provides a function, strcmp($a, $b)
that has the same contract: it takes two strings and returns something negative, zero or
something positive depending on the lexicographic ordering of the two strings.
The PHP language “knows” how to compare built-in types like numbers and strings.
However, to generalize the comparison operation, we can define comparator functions
581
47. Searching & Sorting
that encapsulate more complex logic. As a simple first example, let’s write a comparator
function that orders numbers in ascending order.
1 function cmpInt($a, $b) {
2 if($a < $b) {
3 return -1;
4 } else if($a === $b) {
5 return 0;
6 } else {
7 return -1;
8 }
9 }
What if we wanted to order integers in the opposite order? We could write another
comparator in which the comparisons or values are reversed. Even simpler, we could
reuse the comparator above and “flip” the sign by multiplying by −1 (this is one of the
purposes of writing functions: code reuse). Even simpler still, we could just flip the
arguments we pass to cmpInt() to reverse the order.
1 function cmpIntDesc($a, $b) {
2 return cmpInt($b, $a);
3 }
To illustrate some more examples, consider the Student class we defined in Code
Sample 45.1. The following code samples demonstrate various ways of ordering Student
instances based on one or more of their components.
1 /**
2 * A comparator function to order Student instances by
3 * last name/first name in alphabetic order
4 */
5 function studentByNameCmp($a, $b) {
6 int result = strcmp($a->getLastName(), $b->getLastName());
7 if(result == 0) {
8 return strcmp($a->getFirstName(), $b->getFirstName());
9 } else {
10 return result;
11 }
12 }
582
47.1. Comparator Functions
1 /**
2 * A comparator function to order Student instances by
3 * last name/first name in reverse alphabetic order
4 */
5 function studentByNameCmpDesc($a, $b) {
6 return studentByNameCmp($b, $a);
7 }
1 /**
2 * A comparator function to order Student instances by
3 * id in ascending numerical order
4 */
5 function studentIdCmp($a, $b) {
6 if($a->getId() < $b->getId()) {
7 return -1;
8 } else if($a->getId() === $b->getId()) {
9 return 0;
10 } else {
11 return 1;
12 }
13 }
1 /**
2 * A comparator function to order Student instances by
3 * GPA in descending order
4 */
5 function studentGpaCmp($a, $b) {
6 if($a->getGpa() > $b->getGpa()) {
7 return -1;
8 } else if($a->getGpa() == $b->getGpa()) {
9 return 0;
10 } else {
11 return 1;
12 }
13 }
583
47. Searching & Sorting
47.1.1. Searching
PHP provides a linear search function, array_search() that can be used to search for
an element in an array. The array can be specified to use loose comparisons (default) or
strict comparisons. It returns the key (i.e. index) of the first matching element it finds
and false if the search was unsuccessful. For example:
1 $arr = array(10, 8, 3, 12, 4, 42, 7, 108);
2 $index = array_search(12, $arr); //index is now 3
3
4 $arr = array("hello", 10, "mixed", 12, "20");
5 //a loose search:
6 $index = array_search(20, $arr); //index is now 4
7 //a strict search:
8 $index = array_search(20, $arr, false); //index is now false.
PHP does not provide a standard binary search function. Though you can write your
own binary search implementation, likely the reason that that PHP does not provide
one is because one is not needed. The purpose of binary search is to search a sorted
array efficiently. However, PHP arrays are not usual arrays: they are associative arrays,
essentially key-value maps. Retrieving an element via its key is essentially a constant-time
operation, even more efficient that binary search. A better solution may be to simply
store the elements using a proper key which can be used to retrieve the element later on.
47.1.2. Sorting
PHP’s sort() function can be used to sort elements in ascending order. This is useful
if you have arrays of numbers or strings, but doesn’t work very well if you have an array
of mixed types or objects.
1 $arr = array("banana", "Apple", "zebra", "apple", "bananas");
2 sort($arr);
3 //arr is now ("Apple", "apple", "banana", "bananas", "zebra")
4
5 $arr = array(10, 8, 3, 12, 4, 42, 7, 108);
6 sort($arr);
7 //arr is now (3, 4, 7, 8, 10, 12, 42, 108)
PHP provides a more versatile sorting function, usort() (user defined sort) that
accepts a comparator function that it uses to define the ordering of elements. To pass
a comparator function to the usort() function, we pass a string value containing the
584
47.1. Comparator Functions
name of the comparator function we wish to use. Recall that function names in PHP are
case insensitive, though it is still best practice to match the naming. Several examples of
the usage of this function are presented in Code Sample 47.1.
1 $arr = array(10, 8, 3, 12, 4, 42, 7, 108);
2 usort($arr, "cmpIntDesc");
3 //arr is now 108, 42, 12, 10, 8, 7, 4, 3
4
5 //roster is an array of Student instances
6 $roster = ...
7
8 //sort by name:
9 usort($roster, "studentByNameCmp");
10
11 //sort by ID:
12 usort($roster, "studentIdCmp");
13
14 //sort by GPA:
15 usort($roster, "studentGpaCmp");
Code Sample 47.1.: Using PHP’s usort() Function
585
Glossary
abstraction a technique for managing complexity whereby levels of complexity are
established so that higher levels do not see or have to worry about details at lower
levels.
acceptance testing a phase of software testing that is tested, usually by humans, for
acceptability and whether or not it fulfills the business requirements.
ad-hoc testing informal software testing method that is done without much planning
usually as a “sanity check” to see if a piece of code works and intended for immediate
feedback.
algorithm a process or method that consists of a specified step-by-step set of operations.
