-sequence seqall
The sequence from which to choose primers. The sequence
must be presented 5' to 3'
-primer toggle
Tell EPrimer3 to pick primer(s) Default value: Y
-task list
Tell EPrimer3 what task to perform. Legal values are 1:
'Pick PCR primers', 2: 'Pick forward primer only', 3: 'Pick reverse primer
only', 4: 'No primers needed'. Default value: 1
-hybridprobe toggle
An 'internal oligo' is intended to be used as a
hybridization probe (hyb probe) to detect the PCR product after amplification.
Default value: N
-mishyblibraryfile infile
Similar to MISPRIMING-LIBRARY, except that the event we
seek to avoid is hybridization of the internal oligo to sequences in this
library rather than priming from them. The file must be in (a slightly
restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp
2444-2448 [1988]); we briefly discuss the organization of this file below. If
this parameter is specified then EPrimer3 locally aligns each candidate oligo
against each library sequence and rejects those primers for which the local
alignment score times a specified weight (see below) exceeds
INTERNAL-OLIGO-MAX-MISHYB. (The maximum value of the weight is arbitrarily set
to 12.0.) Each sequence entry in the FASTA-format file must begin with an 'id
line' that starts with '>'. The contents of the id line is 'slightly
restricted' in that EPrimer3 parses everything after any optional asterisk
('*') as a floating point number to use as the weight mentioned above. If the
id line contains no asterisk then the weight defaults to 1.0. The alignment
scoring system used is the same as for calculating complementarity among
oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as
lines following the id line up until a line starting with '>' or the end of
the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C',
'a', 't', 'g', 'c' are retained and any other character is converted to 'N'
(with the consequence that any IUB / IUPAC codes for ambiguous bases are
converted to 'N'). There are no restrictions on line length. An empty value
for this parameter indicates that no library should be used.
-mispriminglibraryfile infile
The name of a file containing a nucleotide sequence
library of sequences to avoid amplifying (for example repetitive sequences, or
possibly the sequences of genes in a gene family that should not be
amplified.) The file must be in (a slightly restricted) FASTA format (W. B.
Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss
the organization of this file below. If this parameter is specified then
EPrimer3 locally aligns each candidate primer against each library sequence
and rejects those primers for which the local alignment score times a
specified weight (see below) exceeds MAX-MISPRIMING. (The maximum value of the
weight is arbitrarily set to 100.0.) Each sequence entry in the FASTA-format
file must begin with an 'id line' that starts with '>'. The contents of the
id line is 'slightly restricted' in that EPrimer3 parses everything after any
optional asterisk ('*') as a floating point number to use as the weight
mentioned above. If the id line contains no asterisk then the weight defaults
to 1.0. The alignment scoring system used is the same as for calculating
complementarity among oligos (e.g. SELF-ANY). The remainder of an entry
contains the sequence as lines following the id line up until a line starting
with '>' or the end of the file. Whitespace and newlines are ignored.
Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other
character is converted to 'N' (with the consequence that any IUB / IUPAC codes
for ambiguous bases are converted to 'N'). There are no restrictions on line
length. An empty value for this parameter indicates that no repeat library
should be used.
-numreturn integer
The maximum number of primer pairs to return. Primer
pairs returned are sorted by their 'quality', in other words by the value of
the objective function (where a lower number indicates a better primer pair).
Caution: setting this parameter to a large value will increase running time.
Default value: 5
-includedregion range
A sub-region of the given sequence in which to pick
primers. For example, often the first dozen or so bases of a sequence are
vector, and should be excluded from consideration. The value for this
parameter has the form (start),(end) where (start) is the index of the first
base to consider, and (end) is the last in the primer-picking region.
-targetregion range
If one or more Targets is specified then a legal primer
pair must flank at least one of them. A Target might be a simple sequence
repeat site (for example a CA repeat) or a single-base-pair polymorphism. The
value should be a space-separated list of (start),(end) pairs where (start) is
the index of the first base of a Target, and (end) is the last E.g. 50,51
requires primers to surround the 2 bases at positions 50 and 51.
-excludedregion range
Primer oligos may not overlap any region specified in
this tag. The associated value must be a space-separated list of (start),(end)
pairs where (start) is the index of the first base of the excluded region, and
and (end) is the last. This tag is useful for tasks such as excluding regions
of low sequence quality or for excluding regions containing repetitive
elements such as ALUs or LINEs. E.g. 401,407 68,70 forbids selection of
primers in the 7 bases starting at 401 and the 3 bases at 68.
