tqs - Trim Quality Solexa-Illumina Sequences
Quality trim solexa-Illumina sequence reads using user-defined
thresholds.
- -h, --help
- show this help message and exit
- -f SEQFILE, --sequence
file=SEQFILE
- Illumina sequence file - Output format from the 1G Genome Analyzer
(_seq.txt):
7 1 255 669
AACCCCCACTCCTACAACGCCATCATTCCCCTCGAC
- -q QUALFILE, --qual file=QUALFILE
- A prb file containing all the Illumina intensities, as outputted by the 1G
Genome Analyzer (_prb.txt)
- -l MER, --length=MER
- Length of sequence reads (i.e. Number of sequencing cycles,
default=36)
- -t THRESHOLD,
--threshold=THRESHOLD
- Base intensity threshold value (-40 to 40, default=5)
- -d DIFF, --difference=DIFF
- Base intensity difference between top intensity and second best (1 to 80,
default=5)
- -c CONSEC, --consec=CONSEC
- Minimum number of consecutive bases passing threshold values
(default=20)
- -v, --verbose
- Runs in Verbose mode.
/usr/share/doc/ssake/TQS.readme
This manual page was written by Andreas Tille
<tille@debian.org> for the Debian system (but may be used by
others). Permission is granted to copy, distribute and/or modify this
document under the terms of the GNU General Public License, Version 2 any
later version published by the Free Software Foundation.
On Debian systems, the complete text of the GNU General Public
License can be found in /usr/share/common-licenses/GPL.