DOKK / manpages / debian 11 / ssake / tqs.1.en
TQS(1) General Commands Manual TQS(1)

tqs - Trim Quality Solexa-Illumina Sequences

Quality trim solexa-Illumina sequence reads using user-defined thresholds.

show this help message and exit
Illumina sequence file - Output format from the 1G Genome Analyzer (_seq.txt):
7 1 255 669
AACCCCCACTCCTACAACGCCATCATTCCCCTCGAC
A prb file containing all the Illumina intensities, as outputted by the 1G Genome Analyzer (_prb.txt)
Length of sequence reads (i.e. Number of sequencing cycles, default=36)
Base intensity threshold value (-40 to 40, default=5)
Base intensity difference between top intensity and second best (1 to 80, default=5)
Minimum number of consecutive bases passing threshold values (default=20)
Runs in Verbose mode.

/usr/share/doc/ssake/TQS.readme

This manual page was written by Andreas Tille <tille@debian.org> for the Debian system (but may be used by others). Permission is granted to copy, distribute and/or modify this document under the terms of the GNU General Public License, Version 2 any later version published by the Free Software Foundation.

On Debian systems, the complete text of the GNU General Public License can be found in /usr/share/common-licenses/GPL.

January 2008