-forwardinput string
The sequence of a forward primer to check and around
which to design reverse primers and optional internal oligos. Must be a
substring of SEQUENCE.
-reverseinput string
The sequence of a reverse primer to check and around
which to design forward primers and optional internal oligos. Must be a
substring of the reverse strand of SEQUENCE.
-gcclamp integer
Require the specified number of consecutive Gs and Cs at
the 3' end of both the forward and reverse primer. (This parameter has no
effect on the internal oligo if one is requested.)
-osize integer
Optimum length (in bases) of a primer oligo. EPrimer3
will attempt to pick primers close to this length. Default value: 20
-minsize integer
Minimum acceptable length of a primer. Must be greater
than 0 and less than or equal to MAX-SIZE. Default value: 18
-maxsize integer
Maximum acceptable length (in bases) of a primer.
Currently this parameter cannot be larger than 35. This limit is governed by
the maximum oligo size for which EPrimer3's melting-temperature is valid.
Default value: 27
-otm float
Optimum melting temperature(Celsius) for a primer oligo.
EPrimer3 will try to pick primers with melting temperatures are close to this
temperature. The oligo melting temperature formula in EPrimer3 is that given
in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp
6409-6412 and Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci.
USA, vol 83, pp 3746-3750. Please refer to the former paper for background
discussion. Default value: 60.0
-mintm float
Minimum acceptable melting temperature(Celsius) for a
primer oligo. Default value: 57.0
-maxtm float
Maximum acceptable melting temperature(Celsius) for a
primer oligo. Default value: 63.0
-maxdifftm float
Maximum acceptable (unsigned) difference between the
melting temperatures of the forward and reverse primers. Default value:
100.0
-ogcpercent float
Primer optimum GC percent. Default value: 50.0
-mingc float
Minimum allowable percentage of Gs and Cs in any primer.
Default value: 20.0
-maxgc float
Maximum allowable percentage of Gs and Cs in any primer
generated by Primer. Default value: 80.0
-saltconc float
The millimolar concentration of salt (usually KCl) in the
PCR. EPrimer3 uses this argument to calculate oligo melting temperatures.
Default value: 50.0
-dnaconc float
The nanomolar concentration of annealing oligos in the
PCR. EPrimer3 uses this argument to calculate oligo melting temperatures. The
default (50nM) works well with the standard protocol used at the Whitehead/MIT
Center for Genome Research--0.5 microliters of 20 micromolar concentration for
each primer oligo in a 20 microliter reaction with 10 nanograms template,
0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM
KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of
56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and
Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 21) where a
suitable value (for a lower initial concentration of template) is 'empirically
determined'. The value of this parameter is less than the actual concentration
of oligos in the reaction because it is the concentration of annealing oligos,
which in turn depends on the amount of template (including PCR product) in a
given cycle. This concentration increases a great deal during a PCR;
fortunately PCR seems quite robust for a variety of oligo melting
temperatures. See ADVICE FOR PICKING PRIMERS. Default value: 50.0
-maxpolyx integer
The maximum allowable length of a mononucleotide repeat
in a primer, for example AAAAAA. Default value: 5
-psizeopt integer
The optimum size for the PCR product. 0 indicates that
there is no optimum product size. Default value: 200
-prange range
The associated values specify the lengths of the product
that the user wants the primers to create, and is a space separated list of
elements of the form (x)-(y) where an (x)-(y) pair is a legal range of lengths
for the product. For example, if one wants PCR products to be between 100 to
150 bases (inclusive) then one would set this parameter to 100-150. If one
desires PCR products in either the range from 100 to 150 bases or in the range
from 200 to 250 bases then one would set this parameter to 100-150 200-250.
EPrimer3 favors ranges to the left side of the parameter string. EPrimer3 will
return legal primers pairs in the first range regardless the value of the
objective function for these pairs. Only if there are an insufficient number
of primers in the first range will EPrimer3 return primers in a subsequent
range. Default value: 100-300
-ptmopt float
The optimum melting temperature for the PCR product. 0
indicates that there is no optimum temperature. Default value: 0.0
-ptmmin float
The minimum allowed melting temperature of the amplicon.
Please see the documentation on the maximum melting temperature of the product
for details. Default value: -1000000.0
-ptmmax float
The maximum allowed melting temperature of the amplicon.
