| GT-FINGERPRINT(1) | GenomeTools Manual | GT-FINGERPRINT(1) |
gt-fingerprint - Compute MD5 fingerprints for each sequence given in a set of sequence files.
gt fingerprint [option ...] sequence_file [...]
-check [filename]
-duplicates [yes|no]
-extract [string]
-width [value]
-o [filename]
-gzip [yes|no]
-bzip2 [yes|no]
-force [yes|no]
-help
-version
If neither option -check nor option -duplicates is used, the fingerprints for all sequences are shown on stdout.
Fingerprint of a sequence is case insensitive. Thus MD5 fingerprint of two identical sequences will be the same even if one is soft-masked.
Compute (unified) list of fingerprints:
$ gt fingerprint U89959_ests.fas | sort | uniq > U89959_ests.checklist_uniq
Compare fingerprints:
$ gt fingerprint -check U89959_ests.checklist_uniq U89959_ests.fas 950b7715ab6cc030a8c810a0dba2dd33 only in sequence_file(s)
Make sure a sequence file contains no duplicates (not the case here):
$ gt fingerprint -duplicates U89959_ests.fas 950b7715ab6cc030a8c810a0dba2dd33 2 gt fingerprint: error: duplicates found: 1 out of 200 (0.500%)
Extract sequence with given fingerprint:
$ gt fingerprint -extract 6d3b4b9db4531cda588528f2c69c0a57 U89959_ests.fas >SQ;8720010 TTTTTTTTTTTTTTTTTCCTGACAAAACCCCAAGACTCAATTTAATCAATCCTCAAATTTACATGATAC CAACGTAATGGGAGCTTAAAAATA
Report bugs to https://github.com/genometools/genometools/issues.
| 10/28/2018 | GenomeTools 1.5.10 |