17
anonymous class a class that is defined “inline” without declaring a named class; typi-
cally created because the instance has a single use and there is no reason to create
multiple instances. 484
anonymous function a function that has no identifier or name, typically created so that
it can be passed as an argument to another function as a callback. 144
anti-pattern a common software pattern that is used as a solution to recurring problems
that is usually ineffective in solving the problem or introduces risks and other
problems; a technical term for common “bad-habits” that can be found in software.
152
array an ordered collection of pieces of data, usually of the same type.
assignment operator an operator that allows a user to assign a value to a variable. 33
backward compatible a program, code, library, or standard that is compatible with
previous versions so that current and older versions of it can coexist and successfully
operate without breaking anything. 29
bar a placeholder name. , see foo
baz a placeholder name. , see foo
587
Glossary
bike shedding a phenomenon in projects where a disproportionate amount of time is
spent on trivial matters at the expense of spending adequate resources on more
important matters. The term was applied to software development by Kamp [24]
but derives from Parkinson’s law of triviality [32].
bit the basic unit of information in a digital computer. A bit can be either 1 or 0
(alternatively, true/false, on/off, high voltage/low voltage, etc.). Originally a
portmanteau (mash up) of binary digit. 4, 22, 23
Boolean a data type that represents the truth value of a logical statement. Booleans
typically have only two values: true or false. 30
boundary case a situation or input that is just beyond the acceptable limits.
bug A flaw or mistake in a computer program that results in incorrect behavior that may
have unintended such as errors or failure. The term predates modern computer
systems but was popularized by Grace Hopper who, when working with the Mark
II computer in 1946 traced a system failure to a moth stuck in a relay. 46, 81, 151
byte a unit of information in a digital computer consisting of 8 bits. 4
cache a component or data structure that stores data in an efficiently retrievable manner
so that future requests for the data are fast. 208
call by reference when a variable’s memory address is passed as a parameter to a
function, enabling the function to manipulate the contents of the memory address
and change the original variable’s value. 142
call by value when a copy of a variable’s value is passed as a parameter to a function;
the function has no reference to the original variable and thus changes to the copy
inside the function have no effect on the original variable. 140
callback a function or executable unit of code that is passed as an argument to another
function with the intention that the function that it is passed to will execute or
“call back” the passed function at some point. 144, 366
cargo cult programming refers to the act of including code, patterns, or processes with
no real purpose due to a lack of understanding of a bug or of the problem they
were attempting to solve or a lack of understanding of the copied code/pattern
itself or an inability to adapt it properly..
case sensitive a language is case sensitive if it recognizes differences between lower and
upper case characters in identifier names. A language is case insensitive if it does
not.. 19
chomp the operation of removing any endline characters from a string (especially when
read from a file); may also refer more generally to removing leading and trailing
whitespace from a string or “trimming” it. 337,
588
Glossary
closure a function with its own environment in which variables exist. 485
code smell a symptom or common pattern in source code that is usually indicative of
a deeper problem or design flaw; smells are usually not bugs and may not cause
problems in and of themselves, but instead indicate a pattern of carelessness or low
quality of software design or implementation. 152
comparator a function or object that allows you to pass in two elements a, b for com-
parison and returns an integer indicating their relative order: something negative,
zero, or something positive if a < b, a = b or a > b respectively. 178, 331, 560
compile the process of translating code in a high-level programming language to a low
level language such as assembly or machine code.
computer engineering a discipline integrating electrical engineering and computer sci-
ence that tends to focus on the development of hardware and its interaction with
software.
computer science the mathematical modeling and scientific study of computation.
concatenation the process of combining two (or more) strings to create a new string by
appending one of them to the end of the other. 178
constant a variable whose value cannot be changed once set.
continuous integration a software development/engineering process by which developer
code is merged and shared on a frequent basis.
contradiction a logical statement that is always false regardless of the truth values of
the statement’s variables. 72
control flow the order in which individual statements in a program are executed or
evaluated. 75
Conway’s Law an observation that organizations that build software will inevitably
design it as modeling the structure of the organization itself. Attributed to Melvin
Conway (1967) who originally stated it as “organizations which design systems
. . . are constrained to produce designs which are copies of the communication
structures of these organizations”.
copy pasta bad coding practice of copy-pasting code and making slight changes when a
function or other control structure should be written instead. Copy-pasta practices
often lead to poorly designed code, bugs or spaghetti code..
corner case a situation or input that is abnormal but still within the range of possible
values; represents a situation that is outside normal operating parameters but still
valid..