Product Tm is calculated using the formula from Bolton and McCarthy, PNAS
84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular
Cloning, p 11.46 (1989, CSHL Press). Tm = 81.5 + 16.6(log10([Na+])) +
.41*(%GC) - 600/length Where [Na+} is the molar sodium concentration, (%GC) is
the percent of Gs and Cs in the sequence, and length is the length of the
sequence. A similar formula is used by the prime primer selection program in
GCG, which instead uses 675.0/length in the last term (after F. Baldino, Jr,
M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1)
on page 766 without the mismatch and formamide terms). The formulas here and
in Baldino et al. assume Na+ rather than K+. According to J.G. Wetmur,
Critical Reviews in BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be
equivalent in these formulae to .2 M Na+. EPrimer3 uses the same salt
concentration value for calculating both the primer melting temperature and
the oligo melting temperature. If you are planning to use the PCR product for
hybridization later this behavior will not give you the Tm under hybridization
conditions. Default value: 1000000.0
-oexcludedregion range
Middle oligos may not overlap any region specified by
this tag. The associated value must be a space-separated list of (start),(end)
pairs, where (start) is the index of the first base of an excluded region, and
(end) is the last. Often one would make Target regions excluded regions for
internal oligos.
-oligoinput string
The sequence of an internal oligo to check and around
which to design forward and reverse primers. Must be a substring of
SEQUENCE.
-osizeopt integer
Optimum length (in bases) of an internal oligo. EPrimer3
will attempt to pick primers close to this length. Default value: 20
-ominsize integer
Minimum acceptable length of an internal oligo. Must be
greater than 0 and less than or equal to INTERNAL-OLIGO-MAX-SIZE. Default
value: 18
-omaxsize integer
Maximum acceptable length (in bases) of an internal
oligo. Currently this parameter cannot be larger than 35. This limit is
governed by maximum oligo size for which EPrimer3's melting-temperature is
valid. Default value: 27
-otmopt float
Optimum melting temperature (Celsius) for an internal
oligo. EPrimer3 will try to pick oligos with melting temperatures that are
close to this temperature. The oligo melting temperature formula in EPrimer3
is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18,
num 21, pp 6409-6412 and Breslauer, Frank, Bloecker and Marky, Proc. Natl.
Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for
background discussion. Default value: 60.0
-otmmin float
Minimum acceptable melting temperature(Celsius) for an
internal oligo. Default value: 57.0
-otmmax float
Maximum acceptable melting temperature (Celsius) for an
internal oligo. Default value: 63.0
-ogcopt float
Internal oligo optimum GC percent. Default value:
50.0
-ogcmin float
Minimum allowable percentage of Gs and Cs in an internal
oligo. Default value: 20.0
-ogcmax float
Maximum allowable percentage of Gs and Cs in any internal
oligo generated by Primer. Default value: 80.0
-osaltconc float
The millimolar concentration of salt (usually KCl) in the
hybridization. EPrimer3 uses this argument to calculate internal oligo melting
temperatures. Default value: 50.0
-odnaconc float
The nanomolar concentration of annealing internal oligo
in the hybridization. Default value: 50.0
-oanyself float
The maximum allowable local alignment score when testing
an internal oligo for (local) self-complementarity. Local self-complementarity
is taken to predict the tendency of oligos to anneal to themselves The scoring
system gives 1.00 for complementary bases, -0.25 for a match of any base (or
N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair
gaps are allowed. For example, the alignment 5' ATCGNA 3' || | | 3' TA-CGT 5'
is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' || |
| 3' TA--CGT 5' is not considered. Scores are non-negative, and a score of
0.00 indicates that there is no reasonable local alignment between two oligos.
