6.3.3.1. bam2bed¶
The bam2bed script converts 0-based, half-open [start-1, end) Binary (Sequence) Alignment/Map (BAM) to sorted, 0-based, half-open [start-1, end) UCSC BED data.
For convenience, we also offer bam2starch, which performs the extra step of creating a Starch-formatted archive.
The bam2bed script is “non-lossy”. Similar tools in the world tend to throw out information from the original BAM input upon conversion; bam2bed retains everything, facilitating reuse of converted data and conversion to other formats.
Tip
Doing the extra step of creating a Starch-formatted archive can save a lot of space relative to the original BAM format, up to 33% of the original BAM dataset, while offering per-chromosome random access.
6.3.3.1.1. Dependencies¶
This python shell script is dependent upon the installation of SAMtools and Python, version 2.7 or greater.
6.3.3.1.2. Source¶
The bam2bed and bam2starch conversion scripts are part of the binary and source downloads of BEDOPS. See the Installation documentation for more details.
6.3.3.1.3. Usage¶
The bam2bed script parses BAM data from standard input and prints sorted BED to standard output. The bam2starch script uses an extra step to parse BAM to a compressed BEDOPS Starch-formatted archive, which is also directed to standard output.
Tip
If you work with RNA-seq data, you can use the --split option to process reads with N-CIGAR operations, splitting them into separate BED elements.
Tip
By default, all conversion scripts now output sorted BED data ready for use with BEDOPS utilities. If you do not want to sort converted output, use the --do-not-sort option. Run the script with the --help option for more details.
Tip
If you are sorting data larger than system memory, use the --max-mem option to limit sort memory usage to a reasonable fraction of available memory, e.g., --max-mem 2G or similar. See --help for more details.
6.3.3.1.4. Example¶
To demonstrate these scripts, we use a sample binary input called foo.bam (see the Downloads section to grab this file).
We can convert it to sorted BED data in the following manner (omitting standard error messages):
$ bam2bed < foo.bam
seq1 0 36 B7_591:4:96:693:509 73 + 99 36M * 0 0 CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG <<<<<<<<<<<<<<<;<<<<<<<<<5<<<<<;:<;7 MF:i:18 Aq:i:73 NM:i:0 UQ:i:0 H0:i:1 H1:i:0
seq1 2 37 EAS54_65:7:152:368:113 73 + 99 35M * 0 0 CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT <<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6): MF:i:18 Aq:i:66 NM:i:0 UQ:i:0 H0:i:1 H1:i:0
seq1 4 39 EAS51_64:8:5:734:57 137 + 99 35M * 0 0 AGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCC <<<<<<<<<<<7;71<<;<;;<7;<<3;);3*8/5 MF:i:18 Aq:i:66 NM:i:0 UQ:i:0 H0:i:1 H1:i:0
seq1 5 41 B7_591:1:289:587:906 137 + 63 36M * 0 0 GTGGCTCATTGTAATTTTTTGTTTTAACTCTTCTCT (-&----,----)-)-),'--)---',+-,),''*, MF:i:130 Aq:i:63 NM:i:5 UQ:i:38 H0:i:0 H1:i:0
...
Note
The provided scripts strip out unmapped reads from the BAM file. We believe this makes sense under most circumstances. Add the --all-reads option if you need unmapped and mapped reads.