589
Glossary
cruft anything that is left over, redundant or getting in the way; in the context of code
cruft is code that is no longer needed, legacy or simply poorly written source code.
dangling pointer when a reference to dynamically allocated memory is lost and the
memory can no longer be deallocated, resulting in a memory leak. Alternatively,
when a reference points to memory that gets deallocated or reallocated but the
pointer remains unmodified, still referencing the deallocated memory. 165
dead code a code segment that has no effect on a program either because it is unused
or unreachable (the conditions involving the code will never be satisfied). 72
debug the process of analyzing a program to find a fault or error with the code that
leads to bad or unexpected results. 152
debugger a software tool that facilitates debugging; usually a debugger simulates the
execution of a program allowing a developer to view the contents of a program as
it executes and to “walk” through the execution step by step. 152
deep copy in contrast to a shallow copy, a deep copy is a copy of an array or other piece
of data that is distinct from the original. Changes to one copy do not affect the
other. 166, 319, 443, 449, 557
defensive programming an approach to programming in which error conditions are
checked and handled, preventing undefined or erroneous operations from happening
in a program. 38, 48, 84
dynamic programming a technique for solving problems that involves iteratively com-
puting values to subproblems, storing them in a table so that they can be used to
solve larger versions of the problem. 209
dynamic typing a variable whose type can change during runtime based on the value it
is assigned. 31,
edge case a situation or input that represents an extreme value or parameter.
encapsulation the grouping and protection of data together into one logical entity along
with the functionality (functions or methods) that act on that data. 30
enumerated type a data type (usually user defined) that consists of a list of named
values. 309, 436
exception an event or occurrence of an erroneous or “exceptional” condition that inter-
rupts the normal flow of control in a program, handing control over to exception
handler(s). 155
expression a combination of values, constants, literals, variables, operators and possibly
function calls such that when evaluated, produce a resulting value. 34
590
Glossary
file a resource on a computer stored in memory that holds data. 183
flowchart a diagram that represents an algorithm or process, showing steps as boxes
connected by arrows which establish an order or flow. 17
foo along with “bar,” “baz,” and the full “foobar”, foo is a commonly used placeholder
name in programming used to denote generic variables, functions, etc. Usually
these terms are used as examples when demonstrating a concept. The terms have
a long history [21].
foobar a placeholder name. , see foo
function a sequence of program instructions that perform a specific task, packaged as a
unit, also known as a subroutine. 133
function overloading the ability to define multiple functions with the same name but
with with a different number of or different types of parameters. 145
fuzzing An automated software testing technique that involves providing invalid or
random data as input to a program or piece of code to test that it fails in an
expected manner..
garbage collection automated memory management in which a garbage collector at-
tempts to reclaim memory (garbage) that is no longer being used by a program so
that it can be reallocated for other purposes. 165, 383
global scope a variable, function, or other element in a program has global scope if it is
visible or has effect throughout the entire program. 32,
glue code code that acts as an interface between two other pieces of code, “gluing” them
together and adapting them to be compatible with each other or enabling them to
communicate with each other.
grok slang, meaning to understand something; originally from Stranger in a Strange
Land by Robert A. Heinlein..
hardware (computer hardware) the physical components that make up a computer
system such as the processor, motherboard, storage devices, input and output
devices, etc..
heisenbug a bug in a program that fails to manifest itself under testing or debugging
conditions. Derived from the Heisenberg principle which states that you cannot
observe something without affecting it, thus tainting your observations..
hexadecimal base-16 number system using the symbols 0, 1, . . . , 9, A, B, C, D, E, F;
usually denoted with a prefix 0x such as 0xff1321ab01 . 470
591
Glossary
hoisting usually used in interpreted languages, hoisting involves processing code to find
variable or function declarations and processing them before actually executing the
code or script. 134
identifier a symbol, token, or label that is used to refer to a variable. Essentially, a
variable’s name. 18
idiom in the context of programming, an idiom is a commonly used pattern, expression
or way of structuring code that is well-understood for users of the language. For
example, a for-loop structure that iterates over elements in an array. May also refer
to a programming design pattern.. 315,
immutable an object whose internal state cannot be changed once created, alternatively,
one whose internal state cannot be observably changed once created. 390, 423, 449,
466, 571
inheritance an object oriented programming principle that allows you to derive an object
from another object, usually to allow for more specificity.
input data or information that is provided to a computer program for processing. 41
integration testing a type of software testing used to determine if the integration of
different components or modules works or not.
interactive a program that is designed to interface with humans by prompting them for
input and displaying output directly to them. 41
interactive an informal, abstract, high-level description of a process or algorithm. 41
keyword a word in a programming language with a special meaning in a particular
context. In contrast to a reserved word, a keyword may be used for an identifier
(variable or function name) but it is strongly discouraged to do so as the keyword
already has an intended meaning.
kilobyte a unit of information in a digital computer consisting of 1024 bytes (equivalently,
210 bytes), KB for short.
kludge a poorly designed or “thrown-together” solution; a design that is a collection of
ill-fitting parts that may be functional, but is fragile and not easily maintained.
lambda expression another term for anonymous functions. 144, 493
lexicographic a generalization of the usual dictionary order as codified with the ASCII
character table. 178
linking the process of generating an executable file from (multiple) object files.