Default value: 12.00
-oendself float
The maximum allowable 3'-anchored global alignment score
when testing a single oligo for self-complementarity. The scoring system is as
for the Maximum Complementarity argument. In the examples above the scores are
7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00
indicates that there is no reasonable 3'-anchored global alignment between two
oligos. In order to estimate 3'-anchored global alignments for candidate
oligos, Primer assumes that the sequence from which to choose oligos is
presented 5' to 3'. INTERNAL-OLIGO-SELF-END is meaningless when applied to
internal oligos used for hybridization-based detection, since primer-dimer
will not occur. We recommend that INTERNAL-OLIGO-SELF-END be set at least as
high as INTERNAL-OLIGO-SELF-ANY. Default value: 12.00
-opolyxmax integer
The maximum allowable length of an internal oligo
mononucleotide repeat, for example AAAAAA. Default value: 5
-omishybmax float
Similar to MAX-MISPRIMING except that this parameter
applies to the similarity of candidate internal oligos to the library
specified in INTERNAL-OLIGO-MISHYB-LIBRARY. Default value: 12.0
-explainflag boolean
If this flag is true, produce LEFT-EXPLAIN,
RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN output tags, which are intended to
provide information on the number of oligos and primer pairs that EPrimer3
examined, and statistics on the number discarded for various reasons. Default
value: N
-fileflag boolean
If the associated value is true, then EPrimer3 creates
two output files for each input SEQUENCE. File (sequence-id).for lists all
acceptable forward primers for (sequence-id), and (sequence-id).rev lists all
acceptable reverse primers for (sequence-id), where (sequence-id) is the value
of the SEQUENCE-ID tag (which must be supplied). In addition, if the input tag
TASK is 1 or 4, EPrimer3 produces a file (sequence-id).int, which lists all
acceptable internal oligos. Default value: N
-firstbaseindex integer
This parameter is the index of the first base in the
input sequence. For input and output using 1-based indexing (such as that used
in GenBank and to which many users are accustomed) set this parameter to 1.
For input and output using 0-based indexing set this parameter to 0. (This
parameter also affects the indexes in the contents of the files produced when
the primer file flag is set.) Default value: 1
-pickanyway boolean
If true pick a primer pair even if LEFT-INPUT,
RIGHT-INPUT, or INTERNAL-OLIGO-INPUT violates specific constraints. Default
value: N
-maxmispriming float
The maximum allowed weighted similarity with any sequence
in MISPRIMING-LIBRARY. Default value: 12.00
-pairmaxmispriming float
The maximum allowed sum of weighted similarities of a
primer pair (one similarity for each primer) with any single sequence in
MISPRIMING-LIBRARY. Default value: 24.00
-numnsaccepted integer
Maximum number of unknown bases (N) allowable in any
primer.
-selfany float
The maximum allowable local alignment score when testing
a single primer for (local) self-complementarity and the maximum allowable
local alignment score when testing for complementarity between forward and
reverse primers. Local self-complementarity is taken to predict the tendency
of primers to anneal to each other without necessarily causing self-priming in
the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a
match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap.
Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA
3' ...|| | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the
alignment 5' ATCCGNA 3' ...|| | | 3' TA--CGT 5' is not considered. Scores are
non-negative, and a score of 0.00 indicates that there is no reasonable local
alignment between two oligos. Default value: 8.00
-selfend float
The maximum allowable 3'-anchored global alignment score
when testing a single primer for self-complementarity, and the maximum
allowable 3'-anchored global alignment score when testing for complementarity
between forward and reverse primers. The 3'-anchored global alignment score is
taken to predict the likelihood of PCR-priming primer-dimers, for example 5'
ATGCCCTAGCTTCCGGATG 3' .............||| ||||| ..........3'
AAGTCCTACATTTAGCCTAGT 5' or 5' AGGCTATGGGCCTCGCGA 3' ...............||||||
............3' AGCGCTCCGGGTATCGGA 5' The scoring system is as for the Maximum
Complementarity argument. In the examples above the scores are 7.00 and 6.00
respectively. Scores are non-negative, and a score of 0.00 indicates that
there is no reasonable 3'-anchored global alignment between two oligos. In
order to estimate 3'-anchored global alignments for candidate primers and
primer pairs, Primer assumes that the sequence from which to choose primers is
presented 5' to 3'. It is nonsensical to provide a larger value for this
parameter than for the Maximum (local) Complementarity parameter because the
score of a local alignment will always be at least as great as the score of a
global alignment. Default value: 3.00
-maxendstability float
The maximum stability for the five 3' bases of a forward
or reverse primer. Bigger numbers mean more stable 3' ends. The value is the
maximum delta G for duplex disruption for the five 3' bases as calculated
using the nearest neighbor parameters published in Breslauer, Frank, Bloecker
and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. EPrimer3 uses a
completely permissive default value for backward compatibility (which we may
change in the next release). Rychlik recommends a maximum value of 9 (Wojciech
Rychlik, 'Selection of Primers for Polymerase Chain Reaction' in BA White,
Ed., 'Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods
and Applications', 1993, pp 31-40, Humana Press, Totowa NJ). Default value:
9.0