NAME

trf - locate and display tandem repeats in DNA sequences

SYNOPSIS

OPTIONS

Where: (all weights, penalties, and scores are positive)

File: sequences input file
Match: matching weight
Mismatch: mismatching penalty
Delta: indel penalty
PM: match probability (whole number)
PI: indel probability (whole number)
Minscore: minimum alignment score to report
MaxPeriod: maximum period size to report

[options] = one or more of the following:

-m: masked sequence file
-f: flanking sequence
-d: data file
-h: suppress html output
-r: no redundancy elimination
-l <n>: maximum TR length expected (in millions) (eg, -l 3 or -l=3 for 3 million) Human genome HG38 would need -l 6
-ngs: more compact .dat output on multisequence files, returns 0 on success. Output is printed to the screen, not a file. You may pipe input in with this option using - for file name. Short 50 flanks are appended to .dat output.

NOTE

Note the sequence file should be in FASTA format:

>Name of sequence aggaaacctgccatggcctcctggtgagctgtcctcatccactgctcgctgcctctccag atactctgacccatggatcccctgggtgcagccaagccacaatggccatggcgccgctgt actcccacccgccccaccctcctgatcctgctatggacatggcctttccacatccctgtg

AUTHOR

This manpage was written by Andreas Tille for the Debian distribution and can be used for any other usage of the program.

June 2020