592
Glossary
lint (or linter) a static code analysis tool that analyzes code for suspicious or error-prone
code that is likely to cause problems. 152
literal in a programming language, a literal is notation for specifying a value such as a
number of string that can be directly assigned to a variable. 29, 34
load testing a form of performance testing used to determine to what extent a piece of
software or a system can handle a high demand or “load”.
magic number a value used in a program with unexplained, undocumented, or am-
biguous meaning, usually making the code less understandable. 258, 309, 310,
437
mantissa the part of a floating-point number consisting of its significant digits (called a
significand in scientific notation). 25
map a data structure that allows you to store elements as key-value pairs with the key
mapping to a value.
memoization a technique which uses a table to store previously computed values of a
function so that they do not need to be recomputed, essentially the table serves as
a cache. 208
memory leak the gradual loss of memory when a program fails to deallocate or free up
unused memory, degrading performance and possibly resulting in the termination
of the program when memory runs out. 165, 320, 326
naming convention a set of guidelines for choosing identifier names for variables, func-
tions, etc. in a programming language. Conventions may be generally accepted
by all developers of a particular language or they may be established for use in a
particular library, framework, or organization. 20
network a collection of two or more computer systems linked together through a physical
connection over which data can be transmitted using some protocol.
octal base-8 number system using the symbols 0, 1, 2, . . . , 6, 7; usually denoted with a
single leading zero such as 0123742 .
open recursion a mechanism by which an object is able to refer to itself usually using a
keyword such as this or self .. 200, 465, 569
operand the arguments that an operator applies to. 33
operator a symbol used to denote some transformation that combines or changes the
operands it is applied to to produce a new value. 33
order of precedence the order in which operators are evaluated, multiplication is per-
formed before addition for example. 38
593
Glossary
output data or information that is produced as the result of the execution of a program.
41
overflow when an arithmetic operation results in a number that is larger than the
specified type can represent overflow occurs resulting in an invalid result. 39
parse to process data to identify its individual components or elements. 179,
persistence the characteristic of data that outlives the process or program that created
it; the saving of data across multiple runs of a program. 183
pointer a reference to a particular memory location in a computer. 30, 295
polymorphism an object oriented programming concept that allows you to treat a
variable, method, or object as different types.
primitive a basic data type that is defined and provided by a programming language.
Typically numeric and character types are primitive types in a language for example.
Generally, the user doesn’t need to define the operations involving primitive types
as they are defined by the language. Primitive data types are used as the basic
building blocks in a program and used to compose more complex user-defined types.
30, 390
procedural abstraction the concept that a procedure or sequence of operations can be
encapsulated into one logical unit (function, subroutine, etc.) so that a user need
not concern themselves with the low-level details of how it operates. 134
program stack also referred to as a call stack, it is an area of memory where stack
frames are stored for each function call containing memory for arguments, local
variables and return values/addresses. 137
protocol a set of rules or procedures that define how communication takes place.
pseudocode the act of a program asking a user to enter input and subsequently waiting
for the user to enter data. 13
query an operation that retrieves data, typically from a database. 152
queue a data structure that store elements in a FIFO (First-In First-Out) manner;
elements can be added to the end of a queue by an enqueue operation and removed
from the start of a queue by a dequeue operation.
radix the base of a number system. Binary, octal, decimal, hexadecimal would be base
2, 8, 10, and 16 respectively.
reentrant a function that can be interrupted during its execution while another thread
can successfully invoke the function without the two functions interfering with the
data used in either function call. 334
594
Glossary
refactor the process of modifying, updating or restructuring code without changing
its external behavior; refactoring may be done to make code more efficient, more
readable, more reliable, or simply to bring it into compliance with style or coding
conventions.
reference a reference in a computer program is a variable that refers to an object or
function in memory. 30
regression testing a type of software testing that tests software that previously passed
testing but that was changed or refactored in some way. Regression testing tests
to see if the software still passes the tests or not in which case it is said to have
“regressed”.
regular expression a sequence of characters in which special characters and directives
can be used to define a complex pattern that can be searched and matched in
another string or data. 455, 561
reserved word a word or identifier in a language that has a special meaning to the
syntax of the language and therefore cannot be used as an identifier in variables,
functions, etc.. 19
scope the scope of a variable, method, or other entity in a program is the part of the
program in which the name or reference of the entity is bound. That is, the part of
the program that “knows” about the variable in which the variable can be accessed,
changed, or used. 32, 255, 386
segmentation fault a fault or error that arises when a program attempts to access a
segment of memory that it is not allowed access to, usually resulting in the program
being terminated by the operating system. 296, 315
shallow copy in contrast to a deep copy, a shallow copy is merely a reference that refers
to the original array or piece of data. The two references point to the same data,
so if the data is modified, both references will realize it.. 166, 319, 443
short circuiting the process by which the second operand in a logical statement is not
evaluated if the value of the expression is determined by the first operand. 74
signature a function signature is how a function is uniquely identified. A signature
includes the name (identifier) of the function, its parameter list (and maybe types)
and the return type. 134
software any set of machine-readable instructions that can be executed in a computer
processor.
software engineering the study and application of engineering principles to the design,
development, and maintenance of complex software systems.
595
Glossary
spaghetti code a negative term used for code that is overly complex, disorganized or
unstructured code.
stack a data structure that stores elements in a LIFO (last-in first-out) manner; elements
can be added to a stack via a push operation which places the element on the “top”
of the stack; elements can be removed from the top of the stack via a pop operation.
137, 206
stack overflow when a program runs out of stack space, it may result in a stack overflow
and the termination of the program. 205
static analysis the analysis of software that is performed on source (or object) code
without actually running or compiling a program usually by using an automated
tool that can detect actual or potential problems with the source code (other than
syntactic problems that could easily be found by a compiler). 152
static dispatch when function overloading is supported in a language, this is the mecha-
nism by which the compiler determines which function should be called based on
the number and type of arguments passed to the function when it is called. 145
static typing a variable whose type is specified when it is created (declared) and does
not change while the variable remains in scope. 31,
string a data type that consists of a sequence of characters which are encoded under
some encoding standard such as ASCII or Unicode. 27, 177
string concatenation an operation by which a string and another data type are combined
to form a new string. 37
syntactic sugar syntax in a language or program that is not absolutely necessary (that
is, the same thing can be achieved using other syntax), but may be shorter, more
convenient, or easier to read/write. In general, such syntax makes the language
“sweeter” for the humans reading and writing it. 40, 82, 102, 161, 451
tautology a logical statement that is always true regardless of the truth values of the
statement’s variables. 72
test case an input/output pair that is known to be correct that is to be used to test a
unit of software.
test case a collection of tests that are used to test a piece or collection of software.
token when something (usually a string) is parsed, the individual components or elements
are referred to as tokens. 179
top-down design an approach to problem solving where a problem is broken down into
smaller parts. 3, 133
596
Glossary
transpile to (automatically) translate code in one programming language into code
in another programming language, usually between two high-level programming
languages.
truncation removing the fractional part of a floating-point number to make it an integer.
Truncation is not a rounding operation. 36, 263, 394,
two’s complement A way of representing signed (positive and negative) integers using
the first bit as a sign bit (0 for positive, 1 for negative) and where negative numbers
are represented as the complement with respect to 2n (the result of subtracting the
number from 2n ) . 24
type a variable’s type is the classification of the data it represents which could be
numeric, string, boolean, or a user defined type. 22
type casting converting or variable’s type into another type, for example, converting an
integer into a more general floating-point number, or converting a floating-point
number into an integer, truncating and losing the fractional part. 36, 263, 394
underflow when an arithmetic operation involving floating-point numbers results in a
number that is smaller than the smallest representable number underflow occurs
resulting in an invalid result. 39
Unicode an international character encoding standard used in programming languages
and data formats. 449
unit test software testing method that tests an individual “unit” of code; depending on
the context, a unit may refer to an individual function, class, or module.
unwinding the process of removing a stack frame when returning from a function. 164
validation the process of verifying that data is correct or conforms to certain expectations
including formatting, type, range of values, represents a valid value, etc.. 42
variable a memory location which stores a value that may be set using an assignment
operator. Typically a variable is referred to using a name or identifier . 18
widget a generic term for a graphical user interface component such as a button or text
box.
yak shaving an ostensibly pointless activity that despite its uselessness allows you to
overcome a a difficulty and solve a larger problem. Basically, screwing around
until you become familiar enough with the problem that the solution presents itself.
Attributed to Carlin Vieri who took it from an episode of Ren and Stimpy..
597
Acronyms
ABI Application Binary Interface.
ACID Atomicity Consistency Isolation Durability.
ACM Association for Computing Machinery.
ALU Arithmetic and Logic Unit. 4
ANSI American National Standards Institute. 253
API Application Programmer Interface. 15, 184, 436
ASCII American Standard Code for Information Interchange. 27, 66, 183, 187, 260, 325,
332, 385, 391, 454, 561
BYOD Bring Your Own Device.
CE Computer Engineering.
CI Continuous Integration.
CJK Chinese Japanese Korean. 29
CLA Command Line Arguments.
CLI Command Line Interface. 46
CMS Content Management System. 497
CMYK Cyan-Magenta-Yellow-Key.
CPU Central Processing Unit. 4, 74
CRUD Create Retrieve Update Destroy.
CS Computer Science.
CSS Cascading Style Sheets.
CSV Comma Separated Values. 179, 337
CWD Current Working Directory. 184
599
Acronyms
CYA Cover Your Ass.
DRY Don’t Repeat Yourself. 292
EB Exabyte.
ECMA European Computer Manufacturers Association.
EDI Electronic Data Interchange.
EOF End Of File. 184
FIFO First-In First-Out.
FOSS Free and Open Source Software.
FUD Fear, Uncertainty, Doubt.
GB Gigabyte.
GCC GNU Compiler Collection.
GDB GNU Debugger.
GIF Graphics Interchange Format.
GIGO Garbage-In Garbage-Out.
GIMP GNU Image Manipulation Program.
GIS Geographic Information System.
GNU GNU’s Not Unix!. 49, 324
GUI Graphical User Interface. 42, 144, 366
HTML HyperText Markup Language. 181, 184, 497, 565
IDE Integrated Development Environment. 7, 21, 46, 49, 258, 385, 390, 471, 502
IEC International Electrotechnical Commission. 26, 253
IEEE Institute of Electrical and Electronics Engineers. 26, 260, 306, 503
IP Internet Protocol. 201
ISO International Organization for Standardization. 253, 343
JDBC Java Database Connectivity.
600
Acronyms
JDK Java Development Kit. 383, 385, 388, 427, 431, 436, 449, 458, 487
JEE Java Enterprise Edition.
JIT Just In Time. 12
JPEG Joint Photographic Experts Group. 183
JRE Java Runtime Environment.
JSON JavaScript Object Notation. 185, 565
JVM Java Virtual Machine. 12, 383, 384, 389, 423, 431, 435, 440, 442, 449, 467, 470,
484
KB Kilobyte. 162, 460
KISS Keep It Simple, Stupid.
LIFO Last-In First-Out. 137
LOC Lines Of Code.
MAC Media Access Control. 201
MB Megabyte. 162
MP3 MPEG-2 Audio Layer III.
MPEG Moving Picture Experts Group.
MVP Minimum Viable Product.
MWE Minimum Working Example. 254
NIST National Institute of Standards and Technology.
ODBC Open Database Connectivity.
OEM Original Equipment Manufacturer.
OOP Object-Oriented Programming. 177, 384, 386, 433, 444, 499
ORM Object Relational Mapping.
PB Petabyte.
PDF Portable Document Format. 15
601
Acronyms
PHP PHP: Hypertext Preprocessor (a recursive backronym; used to stand for Personal
Home Page).
PNG Portable Network Graphics.
POJO Plain Old Java Object.
POSIX Portable Operating System Interface. 259, 306, 336, 343
RAII Resource Acquisition is Initialization.
RAM Random Access Memory. 5
REPL Read-Eval-Print Loop.
RGB Red-Green-Blue.
ROM Read-Only Memory.
RTFM Read The “Freaking” Manual.
RTM Read The Manual.
SD Software Development.
SDK Software Development Kit. 443, 444
SE Software Engineering.
SEO Search Engine Optimization.
SOLID Single Responsibility Principle, Open/Closed Principle, Liskov Substitution
Principle, Interface Segregation Principle, Dependency Inversion.
SQL Structured Query Language. 431, 436
SSL Secure Sockets Layer. 296
STEAM Science, Technology, Engineering, Art, and Math.
STEM Science, Technology, Engineering, and Math.
TB Terabyte.
TCP Transmission Control Protocol.
TDD Test-Driven Development.
TSV Tab Separated Values. 179
TUI Text User Interface.
602
Acronyms
UI User Interface.
UML Unified Modeling Language.
URL Uniform Resource Locator.
UTC Coordinated Universal Time. 343
UTF-8 Universal (Character Set) Transformation Format–8-bit.
UX User Experience.
VLSI Very Large Scale Integration. 4
W3C World Wide Web Consortium.
WOM Write Only Memory.
WWW World Wide Web. 181, 383, 497
XML Extensible Markup Language. 21, 185, 565
YAGNI You Ain’t Gonna Need It.
603
Index
aggregation, 199 error handling, 305
algorithm, 215 file I/O, 335
anonymous class, 484 functions, 291
arrays, 159 loops, 283
in C, 313 recursion, 357
in Java, 439 strings, 325
in PHP, 547 cache, 208
indexing, 160 call by reference, 140
iteration, 161 call by value, 140
multidimensional, 166 call stack, 8
static, see static array160 callback, 144, 366
arrow operator, 347 calling functions, see invoking functions
assignment operator, 33 case sensitive, 19
associative arrays, 168 class, 198, 386
class-based, 198
bandwidth, 6
code block, 13
basic input, 41
command line arguments, 44
basic output, 41
comment, 15
binary, 5, 23
comparator, 178, 238, 239, 361
counting, 23
in Java, 483
binary search, 213
comparison operators, 66
analysis, 218
compiled language, 6
C, 373
bit, 5 composition, 199, 344, 472
block, see code block compound logic, 71
Boolean, 30 computer, 4
bottom-up design, 4, 200 conditionals, 65
buffered, 187 if statement, 75
bug, 151 if-else statement, 76
byte, 5 if-else-if statement, 78
in C, 271
C in Java, 403
arrays, 313 in PHP, 515
comparators, 361 conjunction, see logical operators–and
conditionals, 271 constants, 33
605
Index
constructor, 199, 467 functional programming, 142
contradiction, 72 functions, 133
control flow, 17 in C, 291
copy constructor, 468 in Java, 423
in PHP, 535
De Morgan’s laws, 72
debugger, 152 garbage collection, 165
debugging, 46, 49 Gauss’s Formula, 222
deep copy, 166, 353 generic programming, 212
defensive programming, 48, 84, 153 global scope, 32
disjunction, see logical operators–or graphical user interface, 42
do-while loop, 100
dot operator, 346 hardware, 5
dynamic memory, 164 heap, 160
dynamic programming, 209 Heap Sort, 237
dynamic typing, 31 Hello World
C, 253
elementary operation, 215 hello world
encapsulation, 30, 197 Java, 384
C, 341 hexadecimal, 6
enumerated type, 30 hoisting, 134, 535
enumerated types
in Java, 436 identifier, 18
error code, 154 if statement, 75
error handling, 151 if-else statement, 76
exception, 155 if-else-if statement, 78
in C, 305 immutable, 423
in Java, 431 index, 160
in PHP, 543 infinite loop, 97, 103
exception, 155 Insertion Sort, 224
Integrated Development Environment, 6
fatal error, 153 interpreted language, 8
file, 183 invoking functions, 136
file I/O, 183
in C, 335 Java
in Java, 457 arrays, 439
in PHP, 563 Comparators, 483
first-class citizen, 142 conditionals, 403
floating point number, 25 enumerated types, 436
flowchart, 17 error handling, 431
for loop, 99 file I/O, 457
foreach loop, 102, 161 loops, 415
function hoisting, 535 methods, 423
function pointers, 365 objects, 461
function prototype, 291 recursion, 479
606
Index
strings, 449 null, 30
kilobyte, 5 object, 30, 197
objects, 197
lambda expression, 493 defining, 198
linear search, 212 in Java, 461
C, 372 using, 200
linked list, 167
open recursion, 200, 465
linter, 152
in PHP, 569
list
operator, 33
in Java, 444
logical, 65
lists, 167
operators
literal, 34
addition, 35
logic errors, 48
arithmetic, 35
logical operators, 65
assignment, see asignment opera-
and, 69
tor33
negation, 68
C, 262
or, 70
compound assignment, 40
loops, 95
division, 35
do-while loop, 100
increment, 40
for loop, 99
integer division, 37
foreach loop, 102
multiplication, 35
in C, 283
negation, 35
in Java, 415
string concatenation, 37
in PHP, 527
subtraction, 35
infinite loop, 103
optional parameters, 145
while loop, 97
order of precedence, 38
lower camel casing, 20
logic, 73
main memory, 6 overflow, 39
mantissa, 25 overloading, 483
maps, 168
member methods, 198 parse, 179
member variables, 198 pass by reference, 297, 423
memoization, 208, 358 pass by value, 423
memory, 5 paths, 184
memory leak, 165, 326 absolute, 184
memory management, 165 relative, 184
Merge Sort, 232 persistence, 183
method overloading, 423 PHP
multidimensional arrays, 166, 443 arrays, 547
conditionals, 515
natural order, 242 error handling, 543
nested loops, 103 file I/O, 563
nesting, 84 functions, 535
607
Index
loops, 527 Sorting
magic method, 571 C, 374
recursion, 577 sorting, 211, 220
strings, 557 Heap Sort, 237
pointers, 295 Insertion Sort, 224
pollute the namespace, 33 Merge Sort, 232
polymorphism, 374 Quick Sort, 227
preprocessor directive, 255 Selection Sort, 221
primitive types, 30 stability, 243
printf, 43 Tim Sort, 237
problem solving, 2 stack overflow, 162, 345
procedural abstraction, 134, 301 standard input, 42
program stack, 137 standard output, 42
pseudocode, 14, 50 static array, 160
static typing, 31
Quick Sort, 227 static vs dynamic memory, 162
recursion, 203 strings, 27, 177
C, 357 comparison, 178
in Java, 479 in C, 325
in PHP, 577 in Java, 449
reentrant, 334 in PHP, 557
regression testing, 48 tokenizing, 179
runtime errors, 47 structures, 341
arrays, 348
scope, 32, 134 defining, 341
global, 137 style guide, 20, 22
local, 136 syntactic sugar, 40
search syntax error, 13, 47
binary search, 213
tail recursion, 205
linear search, 212
tautology, 72
search algorithm
ternary if-else operator, 82
analysis, 215
test case, 49
searching, 211
test cases, 48
segmentation fault, 264, 296
testing, 3
Selection Sort, 221
Tim Sort, 237
analysis, 222
top-down design, 4, 133
sequential control flow, 13
transpiler, 13
set, 167
truncation, 36
in Java, 446
try-with-resources, 458
sets, 167
two’s complement, 24
shallow copy, 166, 353
type casting, 36, 263
short circuiting, 74
type juggling, 505
software, 5
software testing, 48 unbuffered, 187
608
Index
underflow, 39
underscore casing, 20
unicode, 29
upper camel casing, 20
use case, 3
vararg function, 145, 424
variable, 18
identifier, 18
naming conventions, 19
naming rules, 19
scope, 32
types, 22
variable argument function, see vararg
function
variables
C, 260
visibility, 197, 424, 462
while loop, 97
609
Bibliography
[1] Mars climate orbiter. http://mars.jpl.nasa.gov/msp98/orbiter/, 1999. [Online;
accessed 17-March-2015].
[2] Moth in the machine: Debugging the origins of ‘bug’. Computer World Magazine,
September 2011.
[3] errno.h: system error numbers - base definitions reference. http://pubs.opengroup.
org/onlinepubs/9699919799/basedefs/errno.h.html, 2013. [Online; accessed
13-September-2015].
[4] ISO/IEC 9899 - Programming Languages - C. http://www.open-std.org/JTC1/
SC22/WG14/www/standards, 2013.
[5] Java platform standard edition 7. http://docs.oracle.com/javase/7/docs/api/,
2015. [Online; accessed 10-February-2015].
[6] List of software bugs. https://en.wikipedia.org/wiki/List_of_software_bugs,
2015. [Online; accessed 12-September-2015].
[7] Unchecked exceptions — the controversy. https://docs.oracle.com/javase/
tutorial/essential/exceptions/runtime.html, 2015. [Online; accessed 15-
September-2015].
[8] Douglas Adams. Dirk Gently’s Holistic Detective Agency. Pocket Books, 1987.
[9] Jon L. Bentley and M. Douglas McIlroy. Engineering a sort function. Softw. Pract.
Exper., 23(11):1249–1265, November 1993.
[10] Joshua Bloch. Extra, extra - read all about it: Nearly all binary searches
and mergesorts are broken. http://googleresearch.blogspot.com/2006/06/
extra-extra-read-all-about-it-nearly.html, 2006.
[11] Michael Braukus. NASA honors apollo engineer. NASA News, September 2003.
[12] IEEE Computer Society. Portable Applications Standards Committee, England)
Open Group (Reading, Institute of Electrical, Electronics Engineers, and IEEE-
SA Standards Board. Standard for Information Technology: Portable Operating
System Interface (POSIX) : Base Specifications. Number Issue 7 in IEEE Std. 2008.
611
Bibliography
[13] Edsger W. Dijkstra. Why numbering should start at zero. https://www.cs.utexas.
edu/users/EWD/transcriptions/EWD08xx/EWD831.html, 1982. [Online; accessed
September 25, 2015].
[14] Bruce Eckel. Thinking in Java. Prentice Hall PTR, Upper Saddle River, NJ, USA,
4th edition, 2005.
[15] Internet Goons. Do i cast the result of malloc? http://stackoverflow.
com/questions/605845/do-i-cast-the-result-of-malloc. [Online; accessed
September 27, 2015].
[16] Arend Heyting. Die formalen Regeln der intuitionistischen Logik. Berlin, 1930. First
use of the notation ¬ as a negation operator.
[17] C. A. R. Hoare. Algorithm 64: Quicksort. Commun. ACM, 4(7):321–, July 1961.
[18] C. A. R. Hoare. Quicksort. The Computer Journal, 5(1):10–16, 1962.
[19] IEC. IEC 60559 (1989-01): Binary floating-point arithmetic for microprocessor
systems. 1989. This Standard was formerly known as IEEE 754.
[20] IEEE Task P754. IEEE 754-2008, Standard for Floating-Point Arithmetic. August
2008.
[21] Donald E. Eastlake III, Carl-Uno Manros, and Eric S. Raymond. Etymology of
”foo”. RFC, 3092:1–14, 2001.
[22] ISO. ISO 8601:1988. Data elements and interchange formats — Information inter-
change — Representation of dates and times. 1988. See also 1-page correction, ISO
8601:1988/Cor 1:1991.
[23] John McCarthy. Towards a mathematical science of computation. In In IFIP
Congress, pages 21–28. North-Holland, 1962.
[24] Poul-Henning Kamp. The bikeshed email. http://phk.freebsd.dk/sagas/
bikeshed.html. [Online; accessed September 12, 2016].
[25] Brian W. Kernighan. Programming in C – A Tutorial. Bell Laboratories, Murray
Hill, New Jersey, 1974.
[26] Brian W. Kernighan. The C Programming Language. Prentice Hall Professional
Technical Reference, 2nd edition, 1988.
[27] Donald E. Knuth. Von neumann’s first computer program. ACM Comput. Surv.,
2(4):247–260, December 1970.
[28] Tony Long. The man who saved the world by doing ... nothing. Wired, September
2007.
612
Bibliography
[29] M. V. Wilkes, D. J. Wheeler and S. Gill. The preparation of programs for an
electronic digital computer, with special reference to the EDSAC and the use of a
library of subroutines. Addison-Wesley Press, Cambridge, Mass., 1951.
[30] John Morton. On recursive reference. Cognition, 4(4):309, 1976.
[31] United States Government Accountability Office. COLLEGE TEXTBOOKS: Stu-
dents have greater access to textbook information (gao-13-368), 2013.
[32] Cyril Northcote Parkinson. Parkinson’s Law, or the Pursuit of Progress. John
Murray, London, 1958.
[33] Richard E. Pattis. Textbook errors in binary searching. In Proceedings of the
Nineteenth SIGCSE Technical Symposium on Computer Science Education, SIGCSE
’88, pages 190–194, New York, NY, USA, 1988. ACM.
[34] Giuseppe Peano. Studii de Logica Matematica. In Atti della Reale Accademia delle
scienze di Torino, volume 32 of Classe di Scienze Fisiche Matematiche e Naturali,
pages 565–583. Accademia delle Scienze di Torino, Torino, April 1897.
[35] Tim Peters. [Python-Dev] Sorting. Python-Dev mailing list, https://mail.python.
org/pipermail/python-dev/2002-July/026837.html, July 2002.
[36] Bertrand Russell. The theory of implication. American Journal of Mathematics,
28:159–202, 1906.
[37] Bruce A. Tate. Seven Languages in Seven Weeks: A Pragmatic Guide to Learning
Programming Languages. Pragmatic Bookshelf, 1st edition, 2010.
[38] Alfred North Whitehead and Bertrand Arthur William Russell. Principia mathe-
matica; vol. 1. Cambridge Univ. Press, Cambridge, 1910.
[39] J. W. J. Williams. Algorithm 232: Heapsort. Communications of the ACM, 7(6):347–
348, 1964.
613